- Email: [email protected]
Autoinducer-2 of quorum sensing is involved in cell damage caused by avian pathogenic Escherichia coli
Microbial Pathogenesis 99 (2016) 247e252
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
Autoinducer-2 of quorum sensing is involved in cell damage caused by avian pathogenic Escherichia coli Zhen-Qiang Cui 1, Zong-Mei Wu 1, Yun-Xing Fu, Dao-Xiu Xu, Xun Guo, Hai-Qing Shen, Xu-Bin Wei, Peng-Fei Yi, Ben-Dong Fu* Department of Clinical Veterinary Medicine, College of Veterinary Medicine, Jilin University, No. 5333 Xi'an Road, Changchun, Jilin 130062, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 20 July 2016 Received in revised form 14 August 2016 Accepted 24 August 2016 Available online 25 August 2016
Avian pathogenic Escherichia coli (APEC) infections are responsible for great losses in the poultry industry. Quorum sensing (QS) acts as a global regulatory system that controls genes involved in bacterial pathogenesis, metabolism and protein biosynthesis. However, whether QS of APEC is related to cell damage has not been elucidated. In the present study, we explored the correlation between the damage of chicken type II pneumocytes induced by APEC and the autoinducer-2 (AI-2) activity of APEC. The results showed that when chicken type II pneumocytes were co-cultured with 108 CFU/ml of APEC-O78 for 6 h, the release of LDH reached the highest level (192.5 ± 13.4 U/L) (P < 0.01), and the percentages of dead cells followed the same trend in trypan blue exclusion assay. In addition, the AI-2 activity of cellfree culture fluid (CF) reached the maximum value after 6 h co-culture with 108 CFU/ml of APEC-O78. At the same time, the mRNA expressions of eight virulence genes (papC, fimA, fimC, hlyE, ompA, luxS, pfs, and qseA) of 108 CFU/ml APEC-O78 were significantly increased compared with those of 107 CFU/ml, and the mRNA expressions of four virulence genes (hlyE, tsh, iss, and luxS) of 108 CFU/ml APEC-O78 were higher than those of 109 CFU/ml (p < 0.05) after incubation for 6 h. These results suggested that AI-2-mediated QS is involved in the cell damage induced by APEC-O78, indicating AI-2 may be one new potential target for preventing chicken colibacillosis. © 2016 Elsevier Ltd. All rights reserved.
Keywords: Autoinducer-2 Quorum sensing Avian pathogenic Escherichia coli Cell damage Chicken type II pneumocyte
1. Introduction Avian pathogenic Escherichia coli (APEC) causes a wide range of localized or systemic diseases in avian species with a variety of clinical signs, including septicemia, air sacculitis and salpingitis [1]. In Asia, O78 is the most frequently detected serotype [2]. APEC contains a number of virulence factors, including iron uptake chelate gene D (iucD), iron regulatory protein 2 (irp-2), type 1 pili fimA gene (fimA); type 1 pili fimC gene (fimC), pyelonephritisassociated pili papC (papC), temperature-sensitive hemagglutinin gene (tsh), hemolysin E (hlyE), serum survival gene (iss), outer membrane proteins A (ompA), and vacuolating autotransporter toxin gene (vat), among others. These virulence factors are associated with bacterial iron acquisition, metabolism, adhesion and invasion, and serum survival to attack the host [3,4]. APEC infection begins in the upper respiratory tract [5] and breaches the blood-air
* Corresponding author. E-mail address: [email protected] (B.-D. Fu). 1 Zhen-Qiang Cui and Zong-Mei Wu contributed equally to this work. http://dx.doi.org/10.1016/j.micpath.2016.08.033 0882-4010/© 2016 Elsevier Ltd. All rights reserved.
barrier to induce septicemia [6]. Type II pneumocytes play an important role of maintaining the function of bloodeair barrier [7,8], and APEC can invade chicken type II pneumocytes [9]. Quorum sensing (QS) is a bacterial intercellular communication system, involving the production and detection of autoinducers (AIs). Microorganism use QS to control the multiple virulence expression of genes, regulate survival [10] and coordinate particular phenotypic features [11]. Autoinducer-2 (AI-2) is a furanosyl boronated diester molecule, and has been deemed as a language between Gram-negative and Gram-positive bacteria for intraspecies and inter-species communication [12,13], which is synthesized dependent on the enzyme LuxS and pfs [12]. Quorum sensing was demonstrated to act as a key player in the expression of virulence genes at stationary phase in diffusible Escherichia coli [14e18]. In addition, it is reported that K88 ETEC (JG280)-induced cell death was cell density dependent, 108 CFU/ml of strain caused more death of IPEC-J2 cells than did 109 CFU/ml, and, there is a positive correlation between AI-2 activity of JG280 and death of IPEC-J2 cells during the infection [19]. However, the role of QS in APEC pathogenesis also has not been clearly
248
Z.-Q. Cui et al. / Microbial Pathogenesis 99 (2016) 247e252
elucidated. Therefore, in this study, we set out to investigate the association between AI-2 and cell damage caused by APEC-O78.
as follows: Cytotoxicity (%) ¼ (blue cells/total cells counted) 100. 2.5. Preparation of cell-free culture fluid (CF)
2. Materials and methods 2.1. Bacterial strains and culture conditions APEC-O78 strain (CVCC1418) was purchased from the China Veterinary Culture Collection Center (CVCC, Beijing, China), which was isolated from the heart of chicken with septicemia signs. The bacteria were grown routinely in peptone culture media agar plates at 37 C. Vibrio harveyi BB152 (V. harveyi BB152) (sensor1þsensor2þ) strain was provided by Dr. Han, Xian-Gan of Shanghai Veterinary Research Institute (CAAS, Shanghai, China), Vibrio harveyi BB170 (V. harveyi BB170) (sensor1-sensor2þ) strain was donated by Dr. Ke, Cai-Huan of the College of Ocean & Earth Sciences (Xiamen University, Xiamen, China) and cultivated in modified autoinducer bioassay [19] medium at 30 C [20]. E. coli DH5a was purchased from Takara Bio Inc. Chemical reagents were of analytical quality where available. 2.2. Culture of chicken type II pneumocytes This assay was performed as described previously [9] with modifications. Briefly, lung tissue samples of 13-day-old chicken embryos were cut into small tissue blocks of about 1 cubic centimeter, and then the 0.25% trypsin and 0.1% IV collagenase (Invitrogen-Gibco, Grand Island, NY, USA) were added for digestion at 37 C for 10 min and 15 min, respectively. Cell suspensions were filtrated by 200 mesh sieve, re-suspended with 10% fetal bovine serum (FBS) in a 100-mm culture plate, incubated for 1 h, and then the supernatants with the unattached cells were collected for three times. The unattached cells were centrifuged at 1200 r/min for 5 min, re-suspended in fresh Dulbecco's modified Eagle's medium (DMEM) for three times, filtrated by 400 mesh sieve, and cells were incubated for 18 h at 37 C. The attaching cells on culture dish were chicken type II pneumocytes. 2.3. Lactate dehydrogenase (LDH) activity detection Chicken type II pneumocytes were seeded in 24-well plates and incubated in DMEM with 20% FBS for 18 h to 90% confluence. The cells of each well were infected with 400 ml APEC-O78 (107e109 CFU/ml) for 3, 6 and 9 h. Cells handled with DMEM with 20% FBS served as controls. The supernatants were collected after centrifugation at 300 g for 5 min and 12,000 g for 10 min. The LDH activity was determined according to the manufacturer's protocol (Jiancheng Technology Co., Nanjing, China). LDH activity was calculated as follows: LDH activity (U/L)¼ (Aexp Acon)/ (Asta Abla) 0.2 1000, where Aexp is the absorbance of test samples, Acon is the absorbance of control samples, Asta is the absorbance of standard hole, and Abla is the absorbance of blank wells. 2.4. Cell viability assay Cell death of chicken type II pneumocytes was initially assessed by Trypan blue staining for quantitative analysis of cell viability [19]. Cells were treated as described in LDH detection. After being harvested, cells were washed twice with phosphate buffer saline (PBS), then concentrated to 100 ml, and stained with 0.4% trypan blue for 5 min at room temperature. To assess cell viability, approximately 100 cells were counted with a hemocytometer for each experiment. The total numbers of cells and blue cells (dead cells) were counted. The percentage of cytotoxicity was calculated
Cell-free culture fluid (CF) was performed as described previously [21]. V. harveyi BB152 were grown to an optical density 600 nm (OD600) of 2.0 in 50 ml of AB medium contained in 250-ml flasks. CF were collected by being centrifuged at 12,000 g for 10 min at 4 C, and the resulting supernatant was further filtered through a 0.22 mm filter (Pall Corporation, Ann Arbor, MI, USA). CF preparations of DH5a and APEC-O78 were collected in a similar way. 2.6. AI-2 bioluminescence assay The AI-2 bioluminescence assay was performed as described previously [22], with modifications. Cell-free culture fluids from E. coli and V. harveyi strains BB152 were tested for the presence of signaling substances that could induce luminescence in the V. harveyi reporter strain BB170. CF of V. harveyi BB152 was used as a positive control, and CF of DH5a served as a negative control, CF of APEC-O78 (40 ml) boiled at 121 C for 15 min was used as a blank control. In order to establish the optimum AI-2 bioluminescence assay, we chose 0e40 ml of CF from APEC-O78strains, added to the black flat-bottomed 96-well plates (Corning Costar, Fisher Scientific, Canada), the reporter strain V. harveyi BB170 was grown in AB medium to OD600 of 2.0, diluted at 1: 5000 with fresh AB medium, and then 160e200 ml inoculum of the V. harveyi BB170 was supplemented, total reaction volume is 200 mL per well and incubated at 30 C for 2e5 h. Bioluminescence was measured via BHP9504 microplate luminescence analyzer (Beijing Hamamatsu Photonics Technology Co., Beijing, China). The AI-2-mediated bioluminescence was expressed as induction (n-fold) over the negative control. The experiments were repeated three times. 2.7. The growth curve and AI-2 activity of APEC-O78 in different growth phases APEC-O78 were grown at 37 C overnight with aeration in LuriaeBertani (LB) broth. The next morning fresh LB medium used for the overnight growth was inoculated at a 1:100 dilution with the overnight-grown cultures. Then extracting the 5.0 mL mixture to 14 tubes. The 14 tubes inoculated in a shaker, at 37 C, 200 rpm. Respectively at 0e26 h with the number corresponding to the time of the test tube removed, taking 1.0 mLe1.5 mL extraction centrifuge tube, for measuring the optical density, fresh LB medium as control, using the BioPhotometer analyzer in 600 nm wavelength. The remaining 4 mL broth were subjected to centrifugation for 10 min at 12,000 g, the supernatant were filtered through a 0.22 mm filter membrane, 80 C stored for use. CF samples were prepared from different phases, corresponding at 0e26 h. The AI-2 activities in CF samples were tested as described above. The experiments were done in triplicate. 2.8. AI-2 activity of APEC-O78 co-cultured with chicken type II pneumocytes The chicken type II pneumocytes were incubated with 107, 108, and 109 CFU/ml of APEC-O78 for 3, 6 and 9 h, cells handled with equivalence medium were used as controls. The supernatant was collected by centrifuging at 12,000 g for 10 min and further filtered through a 0.22 mm filter. The reporter strain V. harveyi BB170 was grown in AB medium to OD600 of 2.0, diluted at 1:5000 with fresh AB medium. The 20 ml above supernatant was diluted 10fold with 180 ml V. harveyi BB170 dilution, then added to black flat-
Z.-Q. Cui et al. / Microbial Pathogenesis 99 (2016) 247e252
bottomed 96-well plates (Corning Costar, Fisher Scientific, Canada), and incubated at 30 C for 4 h. The presence of AI-2 activity in the culture supernatant was tested as described above. The experiments were done in triplicate.
