- Email: [email protected]
Autophagy promotes osteogenic differentiation of human bone marrow mesenchymal stem cell derived from osteoporotic vertebrae
Biochemical and Biophysical Research Communications xxx (2017) 1e7
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Autophagy promotes osteogenic differentiation of human bone marrow mesenchymal stem cell derived from osteoporotic vertebrae Yongxian Wan a, b, Naiqiang Zhuo b, Yulin Li a, Weikang Zhao a, Dianming Jiang a, * a b
Department of Orthopaedics, The First Affiliated Hospital of Chongqing Medical University, Chongqing 400016, People's Republic of China Department of Orthopaedics, The Affiliated Hospital of Southwest Medical University, Luzhou City, Sichuan Province 646000, People's Republic of China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 20 April 2017 Accepted 1 May 2017 Available online xxx
Osteoporosis is one of the most prevalent age-related diseases worldwide, of which vertebral fracture is by far the most common osteoporotic fracture. Reduced bone formation caused by senescence is a main cause for senile osteoporosis, however, how to improve the osteogenic differentiation of osteoporotic bone marrow mesenchymal stem cells (BMSCs) remains a challenge. This study aimed to investigate the autophagic level changes in osteoporotic BMSCs derived from human vertebral body, and then influence osteogenesis through the regulation of autophagy. We found that hBMSCs from osteoporotic patients displayed the senescence-associated phenotypes and significantly reduced autophagic level compared to those derived from healthy ones. Meanwhile, the osteogenic potential remarkably decreased in osteoporotic hBMSCs, suggesting an inherent relationship between autophagy and osteogenic differentiation. Furthermore, rapymycin (RAP) significantly improved osteogenic differentiation through autophagy activatoin. However, the osteogenesis of hBMSCs was reversed by the autophagy inhibitor 3methyladenine (3-MA). To provide more solid evidence, the hBMSCs pretreated with osteogenesis induction medium in the presence of 3-MA or RAP were implanted into nude mice. In vivo analysis showed that RAP treatment induced larger ectopic bone mass and more osteoid tissues, however, this restored ability of osteogenic potential was significantly inhibited by 3-MA pretreatment. In conclusion, our study indicated the pivotal role of autophagy for the osteo-differentiation hBMSCs, and offered novel therapeutic target for osteoporosis treatment. © 2017 Elsevier Inc. All rights reserved.
Keywords: Bone marrow mesenchymal stem cells Osteogenic differentiation Autophagy Osteoporosis
1. Introduction Osteoporosis has high incidence rate in current aging society [1], which is characterized by an attenuation of bone resistance and susceptibility to fracture. By far, fragility vertebral fracture is the most prevalent osteoporotic fracture, which easily results in intractable back pain, physcial disability and reduced lifeexpectancy [2]. Decreased bone formation is the key feature of senile osteoporosis. It is well known that osteoblasts with osteogenetic potential are mainly originated from bone marrow stem cells (BMSCs). Previous study has demonstrated that BMSCs in osteoporosis has common pathological phenotype of defective osteogenesis [3], however, the underlying mechanism remains unclear. Thus, we hypothesized that attenuate cell senescence can enhance cellular fuction of BMSCs to protect against osteoporosis.
Autophagy is a natural and self-cannibalization process that allows orderly degradation and recycling of dysfunctional cellular organelles or macromolecules to guarantee cellular homeostasis [4]. More and more studies has demonstrated that autophagy plays an important role in the regulation of self-renewal and stemness of MSCs [5]. Oliver L et al. has shown that high autophagic activity would decrease after induced differentiation in human adult MSCs [6]. Up to date, no study has concerned the role of autophagy on the osteogenic differentiation control of hBMSCs with senile osteoporosis. In the present study, we set out to investigate the autophagy changes of hBMSCs derived from donators with senile osteoporosis, and whether the autophagy was responsible for maintaining osteogenic capacity in osteoporotic hBMSCs. 2. Materials and methods 2.1. Isolation and cultivation of hBMSCs
* Corresponding author. E-mail address: [email protected] (D. Jiang).
Fresh human BM was harvested from the vertebral bodies of 10
http://dx.doi.org/10.1016/j.bbrc.2017.05.004 0006-291X/© 2017 Elsevier Inc. All rights reserved.
Please cite this article in press as: Y. Wan, et al., Autophagy promotes osteogenic differentiation of human bone marrow mesenchymal stem cell derived from osteoporotic vertebrae, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/ j.bbrc.2017.05.004
2
Y. Wan et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e7
male donators with vertebral fracture or spinal deformity during corpectomy surgery. Five patients were young and healthy before the injury, aged from 26 to 35 years old (control group), and the other 5 patients were old and diagnosed as osteoporosis, aged from 60 to 75 years old (OP group). Written informed consent was obtained from all tissue donators and this study approach was approved by Ethics Committee of Chongqing Medical University before surgery. The hBMSCs were isolated and cultured as previously described [7]. In brief, 5e10 mL bone marrow aspirate was collected, then the mononucleated cells were isolated by density gradient centrifugation, and differential adhesion method was used to isolate hBMSCs. The hBMSCs were cultured in a- Dulbecco's modified Eagle's medium (a-DMEM, Gibco, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, USA) and 1% penicillin/streptomycin at 37 C in a humidified 5% CO2 atmosphere. When reaching 90% confluency, cells were digested by 0.125% trypsin enzyme. Cells of the primary passages (P) were compared between groups, and cells from P3 to P5 in osteoporotic group were used for the subsequent experiment. To regulate autophagy of hBMSCs, the cells were treated with 100 nM RAP (Sigma, USA) induce autophagy, and 2 mM 3-MA (Sigma, USA) to inhibit autophagy.
2.6. Alizarin red S and alkaline phosphatase (ALP) staining Osteogenic differentiation of hBMSCs was determined by Alizarin red S staining for calcium deposites, alkaline phosphatase (ALP) staining for reflecting early osteoblastic differentiation. Briefly, after fixed with 4% paraformaldehyde, cells were stained with 2% Alizarin red S pH 4.6 or 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (Sigma-Aldrich, USA) and stained for 1 h at room temperature. Then the plates were washed with deionized water and observed after dry. 2.7. Real-time quantitative polymerase chain reaction (qPCR) Total RNA was extracted from hBMSCs after osteogenic induction by using Trizol reagent (Invitrogen, USA). Then, 1 mg of mRNA was reverse transcribed to cDNA. The cDNA samples were amplified by performing real-time PCR in ABI Prism 7500 (ABI, USA) by using SYBR® Green Real-Time PCR Master Mix (Takara, Japan). Relative expression levels of the indicated genes were calculated using 2DDCt method. The GAPDH gene was amplified as an internal control. The primers of osteogenic marker gene collagen I (COL I), osteocalcin (OCN), osteopontin (OPN) and Runt-related transcription factor 2 (RUNX2) were shown in Table 1.
2.2. Senescence-associated b-galactosidase staining 2.8. Cell autophagy analysis SA-b-gal staining was performed to detect hBMSCs senescence using a senescence cell histochemical staining kit (Beyotime, China) according to the manufacturer's instructions. Briefly, fixed cells were incubated in Staining Solution Mix overnight at 37 C and the percentage of SA-b-gal-positive blue cells was counted in randomly 3 fields on a phase contrast microscope (Olympus, Japan).