249
2.10. Statistical analysis The data were evaluated using one-way ANOVA in SPSS 13.0 software (SPSS Inc., Chicago, IL, USA). Data are presented as means ± SD. P values of less than 0.05 were considered significant. 3. Results
2.9. Reverse transcription polymerase chain reaction (RT-PCR) analysis Chicken type II pneumocytes were treated as described in LDH detection. The supernatants were collected after centrifugation at 300 g for 5 min, and the bacteria were collected by being centrifuged at 12,000 g for 10 min at 4 C. Total RNA was isolated using Trizol reagent (Invitrogen Co., USA) according to the standard procedures. For each RT-PCR reaction, 2 mg of total RNA were subjected to synthesize cDNA using Bio RT cDNA First Strand Synthesis Kit (Bioer Technology, Hangzhou, China). RT-PCR was performed in a total volume of 25 ml containing 12.5 ml of 2 Power Tap PCR MasterMix (Biotechs Corporation, Changchun, China), 2 ml of cDNA, 1 ml of 10 mM forward primer, 1 ml of 10 mM reverse primer, and 8.5 ml of ddH2O water. Parameters of PCR conditions were as follows: 94 C for 3 min for one cycle, then 94 C for 30 s, 51.8e59.5 C for 30 s, 72 C for 45 s for 30e35 cycles, and 72 C for 10 min for one cycle. Primer sets were listed in http://www.ncbi.nlm.nih.gov/pmc/ articles/PMC2875385/-SD2 Table 1. The amplified PCR products were separated by 2% agarose gel electrophoresis and visualized with ethidium bromide staining and UV irradiation. The dnaE was acted as a house-keeping control gene. Relative change in gene expression was recorded as follows: Relative ratio of target gene ¼ (expression of target gene/expression of dnaE) [23].
NC_020163.1
3.3. The growth curve and AI-2 levels in different growth phases
Amplicon (bp)
Sequence (50 to 30 )
Accession No.
papC-F papC-R fimA-F fimA-R fimC-F fimC-R iucD-F iucD-R iroN-F iroN -R iutA-F iutA-R irp-2-F irp-2-R fuyA-F fuyA-R hlyE-F hlyE-R tsh-F tsh-R ompA-F ompA-R iss-F iss-R vat-F vat-R luxS-F luxS-R pfs-F pfs-R qseA-F qseA-R DnaE-F dnaE-R
329
CGGGATTGCGGAGACTAA CGCCATACAGCGACCACT CCGTTCAGTTAGGACAGGTT TGGTTCCGTTATTCAGGGT CACCGCCACTGTTTGTTA TCAGCTTTCCCTGCACTC ACAAAAAGTTCTATCGCTTCC CCTGATCCAGATGATGCTC GTCGCTAACTGTGCTCCTG CGCCCTCATCGCTACTTT TCAACCCACTGCTTCTTACC GCCACGCACATTCATACC CAACCATTCGTCCACTCCC CTCAGACCGTCAAGCAACAG CTAATGCCCAGACTTCACAGC TCCGGTACAGCCCAAACAC ATCCGCCCAGAAAGACAT GCCCGCAGCAATAGAATA ACGAACTGGGAAGTATGG TTACGACGCATTGAGACA ATGGGTTATGACTGGTTAGG GTTGTTGGTCCACTGGTATT TGGCAATGCTTATTACAGG CGAAGAAATGATGGGTGA ACCCTCTGACAAGGACACG CACTGAATCCCACAACCC ACGCCATTACCGTTAAGATG AGTGATGCCAGAAAGAGGGA TTGTCTCGGACGAAGCAC GCAACAGCCAGGAACTCAT GCTGCCGTCGTATGCTTC CGCTCAAACCTGGGTATTCT TATGCGTAGCGAAGAGGAG GCCATTGTACCGAAGGTGA
NC_008563.1
693 557 254 437 993 276 379 282 99 101 128 373 165 594
3.2. Measurement of AI-2
NC_020163.1
Primer name
405
The release of LDH from chicken type II pneumocytes, which exposed to the APEC-O78 (107e109 CFU/ml), have no significant difference compared to the control group (126.1 ± 6.8 U/L) after 3 h of incubation. However, while cells were co-cultured with APECO78 for 6 h, APEC-O78 induced 181.3 ± 3.9, 192.5 ± 13.4 and 186.6 ± 10.2 U/L release of LDH from chicken type II pneumocytes at 107, 108 and 109 CFU/ml, respectively, which were significantly higher than 125.4 ± 9.8 U/L of control group. When the co-culture time reached to 9 h, cells exposed to 109 CFU/ml APEC-O78 induced significantly more LDH compared to control group (P < 0.01) (Fig. 1A). Similar observations were seen with trypan blue exclusion assay. Less 3% blue cells (dead cells) were observed at 3 h. APECO78 at 108 CFU/ml induced 27.0 ± 6.0% and 33.0 ± 5.3% dead cells at 6 h and 9 h, respectively. APEC-O78 at 109 CFU/ml also induced similar percentage of dead cells at 6 h and 9 h, which were significantly higher than control (P < 0.01) (Fig. 1B).
Fig. 2 showed that the bioluminescence is plotted as a function of time, and increase in proportion to the amount of CF. By measuring the fluorescence intensity to determine the optimum addition's amount of CF from APEC-O78strains and incubation time. Almost no bioluminescence induction was observed from 0 h to 3 h, but, it was dramatically increased at 4 h. The bioluminescence of CF of APEC-O78 boiled at 121 C for 15 min was very low. Therefore, the optimized measurement condition is 1:10 for the proportion of CF to the inoculum of V. harveyi BB170 and incubation at 30 C for 4 h.
Table 1 PCR primers.
294
3.1. Cytotoxicity of APEC-O78 to chicken type II pneumocytes
NC_011747.1 NC_007675.1 NC_011964.1 NC_008563.1 NC_008563.1 NC_020163.1 NC_007675.1 NC_007946.1 NC_020163.1 NC_008563.1
According to the above described measurement condition, the AI-2 activities of APEC-O78 in different growth phases were examined. As shown in Fig. 3, APEC-O78 was then incubated at 37 C for 0e1.5 h, OD600 slowly rising, 3e8 h, OD600 became logarithmic increase, 10e18 h, its value was stable at about 2.5, no longer as time changes, but when the bacterial was then incubated at 37 C for 22 h, the OD600 decreased. In different growth phases APEC - O78 can secrete different levels of the AI-2. The bioluminescence intensity induced by CF of APEC-O78 increased from lag phase to the late log phase (0e12 h). The levels of AI-2 were increased markedly and reached the maximum value in the late log phase. However, there were almost little or no bioluminescence detected in the lag phase, stationary phase and death phase. 3.4. AI-2 activity of APEC-O78 co-cultured with chicken type II pneumocytes
NC_007779.1 NC_013353.1 NC_002655.2 NC_002695.1
To determine whether the bacterial density-dependent cell death of APEC-O78 associated with bacterial quorum sensing, we examined AI-2 activity of APEC-O78 co-cultured with chicken type II pneumocytes. The AI-2 levels of CF from the co-culture with APEC-O78 secreted (107 CFU/ml) increased gradually after 6 h of incubation, and reached the highest level at 9 h of incubation.