To visualize the autophagosome, hBMSCs were transfected with adenovirus containing GFP-LC3. Briefly, cells were incubated with adenovirus at a multiplicity of infection of 50 for 48 h. GFP-LC3positive punctate pattern of autophagosomes was observed under confocal laser scanning microscope (Hitachi, Japan). The number of autophagosomes was determined in 3 random fields.
2.3. Telomerase activity 2.9. Ectopic bone formation in vivo Telomerase activity was determined by the telomeric repeat amplification protocol (TRAP) with the TeloTAGGG Telomerase PCR ELISA kit (Roche, Swiss) according to the manufacturer's instructions. Briefly, cells were lysed and centrifuged to collect the resultant supernatant to measure the telomerase activity as previously described [8]. The absorbance of the final product was measured within 30 min at 450 nm using a microplate reader (BioRad, USA). 2.4. Western blot analysis Whole Cells were lysed on ice using RIPA Lysis buffer (Beyotime, China) to get total cellular protein. Equal amounts of protein were separated by SDS-PAGE gels and transferred onto PVDF membranes. Then, the membranes were blocked by Blocking buffer (Abcam, UK) for 1 h at 37 C and then incubated with primary antiP53, P21 (Cell Signaling, USA), b-atcin (Beyotime, China), LC3B and P62/SQSTM1 (Sigma, USA) at 4 C overnight. After washing by Tris Buffered Saline with Tween (TBST), membranes were incubated with the respective secondary antibodies for 1 h at 37 C. Finally, antibody binding was visualized using an enhanced chemiluminescence (ECL) western blotting detection system (Bio-Rad, USA).
Stem cell implantation and ectopic bone formation were performed as previous description [9]. Briefly, hBMSCs with osteogenic differentiation medium pretreatment from additive free (control), 3-MA and RAP group were collected and seeded onto absorbable collagen gel. Then, these cell pellets were transplanted into the flanks of nude mice, approved for experimental use by the Laboratory Animal Centre of Chongqing Medical University. At 8 weeks after implantation, the mice were terminated and scaffolds were harvested for HE and Masson staining. In briefly, the paraffin blocks were cut into 4 mm sections, for HE staining, the sections were stained with Harris' hematoxylin and eosin for 1e2 min; for Masson staining, the sections were treated with a Masson staining fluid (Solarbio, China) for 5 min. Both the results were observed under a microscope. In addition, micro-computed tomography (micro-CT) was used to test the new bone formation. All retrieved samples were fixed and conducted using a SkyScan-1176 micro-CT (Bruker, Belgium). NRecon software version 1.6 (Bruker) was further used for 3D reconstruction and to view images. The volume of interest (VOI) was defined as the relative changes in bone volume density (BV/TV%), which is the percentage of bone volume (BV) to the total tissue volume (TV). 2.10. Statistical analysis
2.5. Osteogenic induction To promote differentiation into osteoblasts, the osteogenic induction medium were changed to culture hBMSCs for 21 days, which contains 0.1 mM dexamethasone, 10 mM b-glycerolphosphate and 0.25 mM ascorbate (Sigma-Aldrich, USA) in aDMEM with 10% FBS. The medium was changed every 3 days.
All experiments were performed in triplicate. Results were expressed as mean ± standard deviation (SD). Differences between groups were analyzed by independent t-test or ANOVA followed by Tukey post hoc test using SPSS version 19.0 statistical software program (SPSS, Inc., USA). Values of P < 0.05 were considered as statistically significant.
Please cite this article in press as: Y. Wan, et al., Autophagy promotes osteogenic differentiation of human bone marrow mesenchymal stem cell derived from osteoporotic vertebrae, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/ j.bbrc.2017.05.004
Y. Wan et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e7
3. Results 3.1. Senescent phenotype of hBMSCs comparation SA-b-gal is a widely used biomarker for ageing and senescent mammalian cells [10]. Results showed that the percentage of SA-bgal-positive cells increased significantly in the osteoporotic hBMSCs than those from healthy donators (Fig. 1A). In addition, western blotting analysis of osteoporotic hBMSCs showed a significant increase of senecence-related proteins including P53 and P21 (Fig. 1B). To confirm that telomerase activity deficit associated with this cell senescence, ELISA was performed to detect the telomerase activity. Fig. 1C showed that there was an obviously decline in the telomerase activity of the hBMSCs from OP group. These data thus proved an obviously senescent phenotype of hBMSCs with senile osteoporosis.
3.2. Autophagic level and osteogenic potential comparation Previous study has demonstrated that autophagy plays an important role in the osteogenic differentiation of stem cells [11]. To assess cellular autophagic activity, the protein levels of autophagic markers LC3 and P62 were determined by western blot. As shown in Fig. 2A, the osteoporotic hBMSCs significantly decreased the expression ratio of LC3-II/I, a common marker of autophagosomes formation. Simultaneously, the expression of P62 significantly increased, which was involved with autolysosome
Table 1 Primer sequence of target gene. Gene
Forward primer (50 -30 )
Reverse primer (50 -30 )
Col I OCN OPN RUNX2 GAPDH
TCCGGCTCCTGCTCCTCTTA AGCCACCGAGACACCATGAGA CATACAAGGCCATCCCCGTT ACTACCAGCCACCGAGACCA CAATGACCCCTTCATTGACC
GGCCAGTGTCTCCCTTG AGCCACCGAGACACCATGAGA ACGGCTGTCCCAATCAGAAG ACTGCTTGCAGCCTTAAATGACTCT TGGACTCCACGACGTACTCA
3
degradation. To directly visualize autophagosome formation, the GFP-LC3-labeled vacuoles were detected by confocal laser scanning microscope. Results confirmed that osteoporotic hBMSCs exhibited less obvious fluorescent punctates of GFP-LC3, which represented autophagosomes (Fig. 2B). Then, the primary cells were subjected in osteogenic differentiation medium to compare the osteogenic potential. Alizarin red S and ALP staining performed on day 21 indicated that alizarin redpositive mineralization (Fig. 2C) and histochemical detection of ALP (Fig. 2D) were clearly decreased in osteoporotic hBMSCs. The osteogenesis related mRNA were also identified by qRT-PCR. Results showed that the mRNA levels of COL1A1, OP, OC and RUNX2 considerably downregulated in hBMSCs from OP group (Fig. 2E). These findings indicated that osteoporotic hBMSCs were damaged in osteogenic potential and autophagy activity. 3.3. Autophagy promoted osteogenic differentiation of osteoporotic hBMSCs To confirm that autophagy contributed to maintenance of osteogenic potential in osteoporotic hBMSCs, pharmacological autophagy regulators were used in this study. As shown in Fig. 3A and B, hBMSCs exposed to RAP significantly increased autophagy activity, however, 3-MA showed obviously autophagy inhibition. Furthermore, rapmaycin treatment enhance osteoblast differentiation in hBMSCs determined by Alizarin red S and ALP staining, and increased markers of osteogenic differentiation. In contrast, osteogenesis differentiation was significantly decreased in the presence of autophagy inhibitor 3-MA (Fig. 3C and D). These results indicated that that autophagy plays a catalytic role in osteogenesis differentiation of hBMSCs. 3.4. Autophagy promoted osteogenic potential of osteoporotic hBMSC in vivo To further examine the effect of autophagy on ectopic bone formation in vivo, nude mice were implanted by osteoporotic
Fig. 1. The osteoporotic hBMSCs appeared senescent phenotype. The senescent phenotype of primary hBMSCs were compared, which were derived from donators with senile osteoporosis (OP group) or healthy (control group), respectively. Fig. 1A, senescent hBMSCs were stained with senescence-associated b-galactosidase (SA-b-gal) and the percentage of SA-b-gal positive cells was counted. Fig. 1B, The expressions of senecence-related protein P53 and P21 were examined by western blot. Relative protein expressions of P53 and P21 were normalized to b-actin. Fig. 1C, Telomerase activity was measured by a microplate reader. The values are expressed as the mean ± SD. *P < 0.05 Vs. control group. Bars ¼ 100 mm.
Please cite this article in press as: Y. Wan, et al., Autophagy promotes osteogenic differentiation of human bone marrow mesenchymal stem cell derived from osteoporotic vertebrae, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/ j.bbrc.2017.05.004
4
Y. Wan et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e7
hBMSCs treated with osteogenic induction medium in the presence of rapmaycin and 3-MA, respectively. Eight weeks after implantation, bony masses formed at the injection site were removed and analyzed. The size of new bone was significantly larger in rapmaycin group than that in control group, however, 3-MA treated hBMSCs exhibited lower osteogenetic ability, whose bone size was smaller than that in control group. These results were confirmed by
micro-CT analysis (Fig. 4A and B). HE and masson staining revealed that rapmaycin markedly induced bone-like tissue formation in vivo; while after 3-MA treatment, this autophagy-induced osteogenetic ability was significantly decreased (Fig. 4C and D). Taken together, these result proved that autophagy activation promoted the osteogenetic differentiation of hBMSCs in vivo.
Fig. 2. The osteoporotic hBMSCs showed inadequate autophagy and osteogenic capacity. The autophagic level of primary hBMSCs were first compared between OP and control group. Fig. 2A, Western blot for the autophagy-related protein level of LC3 and P62. The rate of LC3 II/I and P62/b-actin represent the relative expressions. Fig. 2B, Representative fluorescence images of GFP-LC3 punctate were observed under confocal microscopy. The number of autophagosomes was determined in 3 random fields. Then, the hBMSCs from two groups were cultured in osteogenic differentiation medium to compare the osteogenic potential. Fig. 2C and D, Representative picture of Alizarin Red S and ALP staining to detect osteogenic differentiation. Fig. 2E, The gene expressions of osteogenic marker COL I, OCN, OPN and RUNX2 were examined by qPCR. Relative mRNA expressions were normalized to control. The values are expressed as the mean ± SD. *P < 0.05 Vs. control group. Bars ¼ 100 mm. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Please cite this article in press as: Y. Wan, et al., Autophagy promotes osteogenic differentiation of human bone marrow mesenchymal stem cell derived from osteoporotic vertebrae, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/ j.bbrc.2017.05.004
Y. Wan et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e7
4. Discussion Replicative senescence has been proved to be linked to organism aging and disease development [12], and aging is a major cause of primary osteoporosis in elderly men. We herein unraveled that hBMSCs from senile osteoporosis appears senescent phenotype, as a consequence, the osteogenetic capacity is obviously reduced in
5
osteoporotic hBMSCs. In the present study, we provid a novel evidence that autophagy is deficit in osteoporotic hBMSCs compared that in healthy ones. Furthermore, our finding is the first report to indicate that autophagy activation is able to promote osteogenic differentiation of hBMSCs derived from osteoporotic vertebrae. It is suggested aging-induced deterioration of stem cell functions may play a key role in the pathophysiology of the various
Fig. 3. Autophagy promoted osteogenic differentiation of osteoporotic hBMSCs. The osteoporotic hBMSCs were cultured in osteogenic differentiation medium in the presence of autopahgy activator RAP or inhibitor 3-MA, respectively. Fig. 3A and B, autophagic levels were detected by western blot and laser confocal microscopy. Fig. 3C and D, the levels of osteogenic differentiation were detected by Alizarin Red S, ALP staining. Fig. 3E The gene expressions of osteogenic marker COL I, OCN, OPN and RUNX2 were examined by qPCR. Relative mRNA expressions were normalized to control. The values are expressed as the mean ± SD. *P < 0.05 Vs. control group. Bars ¼ 100 mm. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Please cite this article in press as: Y. Wan, et al., Autophagy promotes osteogenic differentiation of human bone marrow mesenchymal stem cell derived from osteoporotic vertebrae, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/ j.bbrc.2017.05.004
6
Y. Wan et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e7
aging-associated disorders [13]. This study showed that senescence-associated SA-b-gal activity was obviously increased in osteoporotic hBMSCs. The cell cycle inhibitor p53 and its transcriptional target p21, both of which were responsible for the initiation of cellular senescence [14], were significantly upregulated in osteoporotic hBMSCs. To further confirm the type of
replicative senescence [15], telomerase activity analysis indicated that it was obviously declined in osteoporotic hBMSCs. Moreover, as a consequence of cellular senescence, osteogenic potential of hBMSCs from OP group was significantly impaired detected by Alizarin red S and ALP staining and several specific genes associated to osteogenesis. Therefore, how to improve the osteogenic potential
Fig. 4. Autophagy promoted osteogenic potential of osteoporotic hBMSC in vivo. Nude mice were implanted with hBMSCs treated with 3-MA or RAP, respectively. Fig. 4A and B, gross images and micro CT analysis, the average bone volume and bone volume density (BV/TV%) were determined using the NRecon 1.6 software. Fig. 4C and D, Histologic evaluation of HE and Masson stained paraffin-embedded tissue sections. The values are expressed as the mean ± SD. *P < 0.05 Vs. control group. Bars ¼ 100 mm.