250
Z.-Q. Cui et al. / Microbial Pathogenesis 99 (2016) 247e252
Fig. 1. (A) Lactate dehydrogenase (LDH) activity of the chicken type II pneumocytes. (B) Quantitative analysis of chicken type II pneumocytes viability by trypan blue exclusion assay. The chicken type II pneumocytes were infected with APEC-O78 (107e109 CFU/ml) for 3e9 h, cells handled with equivalence medium used as controls. Each sample had triplicates in the assay. The values represent mean ± SD of three independent experiments. **P < 0.01 vs. control groups.
Fig. 2. Measurement of AI-2. Different amounts of CF (0e40 ml) were added to the black flat-bottomed 96-well plates, and then V. harveyi BB170 dilution were added to give a total volume of 200 ml per well. The mixture was incubated at 30 C for 2e5 h. The CF samples of V. harveyi BB152, DH5a and APEC-O78 (boiled at 121 C for 15 min) were used as a positive control, negative control, and blank control, respectively. The result of AI-2-mediated bioluminescence was expressed as induction (n-fold) over the negative control. The values represent mean ± SD of three independent experiments. Error bars indicate standard deviations.
While the AI-2 levels of CF from the co-culture with 108 and 109 CFU/ml of APEC-O78 secreted reached the maximum value after 6 h of incubation (Fig. 4). The CF from cells in the absence of APEC-O78 had no AI-2 activity.
3.5. The expressions of virulence genes in different concentrations of APEC The RT-PCR results showed that the mRNA levels of eight virulence genes (papC, fimA, fimC, hlyE, ompA, luxS, pfs, and qseA) were significantly increased, and one genes (vat) was significantly decreased in 108 CFU/ml compared with 107 CFU/ml (p < 0.05). The mRNA levels of four virulence genes (hlyE, tsh, iss, and luxS) were significantly increased in the initial inoculums of 108 CFU/ml than those in 109 CFU/ml. There was no difference in the expression of six genes (iucD, iroN, iutA, iss, rap-2, and fuyA) between each group (Fig. 5 and Table 2).
Fig. 3. The growth curve and AI-2 activity of APEC-O78 in different growth phases. The CF samples were prepared from different phases of APEC-O78, corresponding at 0e26 h. The AI-2 activities were tested as described. The CF samples of V. harveyi BB152 and DH5a were used as a positive control and negative control, respectively. The turbidity of medium was represented as the optical density 600 (OD600). The values represent mean ± SD of three independent experiments. Error bars indicate standard deviations.
4. Discussion In the present study, we found that APEC-induced cell damage was correlated with the production of AI-2. APEC-O78 at 108 CFU/ ml caused significantly more cell death of chicken type II pneumocytes than at 107 and 109 CFU/ml. Similarly, eight virulence genes (papC, fimA, fimC, hlyE, ompA, luxS, pfs, and qseA) of 108 CFU/ ml APEC-O78 were significantly increased compared with those of 107 CFU/ml, and four virulence genes (hlyE, tsh, iss, and luxS) of 108 CFU/ml APEC-O78 were more higher than those of 109 CFU/ml. The QS is a global regulatory system that controls not only genes involved in pathogenesis but also genes involved in bacterial metabolism, DNA repair, nucleotide and protein biosynthesis [24]. In this study, we found that the AI-2 activity and the mRNA expressions of the virulence genes of APEC-O78 (108 CFU/ml) reached the maximum value at late log phase (6 h incubation). As both of them are controlled by QS, we hypothesized that the virulence gene expressions of APEC-O78 were also mediated by AI-2 of QS. LDH is a biological enzyme as a marker for common injuries, and LDH release from cells was useful for determining the virulence
Z.-Q. Cui et al. / Microbial Pathogenesis 99 (2016) 247e252
251
Table 2 The transcriptional levels of selected genes.
Fig. 4. AI-2 activity of APEC-O78 co-cultured with chicken type II pneumocytes. The chicken type II pneumocytes were incubated with 107, 108, and 109 CFU/ml of APEC-O78 for 3, 6 and 9 h, cells handled with equivalence medium were used as controls. The presence of AI-2 activity in the culture supernatant was tested as described. The values represent mean ± SD of three independent experiments. **P < 0.01 vs. group of cells treated with 108 CFU/ml APEC-O78.
Fig. 5. Effect of different concentrations of APEC on the mRNA expression of virulence genes. Ferric uptake regulator: iucD, fuyA, irp-2, iroN, and iutA; adhesin factors: fimA, fimC, and papC; haemolysin: tsh, and hlyE; antiserum survival factor: iss, and ompA; vacuolating autotransporter toxin gene: vat; and regulator of QS: luxS, pfs, and qseA. The chicken type II pneumocytes were incubated with 107, 108, and109 CFU/ ml of APEC-O78 for 6 h. Then the bacteria were collected, total RNA was isolated, and RT-PCR reaction was carried out as described.
potential of E. coli strains [25]. Interestingly, 108 CFU/ml of APECO78 significantly caused more cell death of chicken type II pneumocytes than 107 and 109 CFU/ml after 6 h incubation in LDH and trypan blue exclusion assays. Similar observations were also found that there is a positive correlation between AI-2 activity and death of IPEC-J2 cells during exposed to JG280 [19]. In addition, the inhibition of AI-2 production by deleting luxS gene significantly decreased the virulence of APEC [26]. Therefore, we speculated that AI-2 plays a major role in regulating APEC-O78-induced cell damage. Many bacterial species possess the luxS and pfs gene, and produce AI-2 to induce luminescence in V. harveyi, including salmonellae, H. pylori, streptococci, E. coli, and others [27]. To understand the association between AI-2 and cell damage caused by APEC-O78, we focused on the ability of APEC-O78 to produce AI-2. In this study, APEC-O78 produced AI-2 and induced the bioluminescence
Genes
107 CFU/mL
paC fimA fimC iucD Iron iutA hlyE tsh ompA iss rap-2 fuyA vat luxS Pfs qseA
0.87 0.67 0.48 1.16 1.12 0.94 0.64 0.98 0.65 0.69 0.99 0.88 0.85 0.77 0.77 0.84
± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±
0.04** 0.04* 0.02* 0.03 0.06 0.05 0.05** 0.06 0.03* 0.04 0.05 0.04 0.04* 0.05* 0.03* 0.06*
108 CFU/mL 1.20 0.82 0.59 1.20 1.16 0.91 0.89 0.93 0.79 0.70 1.00 0.89 0.70 0.96 0.95 1.05
± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±
0.04 0.05 0.02 0.07 0.10 0.05 0.04 0.06 0.03 0.05 0.05 0.03 0.06 0.03 0.04 0.04
109 CFU/mL 1.04 0.76 0.57 1.11 1.14 0.87 0.73 0.74 0.84 0.53 1.01 0.97 0.69 0.80 0.97 1.10
± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±
0.06 0.02 0.04 0.09 0.10 0.04 0.04* 0.02* 0.05 0.06* 0.06 0.05 0.03 0.04* 0.07 0.06
The mRNA level of each gene was normalized to that of dnaE. Each value shown represents the mean ± SD of three different determinations.**P < 0.01, *P < 0.05 vs. the group of cells treated with 108 CFU/ml APECO78.
of reporter V. harveyi BB170. It has been reported the autoinducer activity is heat sensitive [28,29], similarly our results confirmed that AI-2 lost the biological activity after being boiled. This also proved that the autoinducer bioassays was to detect bacterial metabolites rather than an inhibitory substance present in fresh medium [28]. AI-2 activity reached the maximum value at late log phase, and declined steeply in the stationary phase, suggesting that AI-2 activity of APEC-O78 is density dependent, in accordance with the results in Streptococcus oralis [30]. In Salmonella typhimurium, AI-2 is also produced and released during exponential growth, and is subsequently imported into the bacteria via the Lsr ATP binding cassette (ABC) transporter [31]. A number of genes, associated with bacterial iron acquisition, metabolism, adhesion and invasion, serum survival, and virulence, have been identified, and ultimately result in APEC infection to the host [3,4]. The F1 and P pili, and Tsh mediated the colonization of APEC to internal organs [32]. Then, toxins and effector proteins enter host cells and modify host physiology to induce injury through protein secretion systems [33]. The genes responsible for the formation of AE lesions are located on the locus of enterocyte effacement [34,35], while, qseA activate the transcription of the LEE genes [36]. DNA microarrays hybridization identified 242 genes of E. coli (up-regulated 154 genes, repressed 88 genes) that are controlled by AI-2 [17]. Type III secretion systems of both enterohemorrhagic E. coli (EHEC) and enteropathogenic E. coli (EPEC) have also been shown to be controlled by QS [18]. The loss of AI-2 activity significantly reduced the adherence and invasion percentage of APEC and the mRNA levels of the virulence-related genes [26]. In this study, the mRNA levels of eight virulence genes (papC, fimA, fimC, hlyE, ompA, luxS, pfs, and qseA) of 108 CFU/ml APEC-O78 were significantly increased compared with those of 107 CFU/ml, and the mRNA of four virulence genes (hlyE, tsh, iss, and luxS) of 108 CFU/ml APEC-O78 were more higher than those of 109 CFU/ml. Our results demonstrated that the down-regulation of the virulence genes, such as adhesion (fimA, fimC, and papC), haemolysin (tsh and hlyE), and serum survival gene (iss and ompA), reduced the cell damage induced by APEC. In conclusion, AI-2-mediated QS may down regulate the mRNA levels of virulence genes, and then decrease the damage of chicken type II pneumocytes induced by APEC-O78. These results indicated that AI-2 may be one new potential target for preventing chicken colibacillosis.