Please cite this article in press as: Y. Wan, et al., Autophagy promotes osteogenic differentiation of human bone marrow mesenchymal stem cell derived from osteoporotic vertebrae, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/ j.bbrc.2017.05.004
Y. Wan et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e7
of senescent hBMSCs to against osteoporosis remains a great challenge. Autophagy is a major intracellular mechanism to recycle damaged or unwanted cytoplasmic materials, resulting in protecting cells under stress stimulation and maintaining the properties of stem cells [16]. The autophagy activation of hBMSCs analyzed in our study was indicated to be restricted by cellular senescence, which is consistent with studies on some other stem cells [17]. It indicated a type of senescence-associated defective autophagy. In addition, it has been proved that autopahgy plays an essential process for the differentiation of stem cells [18]. To further detected the role of autophagy on osteogenesis differentiation in osteoporotic hBMSCs, the autophagic modulators were used. RAP is a commonly used inhibitor for mammalian target of rapamycin (mTOR). Previous study indicated that Rap can upregulate autophagy by resulting in the inhibition of mTOR-unc-51-like kinase 1 (ULK1) activity [19]. 3MA is a specific autophagosome formation inhibitor to decrease autophagy [20]. Our results showed that RAP significantly promoted autopahgy activation, which resulted in the upregulation of osteogenic differentiation. On the contrary, while 3-MA was used, we found that all the markers of osteogenesis were dramatically reduced. These in vitro results demonstrated that autophagy is an important mechanism for the pro-osteogenic effect in osteoporotic hBMSCs. Due to inadequate autophagy and osteogenic capacity of hBMSCs from senile osteoporosis, it seems a good prospect in clinical application for autophagy activation to treat osteoporosis. We further investigated the ectopic bone formation of autopahgy regulation in hBMSCs in vivo. Notably, the mice receiving hBMSCs pre-treated by RAP showed increased bone formation, but the bone mass and bone volume density were both significantly decreased in 3-MA group. These in vivo results confirmed the positive role of autophagy on osteogenic differentiation. In conclusion, we showed that autopahgy deficiency was associated with impaired osteogenic differentiation in senescent hBMSCs with osteoporosis. Our study showes for the first time that autopahgy activation stimulated the osteogenic differentaition of osteoporotic hBMSCs both in vitro and in vivo. The findings of the current study not only add to the understanding of the role of autophagy in osteogenic differentiation, but also provid new insight into prevention and treatment for senile osteoporosis. Conflict of interest The authors declared that they have no conflicts of interest to this work. Acknowledgements This work was supported by the National Natural Science Foundation of China (No. 81472057, No. 81672136), the Natural Science Foundation of the Health and Family Planning Commission of Sichuan Province (16PJ550).
7
Transparency document Transparency document related to this article can be found online at http://dx.doi.org/10.1016/j.bbrc.2017.05.004.
References [1] F. Rivadeneira, O. Makitie, Osteoporosis and bone mass disorders: from gene pathways to treatments, Trends Endocrinol. Metab. 27 (2016) 262e281. [2] D.L. Kendler, D.C. Bauer, K.S. Davison, L. Dian, D.A. Hanley, S.T. Harris, M.R. McClung, P.D. Miller, J.T. Schousboe, C.K. Yuen, E.M. Lewiecki, Vertebral fractures: clinical importance and management, Am. J. Med. 129 (2016), 221 e221e210. [3] Y.X. Zhang, H.L. Sun, H. Liang, K. Li, Q.M. Fan, Q.H. Zhao, Dynamic and distinct histone modifications of osteogenic genes during osteogenic differentiation, J. Biochem. 158 (2015) 445e457. [4] F.V. Sbrana, M. Cortini, S. Avnet, F. Perut, M. Columbaro, A. De Milito, N. Baldini, The role of autophagy in the maintenance of stemness and differentiation of mesenchymal stem cells, Stem Cell Rev. 12 (2016) 621e633. [5] C. Rodolfo, S. Di Bartolomeo, F. Cecconi, Autophagy in stem and progenitor cells, Cell Mol. Life Sci. 73 (2016) 475e496. [6] L. Oliver, E. Hue, M. Priault, F.M. Vallette, Basal autophagy decreased during the differentiation of human adult mesenchymal stem cells, Stem Cells Dev. 21 (2012) 2779e2788. [7] D.S. Park, J.C. Park, J.S. Lee, T.W. Kim, K.J. Kim, B.J. Jung, E.K. Shim, E.Y. Choi, S.Y. Park, K.S. Cho, C.S. Kim, Effect of FGF-2 on collagen tissue regeneration by human vertebral bone marrow stem cells, Stem Cells Dev. 24 (2015) 228e243. [8] B. Wilson, K.D. Novakofski, R.S. Donocoff, Y.X. Liang, L.A. Fortier, Telomerase activity in articular chondrocytes is lost after puberty, Cartilage 5 (2014) 215e220. [9] A.S. Qadir, S. Um, H. Lee, K. Baek, B.M. Seo, G. Lee, G.S. Kim, K.M. Woo, H.M. Ryoo, J.H. Baek, miR-124 negatively regulates osteogenic differentiation and in vivo bone formation of mesenchymal stem cells, J. Cell Biochem. 116 (2015) 730e742. [10] K. Itahana, J. Campisi, G.P. Dimri, Methods to detect biomarkers of cellular senescence: the senescence-associated beta-galactosidase assay, Methods Mol. Biol. 371 (2007) 21e31. [11] J. Tao, H. Wang, Y. Zhai, H. Park, J. Wang, F. Ji, Z. Zhang, Downregulation of Nrf2 promotes autophagy-dependent osteoblastic differentiation of adiposederived mesenchymal stem cells, Exp. Cell Res. 349 (2016) 221e229. [12] R.A. Signer, S.J. Morrison, Mechanisms that regulate stem cell aging and life span, Cell Stem Cell 12 (2013) 152e165. [13] A.S. Ahmed, M.H. Sheng, S. Wasnik, D.J. Baylink, K.W. Lau, Effect of aging on stem cells, World J. Exp. Med. 7 (2017) 1e10. [14] M.Y. Terzi, M. Izmirli, B. Gogebakan, The cell fate: senescence or quiescence, Mol. Biol. Rep. 43 (2016) 1213e1220. [15] N.C. Arsenis, T. You, E.F. Ogawa, G.M. Tinsley, L. Zuo, Physical activity and telomere length: impact of aging and potential mechanisms of action, Oncotarget (2017 Mar 30), http://dx.doi.org/10.18632/oncotarget.16726 [Epub ahead of print]. [16] K. Phadwal, A.S. Watson, A.K. Simon, Tightrope act: autophagy in stem cell renewal, differentiation, proliferation, and aging, Cell Mol. Life Sci. 70 (2013) 89e103. [17] L. Garcia-Prat, P. Munoz-Canoves, M. Martinez-Vicente, Monitoring autophagy in muscle stem cells, Methods Mol. Biol. 1556 (2017) 255e280. [18] T.T. Ho, M.R. Warr, E.R. Adelman, O.M. Lansinger, J. Flach, E.V. Verovskaya, M.E. Figueroa, E. Passegue, Autophagy maintains the metabolism and function of young and old stem cells, Nature 543 (2017) 205e210. [19] L. Wu, Z. Feng, S. Cui, K. Hou, L. Tang, J. Zhou, G. Cai, Y. Xie, Q. Hong, B. Fu, X. Chen, Rapamycin upregulates autophagy by inhibiting the mTOR-ULK1 pathway, resulting in reduced podocyte injury, PLoS One 8 (2013) e63799. [20] N.T. Cheng, H. Meng, L.F. Ma, L. Zhang, H.M. Yu, Z.Z. Wang, A. Guo, Role of autophagy in the progression of osteoarthritis: the autophagy inhibitor, 3methyladenine, aggravates the severity of experimental osteoarthritis, Int. J. Mol. Med. 39 (2017) 1224e1232.