252
Z.-Q. Cui et al. / Microbial Pathogenesis 99 (2016) 247e252
Conflict of interest The authors have declared no conflict of interest. Acknowledgements We thank Matthew Engel, Cornell University for very carefully editing the manuscript. This work was supported by the National Natural Science Foundation of China (No. 31372470), and China Postdoctoral Science Special Foundation (No. 2014T70297). References [1] T. Knobl, A.M. Moreno, R. Paixao, T.A. Gomes, M.A. Vieira, D. da Silva Leite, et al., Prevalence of avian pathogenic Escherichia coli (APEC) clone harboring sfa gene in Brazil, Sci.World J. 2012 (2012) 437342. [2] F. Orskov, I. Orskov, Escherichia coli serotyping and disease in man and animals, Can. J. Microbiol. 38 (1992) 699e704. [3] R.H. Olsen, M.S. Chadfield, J.P. Christensen, F. Scheutz, H. Christensen, M. Bisgaard, Clonality and virulence traits of Escherichia coli associated with haemorrhagic septicaemia in turkeys, Avian Pathol. J. WVPA 40 (2011) 587e595. [4] T.J. Johnson, Y. Wannemuehler, S. Kariyawasam, J.R. Johnson, C.M. Logue, L.K. Nolan, Prevalence of avian-pathogenic Escherichia coli strain O1 genomic islands among extraintestinal and commensal E. coli isolates, J. Bacteriol. 194 (2012) 2846e2853. [5] S. Edelman, S. Leskela, E. Ron, J. Apajalahti, T.K. Korhonen, In vitro adhesion of an avian pathogenic Escherichia coli O78 strain to surfaces of the chicken intestinal tract and to ileal mucus, Veterinary Microbiol. 91 (2003) 41e56. [6] S.A. Pourbakhsh, M. Boulianne, B. Martineau-Doize, J.M. Fairbrother, Virulence mechanisms of avian fimbriated Escherichia coli in experimentally inoculated chickens, Veterinary Microbiol. 58 (1997) 195e213. [7] J.N. Maina, A.S. King, The thickness of avian blood-gas barrier: qualitative and quantitative observations, J. Anat. 134 (1982) 553e562. [8] R.J. Swain, S.J. Kemp, P. Goldstraw, T.D. Tetley, M.M. Stevens, Spectral monitoring of surfactant clearance during alveolar epithelial type II cell differentiation, Biophysical J. 95 (2008) 5978e5987. [9] L.Y. Zhang, S. Lv, S.C. Wu, X. Guo, F. Xia, X.R. Hu, et al., Inhibitory effects of alpha-cyperone on adherence and invasion of avian pathogenic Escherichia coli O78 to chicken type II pneumocytes, Veterinary Immunol. Immunopathol. 159 (2014) 50e57. [10] N.C. Reading, V. Sperandio, Quorum sensing: the many languages of bacteria, FEMS Microbiol. Lett. 254 (2006) 1e11. [11] W.C. Fuqua, S.C. Winans, E.P. Greenberg, Quorum sensing in bacteria: the LuxR-LuxI family of cell density-responsive transcriptional regulators, J. Bacteriol. 176 (1994) 269e275. [12] S. Schauder, K. Shokat, M.G. Surette, B.L. Bassler, The LuxS family of bacterial autoinducers: biosynthesis of a novel quorum-sensing signal molecule, Mol. Microbiol. 41 (2001) 463e476. [13] B.L. Bassler, Small talk. Cell-to-cell communication in bacteria, Cell 109 (2002) 421e424. [14] G.W. Huisman, R. Kolter, Sensing starvation: a homoserine lactoneedependent signaling pathway in Escherichia coli, Science 265 (1994) 537e539. [15] B.A. Lazazzera, Quorum sensing and starvation: signals for entry into stationary phase, Curr. Opin. Microbiol. 3 (2000) 177e182. [16] D.M. Sitnikov, J.B. Schineller, T.O. Baldwin, Control of cell division in Escherichia coli: regulation of transcription of ftsQA involves both rpoS and SdiAmediated autoinduction, Proc. Natl. Acad. Sci. U. S. A. 93 (1996) 336e341.
[17] M.P. DeLisa, C.F. Wu, L. Wang, J.J. Valdes, W.E. Bentley, DNA microarray-based identification of genes controlled by autoinducer 2-stimulated quorum sensing in Escherichia coli, J. Bacteriol. 183 (2001) 5239e5247. [18] V. Sperandio, J.L. Mellies, W. Nguyen, S. Shin, J.B. Kaper, Quorum sensing controls expression of the type III secretion gene transcription and protein secretion in enterohemorrhagic and enteropathogenic Escherichia coli, Proc. Natl. Acad. Sci. U. S. A. 96 (1999) 15196e15201. [19] J. Zhu, X. Yin, H. Yu, L. Zhao, P. Sabour, J. Gong, Involvement of quorum sensing and heat-stable enterotoxin a in cell damage caused by a porcine enterotoxigenic Escherichia coli strain, Infect Immun 79 (2011) 1688e1695. [20] B.L. Bassler, E.P. Greenberg, A.M. Stevens, Cross-species induction of luminescence in the quorum-sensing bacterium Vibrio harveyi, J. Bacteriol. 179 (1997) 4043e4045. [21] T. Zhu, D.X. Wang, W. Zhang, X.Q. Liao, X. Guan, H. Bo, et al., Andrographolide protects against LPS-induced acute lung injury by inactivation of NF-kappaB, PloS One 8 (2013) e56407. [22] X.G. Han, C.P. Lu, Detection of autoinducer-2 and analysis of the profile of luxS and pfs transcription in Streptococcus suis serotype 2, Curr. Microbiol. 58 (2009) 146e152. [23] X.M. Wang, X.P. Liao, W.J. Zhang, H.X. Jiang, J. Sun, M.J. Zhang, et al., Prevalence of serogroups, virulence genotypes, antimicrobial resistance, and phylogenetic background of avian pathogenic Escherichia coli in south of China, Foodborne Pathogens Dis. 7 (2010) 1099e1106. [24] V. Sperandio, A.G. Torres, J.A. Giron, J.B. Kaper, Quorum sensing is a global regulatory mechanism in enterohemorrhagic Escherichia coli O157:H7, J. Bacteriol. 183 (2001) 5187e5197. [25] Y. Maldonado, J.C. Fiser, C.H. Nakatsu, A.K. Bhunia, Cytotoxicity potential and genotypic characterization of Escherichia coli isolates from environmental and food sources, Appl. Environ. Microbiol. 71 (2005) 1890e1898. [26] X. Han, H. Bai, L. Liu, H. Dong, R. Liu, J. Song, et al., The luxS gene functions in the pathogenesis of avian pathogenic Escherichia coli, Microb. Pathog. 55 (2013) 21e27. [27] M.G. Surette, M.B. Miller, B.L. Bassler, Quorum sensing in Escherichia coli, Salmonella typhimurium, and Vibrio harveyi: a new family of genes responsible for autoinducer production, Proc. Natl. Acad. Sci. U. S. A. 96 (1999) 1639e1644. [28] A. Eberhard, Inhibition and activation of bacterial luciferase synthesis, J. Bacteriol. 109 (1972) 1101e1105. [29] A.L. Beeston, M.G. Surette, pfs-dependent regulation of autoinducer 2 production in Salmonella enterica serovar Typhimurium, J. Bacteriol. 184 (2002) 3450e3456. [30] A.H. Rickard, R.J. Palmer Jr., D.S. Blehert, S.R. Campagna, M.F. Semmelhack, P.G. Egland, et al., Autoinducer 2: a concentration-dependent signal for mutualistic bacterial biofilm growth, Mol. Microbiol. 60 (2006) 1446e1456. [31] M.E. Taga, S.T. Miller, B.L. Bassler, Lsr-mediated transport and processing of AI-2 in Salmonella typhimurium, Mol. Microbiol. 50 (2003) 1411e1427. [32] W. Dias da Silveira, A. Ferreira, M. Brocchi, L. Maria de Hollanda, A.F. Pestana de Castro, A. Tatsumi Yamada, et al., Biological characteristics and pathogenicity of avian Escherichia coli strains, Veterinary Microbiol. 85 (2002) 47e53. [33] T.T. Tseng, B.M. Tyler, J.C. Setubal, Protein secretion systems in bacterial-host associations, and their description in the Gene Ontology, BMC Microbiol. 9 (Suppl 1) (2009) S2. [34] P. Wintachai, P. Kaur, R.C.H. Lee, S. Ramphan, A. Kuadkitkan, N. Wikan, et al., Activity of andrographolide against chikungunya virus infection, Sci. Rep. 5 (2015) 14179. [35] T.K. McDaniel, K.G. Jarvis, M.S. Donnenberg, J.B. Kaper, A genetic locus of enterocyte effacement conserved among diverse enterobacterial pathogens, Proc. Natl. Acad. Sci. U. S. A. 92 (1995) 1664e1668. [36] V. Sperandio, C.C. Li, J.B. Kaper, Quorum-sensing Escherichia coli regulator A: a regulator of the LysR family involved in the regulation of the locus of enterocyte effacement pathogenicity island in enterohemorrhagic E. coli, Infect. Immun. 70 (2002) 3085e3093.