Please cite this article in press as: Y. Wan, et al., Autophagy promotes osteogenic differentiation of human bone marrow mesenchymal stem cell derived from osteoporotic vertebrae, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/ j.bbrc.2017.05.004
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Autophagy promotes osteogenic differentiation of human bone marrow mesenchymal stem cell derived from osteoporotic vertebrae Yongxian Wan a, b, Naiqiang Zhuo b, Yulin Li a, Weikang Zhao a, Dianming Jiang a, * a b
Department of Orthopaedics, The First Affiliated Hospital of Chongqing Medical University, Chongqing 400016, People's Republic of China Department of Orthopaedics, The Affiliated Hospital of Southwest Medical University, Luzhou City, Sichuan Province 646000, People's Republic of China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 20 April 2017 Accepted 1 May 2017 Available online xxx
Osteoporosis is one of the most prevalent age-related diseases worldwide, of which vertebral fracture is by far the most common osteoporotic fracture. Reduced bone formation caused by senescence is a main cause for senile osteoporosis, however, how to improve the osteogenic differentiation of osteoporotic bone marrow mesenchymal stem cells (BMSCs) remains a challenge. This study aimed to investigate the autophagic level changes in osteoporotic BMSCs derived from human vertebral body, and then influence osteogenesis through the regulation of autophagy. We found that hBMSCs from osteoporotic patients displayed the senescence-associated phenotypes and significantly reduced autophagic level compared to those derived from healthy ones. Meanwhile, the osteogenic potential remarkably decreased in osteoporotic hBMSCs, suggesting an inherent relationship between autophagy and osteogenic differentiation. Furthermore, rapymycin (RAP) significantly improved osteogenic differentiation through autophagy activatoin. However, the osteogenesis of hBMSCs was reversed by the autophagy inhibitor 3methyladenine (3-MA). To provide more solid evidence, the hBMSCs pretreated with osteogenesis induction medium in the presence of 3-MA or RAP were implanted into nude mice. In vivo analysis showed that RAP treatment induced larger ectopic bone mass and more osteoid tissues, however, this restored ability of osteogenic potential was significantly inhibited by 3-MA pretreatment. In conclusion, our study indicated the pivotal role of autophagy for the osteo-differentiation hBMSCs, and offered novel therapeutic target for osteoporosis treatment. © 2017 Elsevier Inc. All rights reserved.
Keywords: Bone marrow mesenchymal stem cells Osteogenic differentiation Autophagy Osteoporosis
1. Introduction Osteoporosis has high incidence rate in current aging society [1], which is characterized by an attenuation of bone resistance and susceptibility to fracture. By far, fragility vertebral fracture is the most prevalent osteoporotic fracture, which easily results in intractable back pain, physcial disability and reduced lifeexpectancy [2]. Decreased bone formation is the key feature of senile osteoporosis. It is well known that osteoblasts with osteogenetic potential are mainly originated from bone marrow stem cells (BMSCs). Previous study has demonstrated that BMSCs in osteoporosis has common pathological phenotype of defective osteogenesis [3], however, the underlying mechanism remains unclear. Thus, we hypothesized that attenuate cell senescence can enhance cellular fuction of BMSCs to protect against osteoporosis.
Autophagy is a natural and self-cannibalization process that allows orderly degradation and recycling of dysfunctional cellular organelles or macromolecules to guarantee cellular homeostasis [4]. More and more studies has demonstrated that autophagy plays an important role in the regulation of self-renewal and stemness of MSCs [5]. Oliver L et al. has shown that high autophagic activity would decrease after induced differentiation in human adult MSCs [6]. Up to date, no study has concerned the role of autophagy on the osteogenic differentiation control of hBMSCs with senile osteoporosis. In the present study, we set out to investigate the autophagy changes of hBMSCs derived from donators with senile osteoporosis, and whether the autophagy was responsible for maintaining osteogenic capacity in osteoporotic hBMSCs. 2. Materials and methods 2.1. Isolation and cultivation of hBMSCs
* Corresponding author. E-mail address: [email protected] (D. Jiang).
Fresh human BM was harvested from the vertebral bodies of 10
http://dx.doi.org/10.1016/j.bbrc.2017.05.004 0006-291X/© 2017 Elsevier Inc. All rights reserved.
Please cite this article in press as: Y. Wan, et al., Autophagy promotes osteogenic differentiation of human bone marrow mesenchymal stem cell derived from osteoporotic vertebrae, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/ j.bbrc.2017.05.004
2
Y. Wan et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e7
male donators with vertebral fracture or spinal deformity during corpectomy surgery. Five patients were young and healthy before the injury, aged from 26 to 35 years old (control group), and the other 5 patients were old and diagnosed as osteoporosis, aged from 60 to 75 years old (OP group). Written informed consent was obtained from all tissue donators and this study approach was approved by Ethics Committee of Chongqing Medical University before surgery. The hBMSCs were isolated and cultured as previously described [7]. In brief, 5e10 mL bone marrow aspirate was collected, then the mononucleated cells were isolated by density gradient centrifugation, and differential adhesion method was used to isolate hBMSCs. The hBMSCs were cultured in a- Dulbecco's modified Eagle's medium (a-DMEM, Gibco, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, USA) and 1% penicillin/streptomycin at 37 C in a humidified 5% CO2 atmosphere. When reaching 90% confluency, cells were digested by 0.125% trypsin enzyme. Cells of the primary passages (P) were compared between groups, and cells from P3 to P5 in osteoporotic group were used for the subsequent experiment. To regulate autophagy of hBMSCs, the cells were treated with 100 nM RAP (Sigma, USA) induce autophagy, and 2 mM 3-MA (Sigma, USA) to inhibit autophagy.
2.6. Alizarin red S and alkaline phosphatase (ALP) staining Osteogenic differentiation of hBMSCs was determined by Alizarin red S staining for calcium deposites, alkaline phosphatase (ALP) staining for reflecting early osteoblastic differentiation. Briefly, after fixed with 4% paraformaldehyde, cells were stained with 2% Alizarin red S pH 4.6 or 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (Sigma-Aldrich, USA) and stained for 1 h at room temperature. Then the plates were washed with deionized water and observed after dry. 2.7. Real-time quantitative polymerase chain reaction (qPCR) Total RNA was extracted from hBMSCs after osteogenic induction by using Trizol reagent (Invitrogen, USA). Then, 1 mg of mRNA was reverse transcribed to cDNA. The cDNA samples were amplified by performing real-time PCR in ABI Prism 7500 (ABI, USA) by using SYBR® Green Real-Time PCR Master Mix (Takara, Japan). Relative expression levels of the indicated genes were calculated using 2DDCt method. The GAPDH gene was amplified as an internal control. The primers of osteogenic marker gene collagen I (COL I), osteocalcin (OCN), osteopontin (OPN) and Runt-related transcription factor 2 (RUNX2) were shown in Table 1.
2.2. Senescence-associated b-galactosidase staining 2.8. Cell autophagy analysis SA-b-gal staining was performed to detect hBMSCs senescence using a senescence cell histochemical staining kit (Beyotime, China) according to the manufacturer's instructions. Briefly, fixed cells were incubated in Staining Solution Mix overnight at 37 C and the percentage of SA-b-gal-positive blue cells was counted in randomly 3 fields on a phase contrast microscope (Olympus, Japan).
To visualize the autophagosome, hBMSCs were transfected with adenovirus containing GFP-LC3. Briefly, cells were incubated with adenovirus at a multiplicity of infection of 50 for 48 h. GFP-LC3positive punctate pattern of autophagosomes was observed under confocal laser scanning microscope (Hitachi, Japan). The number of autophagosomes was determined in 3 random fields.
2.3. Telomerase activity 2.9. Ectopic bone formation in vivo Telomerase activity was determined by the telomeric repeat amplification protocol (TRAP) with the TeloTAGGG Telomerase PCR ELISA kit (Roche, Swiss) according to the manufacturer's instructions. Briefly, cells were lysed and centrifuged to collect the resultant supernatant to measure the telomerase activity as previously described [8]. The absorbance of the final product was measured within 30 min at 450 nm using a microplate reader (BioRad, USA). 2.4. Western blot analysis Whole Cells were lysed on ice using RIPA Lysis buffer (Beyotime, China) to get total cellular protein. Equal amounts of protein were separated by SDS-PAGE gels and transferred onto PVDF membranes. Then, the membranes were blocked by Blocking buffer (Abcam, UK) for 1 h at 37 C and then incubated with primary antiP53, P21 (Cell Signaling, USA), b-atcin (Beyotime, China), LC3B and P62/SQSTM1 (Sigma, USA) at 4 C overnight. After washing by Tris Buffered Saline with Tween (TBST), membranes were incubated with the respective secondary antibodies for 1 h at 37 C. Finally, antibody binding was visualized using an enhanced chemiluminescence (ECL) western blotting detection system (Bio-Rad, USA).
Stem cell implantation and ectopic bone formation were performed as previous description [9]. Briefly, hBMSCs with osteogenic differentiation medium pretreatment from additive free (control), 3-MA and RAP group were collected and seeded onto absorbable collagen gel. Then, these cell pellets were transplanted into the flanks of nude mice, approved for experimental use by the Laboratory Animal Centre of Chongqing Medical University. At 8 weeks after implantation, the mice were terminated and scaffolds were harvested for HE and Masson staining. In briefly, the paraffin blocks were cut into 4 mm sections, for HE staining, the sections were stained with Harris' hematoxylin and eosin for 1e2 min; for Masson staining, the sections were treated with a Masson staining fluid (Solarbio, China) for 5 min. Both the results were observed under a microscope. In addition, micro-computed tomography (micro-CT) was used to test the new bone formation. All retrieved samples were fixed and conducted using a SkyScan-1176 micro-CT (Bruker, Belgium). NRecon software version 1.6 (Bruker) was further used for 3D reconstruction and to view images. The volume of interest (VOI) was defined as the relative changes in bone volume density (BV/TV%), which is the percentage of bone volume (BV) to the total tissue volume (TV). 2.10. Statistical analysis
2.5. Osteogenic induction To promote differentiation into osteoblasts, the osteogenic induction medium were changed to culture hBMSCs for 21 days, which contains 0.1 mM dexamethasone, 10 mM b-glycerolphosphate and 0.25 mM ascorbate (Sigma-Aldrich, USA) in aDMEM with 10% FBS. The medium was changed every 3 days.
All experiments were performed in triplicate. Results were expressed as mean ± standard deviation (SD). Differences between groups were analyzed by independent t-test or ANOVA followed by Tukey post hoc test using SPSS version 19.0 statistical software program (SPSS, Inc., USA). Values of P < 0.05 were considered as statistically significant.
Please cite this article in press as: Y. Wan, et al., Autophagy promotes osteogenic differentiation of human bone marrow mesenchymal stem cell derived from osteoporotic vertebrae, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/ j.bbrc.2017.05.004
Y. Wan et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e7
3. Results 3.1. Senescent phenotype of hBMSCs comparation SA-b-gal is a widely used biomarker for ageing and senescent mammalian cells [10]. Results showed that the percentage of SA-bgal-positive cells increased significantly in the osteoporotic hBMSCs than those from healthy donators (Fig. 1A). In addition, western blotting analysis of osteoporotic hBMSCs showed a significant increase of senecence-related proteins including P53 and P21 (Fig. 1B). To confirm that telomerase activity deficit associated with this cell senescence, ELISA was performed to detect the telomerase activity. Fig. 1C showed that there was an obviously decline in the telomerase activity of the hBMSCs from OP group. These data thus proved an obviously senescent phenotype of hBMSCs with senile osteoporosis.
3.2. Autophagic level and osteogenic potential comparation Previous study has demonstrated that autophagy plays an important role in the osteogenic differentiation of stem cells [11]. To assess cellular autophagic activity, the protein levels of autophagic markers LC3 and P62 were determined by western blot. As shown in Fig. 2A, the osteoporotic hBMSCs significantly decreased the expression ratio of LC3-II/I, a common marker of autophagosomes formation. Simultaneously, the expression of P62 significantly increased, which was involved with autolysosome
Table 1 Primer sequence of target gene. Gene
Forward primer (50 -30 )
Reverse primer (50 -30 )
Col I OCN OPN RUNX2 GAPDH
TCCGGCTCCTGCTCCTCTTA AGCCACCGAGACACCATGAGA CATACAAGGCCATCCCCGTT ACTACCAGCCACCGAGACCA CAATGACCCCTTCATTGACC
GGCCAGTGTCTCCCTTG AGCCACCGAGACACCATGAGA ACGGCTGTCCCAATCAGAAG ACTGCTTGCAGCCTTAAATGACTCT TGGACTCCACGACGTACTCA
3
degradation. To directly visualize autophagosome formation, the GFP-LC3-labeled vacuoles were detected by confocal laser scanning microscope. Results confirmed that osteoporotic hBMSCs exhibited less obvious fluorescent punctates of GFP-LC3, which represented autophagosomes (Fig. 2B). Then, the primary cells were subjected in osteogenic differentiation medium to compare the osteogenic potential. Alizarin red S and ALP staining performed on day 21 indicated that alizarin redpositive mineralization (Fig. 2C) and histochemical detection of ALP (Fig. 2D) were clearly decreased in osteoporotic hBMSCs. The osteogenesis related mRNA were also identified by qRT-PCR. Results showed that the mRNA levels of COL1A1, OP, OC and RUNX2 considerably downregulated in hBMSCs from OP group (Fig. 2E). These findings indicated that osteoporotic hBMSCs were damaged in osteogenic potential and autophagy activity. 3.3. Autophagy promoted osteogenic differentiation of osteoporotic hBMSCs To confirm that autophagy contributed to maintenance of osteogenic potential in osteoporotic hBMSCs, pharmacological autophagy regulators were used in this study. As shown in Fig. 3A and B, hBMSCs exposed to RAP significantly increased autophagy activity, however, 3-MA showed obviously autophagy inhibition. Furthermore, rapmaycin treatment enhance osteoblast differentiation in hBMSCs determined by Alizarin red S and ALP staining, and increased markers of osteogenic differentiation. In contrast, osteogenesis differentiation was significantly decreased in the presence of autophagy inhibitor 3-MA (Fig. 3C and D). These results indicated that that autophagy plays a catalytic role in osteogenesis differentiation of hBMSCs. 3.4. Autophagy promoted osteogenic potential of osteoporotic hBMSC in vivo To further examine the effect of autophagy on ectopic bone formation in vivo, nude mice were implanted by osteoporotic
Fig. 1. The osteoporotic hBMSCs appeared senescent phenotype. The senescent phenotype of primary hBMSCs were compared, which were derived from donators with senile osteoporosis (OP group) or healthy (control group), respectively. Fig. 1A, senescent hBMSCs were stained with senescence-associated b-galactosidase (SA-b-gal) and the percentage of SA-b-gal positive cells was counted. Fig. 1B, The expressions of senecence-related protein P53 and P21 were examined by western blot. Relative protein expressions of P53 and P21 were normalized to b-actin. Fig. 1C, Telomerase activity was measured by a microplate reader. The values are expressed as the mean ± SD. *P < 0.05 Vs. control group. Bars ¼ 100 mm.