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
Autoinducer-2 of quorum sensing is involved in cell damage caused by avian pathogenic Escherichia coli Zhen-Qiang Cui 1, Zong-Mei Wu 1, Yun-Xing Fu, Dao-Xiu Xu, Xun Guo, Hai-Qing Shen, Xu-Bin Wei, Peng-Fei Yi, Ben-Dong Fu* Department of Clinical Veterinary Medicine, College of Veterinary Medicine, Jilin University, No. 5333 Xi'an Road, Changchun, Jilin 130062, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 20 July 2016 Received in revised form 14 August 2016 Accepted 24 August 2016 Available online 25 August 2016
Avian pathogenic Escherichia coli (APEC) infections are responsible for great losses in the poultry industry. Quorum sensing (QS) acts as a global regulatory system that controls genes involved in bacterial pathogenesis, metabolism and protein biosynthesis. However, whether QS of APEC is related to cell damage has not been elucidated. In the present study, we explored the correlation between the damage of chicken type II pneumocytes induced by APEC and the autoinducer-2 (AI-2) activity of APEC. The results showed that when chicken type II pneumocytes were co-cultured with 108 CFU/ml of APEC-O78 for 6 h, the release of LDH reached the highest level (192.5 ± 13.4 U/L) (P < 0.01), and the percentages of dead cells followed the same trend in trypan blue exclusion assay. In addition, the AI-2 activity of cellfree culture fluid (CF) reached the maximum value after 6 h co-culture with 108 CFU/ml of APEC-O78. At the same time, the mRNA expressions of eight virulence genes (papC, fimA, fimC, hlyE, ompA, luxS, pfs, and qseA) of 108 CFU/ml APEC-O78 were significantly increased compared with those of 107 CFU/ml, and the mRNA expressions of four virulence genes (hlyE, tsh, iss, and luxS) of 108 CFU/ml APEC-O78 were higher than those of 109 CFU/ml (p < 0.05) after incubation for 6 h. These results suggested that AI-2-mediated QS is involved in the cell damage induced by APEC-O78, indicating AI-2 may be one new potential target for preventing chicken colibacillosis. © 2016 Elsevier Ltd. All rights reserved.
Keywords: Autoinducer-2 Quorum sensing Avian pathogenic Escherichia coli Cell damage Chicken type II pneumocyte
1. Introduction Avian pathogenic Escherichia coli (APEC) causes a wide range of localized or systemic diseases in avian species with a variety of clinical signs, including septicemia, air sacculitis and salpingitis [1]. In Asia, O78 is the most frequently detected serotype [2]. APEC contains a number of virulence factors, including iron uptake chelate gene D (iucD), iron regulatory protein 2 (irp-2), type 1 pili fimA gene (fimA); type 1 pili fimC gene (fimC), pyelonephritisassociated pili papC (papC), temperature-sensitive hemagglutinin gene (tsh), hemolysin E (hlyE), serum survival gene (iss), outer membrane proteins A (ompA), and vacuolating autotransporter toxin gene (vat), among others. These virulence factors are associated with bacterial iron acquisition, metabolism, adhesion and invasion, and serum survival to attack the host [3,4]. APEC infection begins in the upper respiratory tract [5] and breaches the blood-air
* Corresponding author. E-mail address: [email protected] (B.-D. Fu). 1 Zhen-Qiang Cui and Zong-Mei Wu contributed equally to this work. http://dx.doi.org/10.1016/j.micpath.2016.08.033 0882-4010/© 2016 Elsevier Ltd. All rights reserved.
barrier to induce septicemia [6]. Type II pneumocytes play an important role of maintaining the function of bloodeair barrier [7,8], and APEC can invade chicken type II pneumocytes [9]. Quorum sensing (QS) is a bacterial intercellular communication system, involving the production and detection of autoinducers (AIs). Microorganism use QS to control the multiple virulence expression of genes, regulate survival [10] and coordinate particular phenotypic features [11]. Autoinducer-2 (AI-2) is a furanosyl boronated diester molecule, and has been deemed as a language between Gram-negative and Gram-positive bacteria for intraspecies and inter-species communication [12,13], which is synthesized dependent on the enzyme LuxS and pfs [12]. Quorum sensing was demonstrated to act as a key player in the expression of virulence genes at stationary phase in diffusible Escherichia coli [14e18]. In addition, it is reported that K88 ETEC (JG280)-induced cell death was cell density dependent, 108 CFU/ml of strain caused more death of IPEC-J2 cells than did 109 CFU/ml, and, there is a positive correlation between AI-2 activity of JG280 and death of IPEC-J2 cells during the infection [19]. However, the role of QS in APEC pathogenesis also has not been clearly
248
Z.-Q. Cui et al. / Microbial Pathogenesis 99 (2016) 247e252
elucidated. Therefore, in this study, we set out to investigate the association between AI-2 and cell damage caused by APEC-O78.
as follows: Cytotoxicity (%) ¼ (blue cells/total cells counted) 100. 2.5. Preparation of cell-free culture fluid (CF)
2. Materials and methods 2.1. Bacterial strains and culture conditions APEC-O78 strain (CVCC1418) was purchased from the China Veterinary Culture Collection Center (CVCC, Beijing, China), which was isolated from the heart of chicken with septicemia signs. The bacteria were grown routinely in peptone culture media agar plates at 37 C. Vibrio harveyi BB152 (V. harveyi BB152) (sensor1þsensor2þ) strain was provided by Dr. Han, Xian-Gan of Shanghai Veterinary Research Institute (CAAS, Shanghai, China), Vibrio harveyi BB170 (V. harveyi BB170) (sensor1-sensor2þ) strain was donated by Dr. Ke, Cai-Huan of the College of Ocean & Earth Sciences (Xiamen University, Xiamen, China) and cultivated in modified autoinducer bioassay [19] medium at 30 C [20]. E. coli DH5a was purchased from Takara Bio Inc. Chemical reagents were of analytical quality where available. 2.2. Culture of chicken type II pneumocytes This assay was performed as described previously [9] with modifications. Briefly, lung tissue samples of 13-day-old chicken embryos were cut into small tissue blocks of about 1 cubic centimeter, and then the 0.25% trypsin and 0.1% IV collagenase (Invitrogen-Gibco, Grand Island, NY, USA) were added for digestion at 37 C for 10 min and 15 min, respectively. Cell suspensions were filtrated by 200 mesh sieve, re-suspended with 10% fetal bovine serum (FBS) in a 100-mm culture plate, incubated for 1 h, and then the supernatants with the unattached cells were collected for three times. The unattached cells were centrifuged at 1200 r/min for 5 min, re-suspended in fresh Dulbecco's modified Eagle's medium (DMEM) for three times, filtrated by 400 mesh sieve, and cells were incubated for 18 h at 37 C. The attaching cells on culture dish were chicken type II pneumocytes. 2.3. Lactate dehydrogenase (LDH) activity detection Chicken type II pneumocytes were seeded in 24-well plates and incubated in DMEM with 20% FBS for 18 h to 90% confluence. The cells of each well were infected with 400 ml APEC-O78 (107e109 CFU/ml) for 3, 6 and 9 h. Cells handled with DMEM with 20% FBS served as controls. The supernatants were collected after centrifugation at 300 g for 5 min and 12,000 g for 10 min. The LDH activity was determined according to the manufacturer's protocol (Jiancheng Technology Co., Nanjing, China). LDH activity was calculated as follows: LDH activity (U/L)¼ (Aexp Acon)/ (Asta Abla) 0.2 1000, where Aexp is the absorbance of test samples, Acon is the absorbance of control samples, Asta is the absorbance of standard hole, and Abla is the absorbance of blank wells. 2.4. Cell viability assay Cell death of chicken type II pneumocytes was initially assessed by Trypan blue staining for quantitative analysis of cell viability [19]. Cells were treated as described in LDH detection. After being harvested, cells were washed twice with phosphate buffer saline (PBS), then concentrated to 100 ml, and stained with 0.4% trypan blue for 5 min at room temperature. To assess cell viability, approximately 100 cells were counted with a hemocytometer for each experiment. The total numbers of cells and blue cells (dead cells) were counted. The percentage of cytotoxicity was calculated
Cell-free culture fluid (CF) was performed as described previously [21]. V. harveyi BB152 were grown to an optical density 600 nm (OD600) of 2.0 in 50 ml of AB medium contained in 250-ml flasks. CF were collected by being centrifuged at 12,000 g for 10 min at 4 C, and the resulting supernatant was further filtered through a 0.22 mm filter (Pall Corporation, Ann Arbor, MI, USA). CF preparations of DH5a and APEC-O78 were collected in a similar way. 2.6. AI-2 bioluminescence assay The AI-2 bioluminescence assay was performed as described previously [22], with modifications. Cell-free culture fluids from E. coli and V. harveyi strains BB152 were tested for the presence of signaling substances that could induce luminescence in the V. harveyi reporter strain BB170. CF of V. harveyi BB152 was used as a positive control, and CF of DH5a served as a negative control, CF of APEC-O78 (40 ml) boiled at 121 C for 15 min was used as a blank control. In order to establish the optimum AI-2 bioluminescence assay, we chose 0e40 ml of CF from APEC-O78strains, added to the black flat-bottomed 96-well plates (Corning Costar, Fisher Scientific, Canada), the reporter strain V. harveyi BB170 was grown in AB medium to OD600 of 2.0, diluted at 1: 5000 with fresh AB medium, and then 160e200 ml inoculum of the V. harveyi BB170 was supplemented, total reaction volume is 200 mL per well and incubated at 30 C for 2e5 h. Bioluminescence was measured via BHP9504 microplate luminescence analyzer (Beijing Hamamatsu Photonics Technology Co., Beijing, China). The AI-2-mediated bioluminescence was expressed as induction (n-fold) over the negative control. The experiments were repeated three times. 2.7. The growth curve and AI-2 activity of APEC-O78 in different growth phases APEC-O78 were grown at 37 C overnight with aeration in LuriaeBertani (LB) broth. The next morning fresh LB medium used for the overnight growth was inoculated at a 1:100 dilution with the overnight-grown cultures. Then extracting the 5.0 mL mixture to 14 tubes. The 14 tubes inoculated in a shaker, at 37 C, 200 rpm. Respectively at 0e26 h with the number corresponding to the time of the test tube removed, taking 1.0 mLe1.5 mL extraction centrifuge tube, for measuring the optical density, fresh LB medium as control, using the BioPhotometer analyzer in 600 nm wavelength. The remaining 4 mL broth were subjected to centrifugation for 10 min at 12,000 g, the supernatant were filtered through a 0.22 mm filter membrane, 80 C stored for use. CF samples were prepared from different phases, corresponding at 0e26 h. The AI-2 activities in CF samples were tested as described above. The experiments were done in triplicate. 2.8. AI-2 activity of APEC-O78 co-cultured with chicken type II pneumocytes The chicken type II pneumocytes were incubated with 107, 108, and 109 CFU/ml of APEC-O78 for 3, 6 and 9 h, cells handled with equivalence medium were used as controls. The supernatant was collected by centrifuging at 12,000 g for 10 min and further filtered through a 0.22 mm filter. The reporter strain V. harveyi BB170 was grown in AB medium to OD600 of 2.0, diluted at 1:5000 with fresh AB medium. The 20 ml above supernatant was diluted 10fold with 180 ml V. harveyi BB170 dilution, then added to black flat-
Z.-Q. Cui et al. / Microbial Pathogenesis 99 (2016) 247e252
bottomed 96-well plates (Corning Costar, Fisher Scientific, Canada), and incubated at 30 C for 4 h. The presence of AI-2 activity in the culture supernatant was tested as described above. The experiments were done in triplicate.