Please cite this article in press as: Y. Wan, et al., Autophagy promotes osteogenic differentiation of human bone marrow mesenchymal stem cell derived from osteoporotic vertebrae, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/ j.bbrc.2017.05.004
4
Y. Wan et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e7
hBMSCs treated with osteogenic induction medium in the presence of rapmaycin and 3-MA, respectively. Eight weeks after implantation, bony masses formed at the injection site were removed and analyzed. The size of new bone was significantly larger in rapmaycin group than that in control group, however, 3-MA treated hBMSCs exhibited lower osteogenetic ability, whose bone size was smaller than that in control group. These results were confirmed by
micro-CT analysis (Fig. 4A and B). HE and masson staining revealed that rapmaycin markedly induced bone-like tissue formation in vivo; while after 3-MA treatment, this autophagy-induced osteogenetic ability was significantly decreased (Fig. 4C and D). Taken together, these result proved that autophagy activation promoted the osteogenetic differentiation of hBMSCs in vivo.
Fig. 2. The osteoporotic hBMSCs showed inadequate autophagy and osteogenic capacity. The autophagic level of primary hBMSCs were first compared between OP and control group. Fig. 2A, Western blot for the autophagy-related protein level of LC3 and P62. The rate of LC3 II/I and P62/b-actin represent the relative expressions. Fig. 2B, Representative fluorescence images of GFP-LC3 punctate were observed under confocal microscopy. The number of autophagosomes was determined in 3 random fields. Then, the hBMSCs from two groups were cultured in osteogenic differentiation medium to compare the osteogenic potential. Fig. 2C and D, Representative picture of Alizarin Red S and ALP staining to detect osteogenic differentiation. Fig. 2E, The gene expressions of osteogenic marker COL I, OCN, OPN and RUNX2 were examined by qPCR. Relative mRNA expressions were normalized to control. The values are expressed as the mean ± SD. *P < 0.05 Vs. control group. Bars ¼ 100 mm. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Please cite this article in press as: Y. Wan, et al., Autophagy promotes osteogenic differentiation of human bone marrow mesenchymal stem cell derived from osteoporotic vertebrae, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/ j.bbrc.2017.05.004
Y. Wan et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e7
4. Discussion Replicative senescence has been proved to be linked to organism aging and disease development [12], and aging is a major cause of primary osteoporosis in elderly men. We herein unraveled that hBMSCs from senile osteoporosis appears senescent phenotype, as a consequence, the osteogenetic capacity is obviously reduced in
5
osteoporotic hBMSCs. In the present study, we provid a novel evidence that autophagy is deficit in osteoporotic hBMSCs compared that in healthy ones. Furthermore, our finding is the first report to indicate that autophagy activation is able to promote osteogenic differentiation of hBMSCs derived from osteoporotic vertebrae. It is suggested aging-induced deterioration of stem cell functions may play a key role in the pathophysiology of the various
Fig. 3. Autophagy promoted osteogenic differentiation of osteoporotic hBMSCs. The osteoporotic hBMSCs were cultured in osteogenic differentiation medium in the presence of autopahgy activator RAP or inhibitor 3-MA, respectively. Fig. 3A and B, autophagic levels were detected by western blot and laser confocal microscopy. Fig. 3C and D, the levels of osteogenic differentiation were detected by Alizarin Red S, ALP staining. Fig. 3E The gene expressions of osteogenic marker COL I, OCN, OPN and RUNX2 were examined by qPCR. Relative mRNA expressions were normalized to control. The values are expressed as the mean ± SD. *P < 0.05 Vs. control group. Bars ¼ 100 mm. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Please cite this article in press as: Y. Wan, et al., Autophagy promotes osteogenic differentiation of human bone marrow mesenchymal stem cell derived from osteoporotic vertebrae, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/ j.bbrc.2017.05.004
6
Y. Wan et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e7
aging-associated disorders [13]. This study showed that senescence-associated SA-b-gal activity was obviously increased in osteoporotic hBMSCs. The cell cycle inhibitor p53 and its transcriptional target p21, both of which were responsible for the initiation of cellular senescence [14], were significantly upregulated in osteoporotic hBMSCs. To further confirm the type of
replicative senescence [15], telomerase activity analysis indicated that it was obviously declined in osteoporotic hBMSCs. Moreover, as a consequence of cellular senescence, osteogenic potential of hBMSCs from OP group was significantly impaired detected by Alizarin red S and ALP staining and several specific genes associated to osteogenesis. Therefore, how to improve the osteogenic potential
Fig. 4. Autophagy promoted osteogenic potential of osteoporotic hBMSC in vivo. Nude mice were implanted with hBMSCs treated with 3-MA or RAP, respectively. Fig. 4A and B, gross images and micro CT analysis, the average bone volume and bone volume density (BV/TV%) were determined using the NRecon 1.6 software. Fig. 4C and D, Histologic evaluation of HE and Masson stained paraffin-embedded tissue sections. The values are expressed as the mean ± SD. *P < 0.05 Vs. control group. Bars ¼ 100 mm.