249
2.10. Statistical analysis The data were evaluated using one-way ANOVA in SPSS 13.0 software (SPSS Inc., Chicago, IL, USA). Data are presented as means ± SD. P values of less than 0.05 were considered significant. 3. Results
2.9. Reverse transcription polymerase chain reaction (RT-PCR) analysis Chicken type II pneumocytes were treated as described in LDH detection. The supernatants were collected after centrifugation at 300 g for 5 min, and the bacteria were collected by being centrifuged at 12,000 g for 10 min at 4 C. Total RNA was isolated using Trizol reagent (Invitrogen Co., USA) according to the standard procedures. For each RT-PCR reaction, 2 mg of total RNA were subjected to synthesize cDNA using Bio RT cDNA First Strand Synthesis Kit (Bioer Technology, Hangzhou, China). RT-PCR was performed in a total volume of 25 ml containing 12.5 ml of 2 Power Tap PCR MasterMix (Biotechs Corporation, Changchun, China), 2 ml of cDNA, 1 ml of 10 mM forward primer, 1 ml of 10 mM reverse primer, and 8.5 ml of ddH2O water. Parameters of PCR conditions were as follows: 94 C for 3 min for one cycle, then 94 C for 30 s, 51.8e59.5 C for 30 s, 72 C for 45 s for 30e35 cycles, and 72 C for 10 min for one cycle. Primer sets were listed in http://www.ncbi.nlm.nih.gov/pmc/ articles/PMC2875385/-SD2 Table 1. The amplified PCR products were separated by 2% agarose gel electrophoresis and visualized with ethidium bromide staining and UV irradiation. The dnaE was acted as a house-keeping control gene. Relative change in gene expression was recorded as follows: Relative ratio of target gene ¼ (expression of target gene/expression of dnaE) [23].
NC_020163.1
3.3. The growth curve and AI-2 levels in different growth phases
Amplicon (bp)
Sequence (50 to 30 )
Accession No.
papC-F papC-R fimA-F fimA-R fimC-F fimC-R iucD-F iucD-R iroN-F iroN -R iutA-F iutA-R irp-2-F irp-2-R fuyA-F fuyA-R hlyE-F hlyE-R tsh-F tsh-R ompA-F ompA-R iss-F iss-R vat-F vat-R luxS-F luxS-R pfs-F pfs-R qseA-F qseA-R DnaE-F dnaE-R
329
CGGGATTGCGGAGACTAA CGCCATACAGCGACCACT CCGTTCAGTTAGGACAGGTT TGGTTCCGTTATTCAGGGT CACCGCCACTGTTTGTTA TCAGCTTTCCCTGCACTC ACAAAAAGTTCTATCGCTTCC CCTGATCCAGATGATGCTC GTCGCTAACTGTGCTCCTG CGCCCTCATCGCTACTTT TCAACCCACTGCTTCTTACC GCCACGCACATTCATACC CAACCATTCGTCCACTCCC CTCAGACCGTCAAGCAACAG CTAATGCCCAGACTTCACAGC TCCGGTACAGCCCAAACAC ATCCGCCCAGAAAGACAT GCCCGCAGCAATAGAATA ACGAACTGGGAAGTATGG TTACGACGCATTGAGACA ATGGGTTATGACTGGTTAGG GTTGTTGGTCCACTGGTATT TGGCAATGCTTATTACAGG CGAAGAAATGATGGGTGA ACCCTCTGACAAGGACACG CACTGAATCCCACAACCC ACGCCATTACCGTTAAGATG AGTGATGCCAGAAAGAGGGA TTGTCTCGGACGAAGCAC GCAACAGCCAGGAACTCAT GCTGCCGTCGTATGCTTC CGCTCAAACCTGGGTATTCT TATGCGTAGCGAAGAGGAG GCCATTGTACCGAAGGTGA
NC_008563.1
693 557 254 437 993 276 379 282 99 101 128 373 165 594
3.2. Measurement of AI-2
NC_020163.1
Primer name
405
The release of LDH from chicken type II pneumocytes, which exposed to the APEC-O78 (107e109 CFU/ml), have no significant difference compared to the control group (126.1 ± 6.8 U/L) after 3 h of incubation. However, while cells were co-cultured with APECO78 for 6 h, APEC-O78 induced 181.3 ± 3.9, 192.5 ± 13.4 and 186.6 ± 10.2 U/L release of LDH from chicken type II pneumocytes at 107, 108 and 109 CFU/ml, respectively, which were significantly higher than 125.4 ± 9.8 U/L of control group. When the co-culture time reached to 9 h, cells exposed to 109 CFU/ml APEC-O78 induced significantly more LDH compared to control group (P < 0.01) (Fig. 1A). Similar observations were seen with trypan blue exclusion assay. Less 3% blue cells (dead cells) were observed at 3 h. APECO78 at 108 CFU/ml induced 27.0 ± 6.0% and 33.0 ± 5.3% dead cells at 6 h and 9 h, respectively. APEC-O78 at 109 CFU/ml also induced similar percentage of dead cells at 6 h and 9 h, which were significantly higher than control (P < 0.01) (Fig. 1B).
Fig. 2 showed that the bioluminescence is plotted as a function of time, and increase in proportion to the amount of CF. By measuring the fluorescence intensity to determine the optimum addition's amount of CF from APEC-O78strains and incubation time. Almost no bioluminescence induction was observed from 0 h to 3 h, but, it was dramatically increased at 4 h. The bioluminescence of CF of APEC-O78 boiled at 121 C for 15 min was very low. Therefore, the optimized measurement condition is 1:10 for the proportion of CF to the inoculum of V. harveyi BB170 and incubation at 30 C for 4 h.
Table 1 PCR primers.
294
3.1. Cytotoxicity of APEC-O78 to chicken type II pneumocytes
NC_011747.1 NC_007675.1 NC_011964.1 NC_008563.1 NC_008563.1 NC_020163.1 NC_007675.1 NC_007946.1 NC_020163.1 NC_008563.1
According to the above described measurement condition, the AI-2 activities of APEC-O78 in different growth phases were examined. As shown in Fig. 3, APEC-O78 was then incubated at 37 C for 0e1.5 h, OD600 slowly rising, 3e8 h, OD600 became logarithmic increase, 10e18 h, its value was stable at about 2.5, no longer as time changes, but when the bacterial was then incubated at 37 C for 22 h, the OD600 decreased. In different growth phases APEC - O78 can secrete different levels of the AI-2. The bioluminescence intensity induced by CF of APEC-O78 increased from lag phase to the late log phase (0e12 h). The levels of AI-2 were increased markedly and reached the maximum value in the late log phase. However, there were almost little or no bioluminescence detected in the lag phase, stationary phase and death phase. 3.4. AI-2 activity of APEC-O78 co-cultured with chicken type II pneumocytes
NC_007779.1 NC_013353.1 NC_002655.2 NC_002695.1
To determine whether the bacterial density-dependent cell death of APEC-O78 associated with bacterial quorum sensing, we examined AI-2 activity of APEC-O78 co-cultured with chicken type II pneumocytes. The AI-2 levels of CF from the co-culture with APEC-O78 secreted (107 CFU/ml) increased gradually after 6 h of incubation, and reached the highest level at 9 h of incubation.
250
Z.-Q. Cui et al. / Microbial Pathogenesis 99 (2016) 247e252
Fig. 1. (A) Lactate dehydrogenase (LDH) activity of the chicken type II pneumocytes. (B) Quantitative analysis of chicken type II pneumocytes viability by trypan blue exclusion assay. The chicken type II pneumocytes were infected with APEC-O78 (107e109 CFU/ml) for 3e9 h, cells handled with equivalence medium used as controls. Each sample had triplicates in the assay. The values represent mean ± SD of three independent experiments. **P < 0.01 vs. control groups.
Fig. 2. Measurement of AI-2. Different amounts of CF (0e40 ml) were added to the black flat-bottomed 96-well plates, and then V. harveyi BB170 dilution were added to give a total volume of 200 ml per well. The mixture was incubated at 30 C for 2e5 h. The CF samples of V. harveyi BB152, DH5a and APEC-O78 (boiled at 121 C for 15 min) were used as a positive control, negative control, and blank control, respectively. The result of AI-2-mediated bioluminescence was expressed as induction (n-fold) over the negative control. The values represent mean ± SD of three independent experiments. Error bars indicate standard deviations.
While the AI-2 levels of CF from the co-culture with 108 and 109 CFU/ml of APEC-O78 secreted reached the maximum value after 6 h of incubation (Fig. 4). The CF from cells in the absence of APEC-O78 had no AI-2 activity.
3.5. The expressions of virulence genes in different concentrations of APEC The RT-PCR results showed that the mRNA levels of eight virulence genes (papC, fimA, fimC, hlyE, ompA, luxS, pfs, and qseA) were significantly increased, and one genes (vat) was significantly decreased in 108 CFU/ml compared with 107 CFU/ml (p < 0.05). The mRNA levels of four virulence genes (hlyE, tsh, iss, and luxS) were significantly increased in the initial inoculums of 108 CFU/ml than those in 109 CFU/ml. There was no difference in the expression of six genes (iucD, iroN, iutA, iss, rap-2, and fuyA) between each group (Fig. 5 and Table 2).
Fig. 3. The growth curve and AI-2 activity of APEC-O78 in different growth phases. The CF samples were prepared from different phases of APEC-O78, corresponding at 0e26 h. The AI-2 activities were tested as described. The CF samples of V. harveyi BB152 and DH5a were used as a positive control and negative control, respectively. The turbidity of medium was represented as the optical density 600 (OD600). The values represent mean ± SD of three independent experiments. Error bars indicate standard deviations.
4. Discussion In the present study, we found that APEC-induced cell damage was correlated with the production of AI-2. APEC-O78 at 108 CFU/ ml caused significantly more cell death of chicken type II pneumocytes than at 107 and 109 CFU/ml. Similarly, eight virulence genes (papC, fimA, fimC, hlyE, ompA, luxS, pfs, and qseA) of 108 CFU/ ml APEC-O78 were significantly increased compared with those of 107 CFU/ml, and four virulence genes (hlyE, tsh, iss, and luxS) of 108 CFU/ml APEC-O78 were more higher than those of 109 CFU/ml. The QS is a global regulatory system that controls not only genes involved in pathogenesis but also genes involved in bacterial metabolism, DNA repair, nucleotide and protein biosynthesis [24]. In this study, we found that the AI-2 activity and the mRNA expressions of the virulence genes of APEC-O78 (108 CFU/ml) reached the maximum value at late log phase (6 h incubation). As both of them are controlled by QS, we hypothesized that the virulence gene expressions of APEC-O78 were also mediated by AI-2 of QS. LDH is a biological enzyme as a marker for common injuries, and LDH release from cells was useful for determining the virulence
Z.-Q. Cui et al. / Microbial Pathogenesis 99 (2016) 247e252
251
Table 2 The transcriptional levels of selected genes.
Fig. 4. AI-2 activity of APEC-O78 co-cultured with chicken type II pneumocytes. The chicken type II pneumocytes were incubated with 107, 108, and 109 CFU/ml of APEC-O78 for 3, 6 and 9 h, cells handled with equivalence medium were used as controls. The presence of AI-2 activity in the culture supernatant was tested as described. The values represent mean ± SD of three independent experiments. **P < 0.01 vs. group of cells treated with 108 CFU/ml APEC-O78.
Fig. 5. Effect of different concentrations of APEC on the mRNA expression of virulence genes. Ferric uptake regulator: iucD, fuyA, irp-2, iroN, and iutA; adhesin factors: fimA, fimC, and papC; haemolysin: tsh, and hlyE; antiserum survival factor: iss, and ompA; vacuolating autotransporter toxin gene: vat; and regulator of QS: luxS, pfs, and qseA. The chicken type II pneumocytes were incubated with 107, 108, and109 CFU/ ml of APEC-O78 for 6 h. Then the bacteria were collected, total RNA was isolated, and RT-PCR reaction was carried out as described.
potential of E. coli strains [25]. Interestingly, 108 CFU/ml of APECO78 significantly caused more cell death of chicken type II pneumocytes than 107 and 109 CFU/ml after 6 h incubation in LDH and trypan blue exclusion assays. Similar observations were also found that there is a positive correlation between AI-2 activity and death of IPEC-J2 cells during exposed to JG280 [19]. In addition, the inhibition of AI-2 production by deleting luxS gene significantly decreased the virulence of APEC [26]. Therefore, we speculated that AI-2 plays a major role in regulating APEC-O78-induced cell damage. Many bacterial species possess the luxS and pfs gene, and produce AI-2 to induce luminescence in V. harveyi, including salmonellae, H. pylori, streptococci, E. coli, and others [27]. To understand the association between AI-2 and cell damage caused by APEC-O78, we focused on the ability of APEC-O78 to produce AI-2. In this study, APEC-O78 produced AI-2 and induced the bioluminescence
Genes
107 CFU/mL
paC fimA fimC iucD Iron iutA hlyE tsh ompA iss rap-2 fuyA vat luxS Pfs qseA
0.87 0.67 0.48 1.16 1.12 0.94 0.64 0.98 0.65 0.69 0.99 0.88 0.85 0.77 0.77 0.84
± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±
0.04** 0.04* 0.02* 0.03 0.06 0.05 0.05** 0.06 0.03* 0.04 0.05 0.04 0.04* 0.05* 0.03* 0.06*
108 CFU/mL 1.20 0.82 0.59 1.20 1.16 0.91 0.89 0.93 0.79 0.70 1.00 0.89 0.70 0.96 0.95 1.05
± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±
0.04 0.05 0.02 0.07 0.10 0.05 0.04 0.06 0.03 0.05 0.05 0.03 0.06 0.03 0.04 0.04
109 CFU/mL 1.04 0.76 0.57 1.11 1.14 0.87 0.73 0.74 0.84 0.53 1.01 0.97 0.69 0.80 0.97 1.10
± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±
0.06 0.02 0.04 0.09 0.10 0.04 0.04* 0.02* 0.05 0.06* 0.06 0.05 0.03 0.04* 0.07 0.06
The mRNA level of each gene was normalized to that of dnaE. Each value shown represents the mean ± SD of three different determinations.**P < 0.01, *P < 0.05 vs. the group of cells treated with 108 CFU/ml APECO78.
of reporter V. harveyi BB170. It has been reported the autoinducer activity is heat sensitive [28,29], similarly our results confirmed that AI-2 lost the biological activity after being boiled. This also proved that the autoinducer bioassays was to detect bacterial metabolites rather than an inhibitory substance present in fresh medium [28]. AI-2 activity reached the maximum value at late log phase, and declined steeply in the stationary phase, suggesting that AI-2 activity of APEC-O78 is density dependent, in accordance with the results in Streptococcus oralis [30]. In Salmonella typhimurium, AI-2 is also produced and released during exponential growth, and is subsequently imported into the bacteria via the Lsr ATP binding cassette (ABC) transporter [31]. A number of genes, associated with bacterial iron acquisition, metabolism, adhesion and invasion, serum survival, and virulence, have been identified, and ultimately result in APEC infection to the host [3,4]. The F1 and P pili, and Tsh mediated the colonization of APEC to internal organs [32]. Then, toxins and effector proteins enter host cells and modify host physiology to induce injury through protein secretion systems [33]. The genes responsible for the formation of AE lesions are located on the locus of enterocyte effacement [34,35], while, qseA activate the transcription of the LEE genes [36]. DNA microarrays hybridization identified 242 genes of E. coli (up-regulated 154 genes, repressed 88 genes) that are controlled by AI-2 [17]. Type III secretion systems of both enterohemorrhagic E. coli (EHEC) and enteropathogenic E. coli (EPEC) have also been shown to be controlled by QS [18]. The loss of AI-2 activity significantly reduced the adherence and invasion percentage of APEC and the mRNA levels of the virulence-related genes [26]. In this study, the mRNA levels of eight virulence genes (papC, fimA, fimC, hlyE, ompA, luxS, pfs, and qseA) of 108 CFU/ml APEC-O78 were significantly increased compared with those of 107 CFU/ml, and the mRNA of four virulence genes (hlyE, tsh, iss, and luxS) of 108 CFU/ml APEC-O78 were more higher than those of 109 CFU/ml. Our results demonstrated that the down-regulation of the virulence genes, such as adhesion (fimA, fimC, and papC), haemolysin (tsh and hlyE), and serum survival gene (iss and ompA), reduced the cell damage induced by APEC. In conclusion, AI-2-mediated QS may down regulate the mRNA levels of virulence genes, and then decrease the damage of chicken type II pneumocytes induced by APEC-O78. These results indicated that AI-2 may be one new potential target for preventing chicken colibacillosis.