Please cite this article in press as: Y. Wan, et al., Autophagy promotes osteogenic differentiation of human bone marrow mesenchymal stem cell derived from osteoporotic vertebrae, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/ j.bbrc.2017.05.004
Y. Wan et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e7
of senescent hBMSCs to against osteoporosis remains a great challenge. Autophagy is a major intracellular mechanism to recycle damaged or unwanted cytoplasmic materials, resulting in protecting cells under stress stimulation and maintaining the properties of stem cells [16]. The autophagy activation of hBMSCs analyzed in our study was indicated to be restricted by cellular senescence, which is consistent with studies on some other stem cells [17]. It indicated a type of senescence-associated defective autophagy. In addition, it has been proved that autopahgy plays an essential process for the differentiation of stem cells [18]. To further detected the role of autophagy on osteogenesis differentiation in osteoporotic hBMSCs, the autophagic modulators were used. RAP is a commonly used inhibitor for mammalian target of rapamycin (mTOR). Previous study indicated that Rap can upregulate autophagy by resulting in the inhibition of mTOR-unc-51-like kinase 1 (ULK1) activity [19]. 3MA is a specific autophagosome formation inhibitor to decrease autophagy [20]. Our results showed that RAP significantly promoted autopahgy activation, which resulted in the upregulation of osteogenic differentiation. On the contrary, while 3-MA was used, we found that all the markers of osteogenesis were dramatically reduced. These in vitro results demonstrated that autophagy is an important mechanism for the pro-osteogenic effect in osteoporotic hBMSCs. Due to inadequate autophagy and osteogenic capacity of hBMSCs from senile osteoporosis, it seems a good prospect in clinical application for autophagy activation to treat osteoporosis. We further investigated the ectopic bone formation of autopahgy regulation in hBMSCs in vivo. Notably, the mice receiving hBMSCs pre-treated by RAP showed increased bone formation, but the bone mass and bone volume density were both significantly decreased in 3-MA group. These in vivo results confirmed the positive role of autophagy on osteogenic differentiation. In conclusion, we showed that autopahgy deficiency was associated with impaired osteogenic differentiation in senescent hBMSCs with osteoporosis. Our study showes for the first time that autopahgy activation stimulated the osteogenic differentaition of osteoporotic hBMSCs both in vitro and in vivo. The findings of the current study not only add to the understanding of the role of autophagy in osteogenic differentiation, but also provid new insight into prevention and treatment for senile osteoporosis. Conflict of interest The authors declared that they have no conflicts of interest to this work. Acknowledgements This work was supported by the National Natural Science Foundation of China (No. 81472057, No. 81672136), the Natural Science Foundation of the Health and Family Planning Commission of Sichuan Province (16PJ550).
7
Transparency document Transparency document related to this article can be found online at http://dx.doi.org/10.1016/j.bbrc.2017.05.004.
References [1] F. Rivadeneira, O. Makitie, Osteoporosis and bone mass disorders: from gene pathways to treatments, Trends Endocrinol. Metab. 27 (2016) 262e281. [2] D.L. Kendler, D.C. Bauer, K.S. Davison, L. Dian, D.A. Hanley, S.T. Harris, M.R. McClung, P.D. Miller, J.T. Schousboe, C.K. Yuen, E.M. Lewiecki, Vertebral fractures: clinical importance and management, Am. J. Med. 129 (2016), 221 e221e210. [3] Y.X. Zhang, H.L. Sun, H. Liang, K. Li, Q.M. Fan, Q.H. Zhao, Dynamic and distinct histone modifications of osteogenic genes during osteogenic differentiation, J. Biochem. 158 (2015) 445e457. [4] F.V. Sbrana, M. Cortini, S. Avnet, F. Perut, M. Columbaro, A. De Milito, N. Baldini, The role of autophagy in the maintenance of stemness and differentiation of mesenchymal stem cells, Stem Cell Rev. 12 (2016) 621e633. [5] C. Rodolfo, S. Di Bartolomeo, F. Cecconi, Autophagy in stem and progenitor cells, Cell Mol. Life Sci. 73 (2016) 475e496. [6] L. Oliver, E. Hue, M. Priault, F.M. Vallette, Basal autophagy decreased during the differentiation of human adult mesenchymal stem cells, Stem Cells Dev. 21 (2012) 2779e2788. [7] D.S. Park, J.C. Park, J.S. Lee, T.W. Kim, K.J. Kim, B.J. Jung, E.K. Shim, E.Y. Choi, S.Y. Park, K.S. Cho, C.S. Kim, Effect of FGF-2 on collagen tissue regeneration by human vertebral bone marrow stem cells, Stem Cells Dev. 24 (2015) 228e243. [8] B. Wilson, K.D. Novakofski, R.S. Donocoff, Y.X. Liang, L.A. Fortier, Telomerase activity in articular chondrocytes is lost after puberty, Cartilage 5 (2014) 215e220. [9] A.S. Qadir, S. Um, H. Lee, K. Baek, B.M. Seo, G. Lee, G.S. Kim, K.M. Woo, H.M. Ryoo, J.H. Baek, miR-124 negatively regulates osteogenic differentiation and in vivo bone formation of mesenchymal stem cells, J. Cell Biochem. 116 (2015) 730e742. [10] K. Itahana, J. Campisi, G.P. Dimri, Methods to detect biomarkers of cellular senescence: the senescence-associated beta-galactosidase assay, Methods Mol. Biol. 371 (2007) 21e31. [11] J. Tao, H. Wang, Y. Zhai, H. Park, J. Wang, F. Ji, Z. Zhang, Downregulation of Nrf2 promotes autophagy-dependent osteoblastic differentiation of adiposederived mesenchymal stem cells, Exp. Cell Res. 349 (2016) 221e229. [12] R.A. Signer, S.J. Morrison, Mechanisms that regulate stem cell aging and life span, Cell Stem Cell 12 (2013) 152e165. [13] A.S. Ahmed, M.H. Sheng, S. Wasnik, D.J. Baylink, K.W. Lau, Effect of aging on stem cells, World J. Exp. Med. 7 (2017) 1e10. [14] M.Y. Terzi, M. Izmirli, B. Gogebakan, The cell fate: senescence or quiescence, Mol. Biol. Rep. 43 (2016) 1213e1220. [15] N.C. Arsenis, T. You, E.F. Ogawa, G.M. Tinsley, L. Zuo, Physical activity and telomere length: impact of aging and potential mechanisms of action, Oncotarget (2017 Mar 30), http://dx.doi.org/10.18632/oncotarget.16726 [Epub ahead of print]. [16] K. Phadwal, A.S. Watson, A.K. Simon, Tightrope act: autophagy in stem cell renewal, differentiation, proliferation, and aging, Cell Mol. Life Sci. 70 (2013) 89e103. [17] L. Garcia-Prat, P. Munoz-Canoves, M. Martinez-Vicente, Monitoring autophagy in muscle stem cells, Methods Mol. Biol. 1556 (2017) 255e280. [18] T.T. Ho, M.R. Warr, E.R. Adelman, O.M. Lansinger, J. Flach, E.V. Verovskaya, M.E. Figueroa, E. Passegue, Autophagy maintains the metabolism and function of young and old stem cells, Nature 543 (2017) 205e210. [19] L. Wu, Z. Feng, S. Cui, K. Hou, L. Tang, J. Zhou, G. Cai, Y. Xie, Q. Hong, B. Fu, X. Chen, Rapamycin upregulates autophagy by inhibiting the mTOR-ULK1 pathway, resulting in reduced podocyte injury, PLoS One 8 (2013) e63799. [20] N.T. Cheng, H. Meng, L.F. Ma, L. Zhang, H.M. Yu, Z.Z. Wang, A. Guo, Role of autophagy in the progression of osteoarthritis: the autophagy inhibitor, 3methyladenine, aggravates the severity of experimental osteoarthritis, Int. J. Mol. Med. 39 (2017) 1224e1232.
Please cite this article in press as: Y. Wan, et al., Autophagy promotes osteogenic differentiation of human bone marrow mesenchymal stem cell derived from osteoporotic vertebrae, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/ j.bbrc.2017.05.004