252
Z.-Q. Cui et al. / Microbial Pathogenesis 99 (2016) 247e252
Conflict of interest The authors have declared no conflict of interest. Acknowledgements We thank Matthew Engel, Cornell University for very carefully editing the manuscript. This work was supported by the National Natural Science Foundation of China (No. 31372470), and China Postdoctoral Science Special Foundation (No. 2014T70297). References [1] T. Knobl, A.M. Moreno, R. Paixao, T.A. Gomes, M.A. Vieira, D. da Silva Leite, et al., Prevalence of avian pathogenic Escherichia coli (APEC) clone harboring sfa gene in Brazil, Sci.World J. 2012 (2012) 437342. [2] F. Orskov, I. Orskov, Escherichia coli serotyping and disease in man and animals, Can. J. Microbiol. 38 (1992) 699e704. [3] R.H. Olsen, M.S. Chadfield, J.P. Christensen, F. Scheutz, H. Christensen, M. Bisgaard, Clonality and virulence traits of Escherichia coli associated with haemorrhagic septicaemia in turkeys, Avian Pathol. J. WVPA 40 (2011) 587e595. [4] T.J. Johnson, Y. Wannemuehler, S. Kariyawasam, J.R. Johnson, C.M. Logue, L.K. Nolan, Prevalence of avian-pathogenic Escherichia coli strain O1 genomic islands among extraintestinal and commensal E. coli isolates, J. Bacteriol. 194 (2012) 2846e2853. [5] S. Edelman, S. Leskela, E. Ron, J. Apajalahti, T.K. Korhonen, In vitro adhesion of an avian pathogenic Escherichia coli O78 strain to surfaces of the chicken intestinal tract and to ileal mucus, Veterinary Microbiol. 91 (2003) 41e56. [6] S.A. Pourbakhsh, M. Boulianne, B. Martineau-Doize, J.M. Fairbrother, Virulence mechanisms of avian fimbriated Escherichia coli in experimentally inoculated chickens, Veterinary Microbiol. 58 (1997) 195e213. [7] J.N. Maina, A.S. King, The thickness of avian blood-gas barrier: qualitative and quantitative observations, J. Anat. 134 (1982) 553e562. [8] R.J. Swain, S.J. Kemp, P. Goldstraw, T.D. Tetley, M.M. Stevens, Spectral monitoring of surfactant clearance during alveolar epithelial type II cell differentiation, Biophysical J. 95 (2008) 5978e5987. [9] L.Y. Zhang, S. Lv, S.C. Wu, X. Guo, F. Xia, X.R. Hu, et al., Inhibitory effects of alpha-cyperone on adherence and invasion of avian pathogenic Escherichia coli O78 to chicken type II pneumocytes, Veterinary Immunol. Immunopathol. 159 (2014) 50e57. [10] N.C. Reading, V. Sperandio, Quorum sensing: the many languages of bacteria, FEMS Microbiol. Lett. 254 (2006) 1e11. [11] W.C. Fuqua, S.C. Winans, E.P. Greenberg, Quorum sensing in bacteria: the LuxR-LuxI family of cell density-responsive transcriptional regulators, J. Bacteriol. 176 (1994) 269e275. [12] S. Schauder, K. Shokat, M.G. Surette, B.L. Bassler, The LuxS family of bacterial autoinducers: biosynthesis of a novel quorum-sensing signal molecule, Mol. Microbiol. 41 (2001) 463e476. [13] B.L. Bassler, Small talk. Cell-to-cell communication in bacteria, Cell 109 (2002) 421e424. [14] G.W. Huisman, R. Kolter, Sensing starvation: a homoserine lactoneedependent signaling pathway in Escherichia coli, Science 265 (1994) 537e539. [15] B.A. Lazazzera, Quorum sensing and starvation: signals for entry into stationary phase, Curr. Opin. Microbiol. 3 (2000) 177e182. [16] D.M. Sitnikov, J.B. Schineller, T.O. Baldwin, Control of cell division in Escherichia coli: regulation of transcription of ftsQA involves both rpoS and SdiAmediated autoinduction, Proc. Natl. Acad. Sci. U. S. A. 93 (1996) 336e341.
[17] M.P. DeLisa, C.F. Wu, L. Wang, J.J. Valdes, W.E. Bentley, DNA microarray-based identification of genes controlled by autoinducer 2-stimulated quorum sensing in Escherichia coli, J. Bacteriol. 183 (2001) 5239e5247. [18] V. Sperandio, J.L. Mellies, W. Nguyen, S. Shin, J.B. Kaper, Quorum sensing controls expression of the type III secretion gene transcription and protein secretion in enterohemorrhagic and enteropathogenic Escherichia coli, Proc. Natl. Acad. Sci. U. S. A. 96 (1999) 15196e15201. [19] J. Zhu, X. Yin, H. Yu, L. Zhao, P. Sabour, J. Gong, Involvement of quorum sensing and heat-stable enterotoxin a in cell damage caused by a porcine enterotoxigenic Escherichia coli strain, Infect Immun 79 (2011) 1688e1695. [20] B.L. Bassler, E.P. Greenberg, A.M. Stevens, Cross-species induction of luminescence in the quorum-sensing bacterium Vibrio harveyi, J. Bacteriol. 179 (1997) 4043e4045. [21] T. Zhu, D.X. Wang, W. Zhang, X.Q. Liao, X. Guan, H. Bo, et al., Andrographolide protects against LPS-induced acute lung injury by inactivation of NF-kappaB, PloS One 8 (2013) e56407. [22] X.G. Han, C.P. Lu, Detection of autoinducer-2 and analysis of the profile of luxS and pfs transcription in Streptococcus suis serotype 2, Curr. Microbiol. 58 (2009) 146e152. [23] X.M. Wang, X.P. Liao, W.J. Zhang, H.X. Jiang, J. Sun, M.J. Zhang, et al., Prevalence of serogroups, virulence genotypes, antimicrobial resistance, and phylogenetic background of avian pathogenic Escherichia coli in south of China, Foodborne Pathogens Dis. 7 (2010) 1099e1106. [24] V. Sperandio, A.G. Torres, J.A. Giron, J.B. Kaper, Quorum sensing is a global regulatory mechanism in enterohemorrhagic Escherichia coli O157:H7, J. Bacteriol. 183 (2001) 5187e5197. [25] Y. Maldonado, J.C. Fiser, C.H. Nakatsu, A.K. Bhunia, Cytotoxicity potential and genotypic characterization of Escherichia coli isolates from environmental and food sources, Appl. Environ. Microbiol. 71 (2005) 1890e1898. [26] X. Han, H. Bai, L. Liu, H. Dong, R. Liu, J. Song, et al., The luxS gene functions in the pathogenesis of avian pathogenic Escherichia coli, Microb. Pathog. 55 (2013) 21e27. [27] M.G. Surette, M.B. Miller, B.L. Bassler, Quorum sensing in Escherichia coli, Salmonella typhimurium, and Vibrio harveyi: a new family of genes responsible for autoinducer production, Proc. Natl. Acad. Sci. U. S. A. 96 (1999) 1639e1644. [28] A. Eberhard, Inhibition and activation of bacterial luciferase synthesis, J. Bacteriol. 109 (1972) 1101e1105. [29] A.L. Beeston, M.G. Surette, pfs-dependent regulation of autoinducer 2 production in Salmonella enterica serovar Typhimurium, J. Bacteriol. 184 (2002) 3450e3456. [30] A.H. Rickard, R.J. Palmer Jr., D.S. Blehert, S.R. Campagna, M.F. Semmelhack, P.G. Egland, et al., Autoinducer 2: a concentration-dependent signal for mutualistic bacterial biofilm growth, Mol. Microbiol. 60 (2006) 1446e1456. [31] M.E. Taga, S.T. Miller, B.L. Bassler, Lsr-mediated transport and processing of AI-2 in Salmonella typhimurium, Mol. Microbiol. 50 (2003) 1411e1427. [32] W. Dias da Silveira, A. Ferreira, M. Brocchi, L. Maria de Hollanda, A.F. Pestana de Castro, A. Tatsumi Yamada, et al., Biological characteristics and pathogenicity of avian Escherichia coli strains, Veterinary Microbiol. 85 (2002) 47e53. [33] T.T. Tseng, B.M. Tyler, J.C. Setubal, Protein secretion systems in bacterial-host associations, and their description in the Gene Ontology, BMC Microbiol. 9 (Suppl 1) (2009) S2. [34] P. Wintachai, P. Kaur, R.C.H. Lee, S. Ramphan, A. Kuadkitkan, N. Wikan, et al., Activity of andrographolide against chikungunya virus infection, Sci. Rep. 5 (2015) 14179. [35] T.K. McDaniel, K.G. Jarvis, M.S. Donnenberg, J.B. Kaper, A genetic locus of enterocyte effacement conserved among diverse enterobacterial pathogens, Proc. Natl. Acad. Sci. U. S. A. 92 (1995) 1664e1668. [36] V. Sperandio, C.C. Li, J.B. Kaper, Quorum-sensing Escherichia coli regulator A: a regulator of the LysR family involved in the regulation of the locus of enterocyte effacement pathogenicity island in enterohemorrhagic E. coli, Infect. Immun. 70 (2002) 3085e3093.