- Email: [email protected]
Autoregulation of the gene encoding the replication terminator protein of Bacillus subtilis
Gene, 132 (1993) 7-13 @J 1993 Elsevier Science Publishers
B.V. All rights
reserved.
7
0378-l 119/93/$06.00
GENE 07265
Autoregulation of the gene encoding the replication terminator protein of Bacillus sub tilis (Gene expression; oA promoter; rrp; transcription; terC)
K.S. Ahn, M.S. Malo, M.T. Smith and R.G. Wake Department of Biochemistry, University of Sydney, Sydney, NSW 2006, Australia Received by R.E. Yasbin: 5 February
1993; Accepted:
26 March
1993; Received at publishers:
13 May 1993
SUMMARY
One of two putative oA promoters identified previously in the region immediately upstream from the rtp gene (encoding the replication terminator protein) [Smith and Wake, J. Bacterial. 170 (1988) 4083-40901 has been shown by transcription start point (tsp) mapping to be the functional rtp promoter. In these tsp mapping experiments, it was observed that the level of mRNA from this promoter, Prtp, was increased by a factor of 30 in the absence of the replication terminator protein (RTP), consistent with the autoregulation of rtp at the level of transcription. In vitro transcription from Prtp by oA RNA polymerase has been shown to be specifically repressed by RTP. A Prtp-spoVG-lacZ fusion was inserted into the chromosome of a strain in which RTP production was inducible by IPTG. Addition of IPTG to cultures of the new strain lowered PGal production by a factor of at least four. It is concluded that rtp is autoregulated in vivo at the level of transcription.
INTRODUCTION
The replication terminator protein (RTP) of BaciZZus is involved in arresting the chromosomal clockwise replication fork at terC (terminus of the chromosome) as the first stage in termination of a round of replication (see review by Lewis and Wake, 1991). The protein binds to two DNA terminators defined by 47and 48-bp inverted repeats (IRI and IRII, respectively) which are located adjacent to and just upstream from the subtilis
Correspondence to; Dr. R.G. Wake, Department of Biochemistry, University of Sydney, Sydney, NSW 2006, Australia. Tel. (61-2) 6922504; Fax (61-2) 692-4726; e-mail: [email protected] Abbreviations: aa, amino acid(s); Ap, ampicillin; B., Bacillus; BGal, bgalactosidase; bp, base pair(s); Cm, chloramphenicol; IPTG, isopropylP-o-thiogalactopyranoside; IR. inverted repeat(s); kb, kilobase or 1000 bp; MUG, 4-methylumbelliferyl-P-D-galactopyranoside; Nm, neomycin; nt, nucleotide(s); orf; open reading frame; P, promoter; Pm, phleomycin; R. resistance; RTP, replication terminator protein; rtp, gene encoding RTP; tsp, transcription start point(s); wt. wild type; XGal. 5-bromo-4-chloro-3-indolyl-B-D-galactopyranoside.
gene (rtp) that encodes it (see Fig. 1, upper section). It was noted previously (Smith and Wake, 1988) that two potential crA promoters were present just upstream from rtp in the vicinity of IRI and IRII, and that the binding of RTP to IRI and IRII might function to autoregulate expression of the gene at the level of transcription. The canonical (TATAAT) -10 region (around nt 653) for one of the promoters is identified in the B. subtilis 168 sequence of Fig. 1 (lower section); it is separated by 18 nt from the putative - 35 region (TTGAAG). These - 10 and -35 regions remain unaltered in the closely related B. subtilis W23 strain (spacing reduced to 17 nt; Lewis and Wake, 1989) which has also been shown to encode and express rtp. The -10 and -35 regions of the other candidate promoter in the 168 strain (- 10 around nt 7 17, and for which the spacing is somewhat high at 20 nt) are not conserved in the W23 strain. This suggests that the - 10 and - 35 regions identified in Fig. 1 constitute the functional promoter. It should also be noted that a sequence corresponding to a Rho-independent transcriptional terminator is present just upstream from and
8
516
576
AAACAGCGGGATTATGGTCAACAAATCCTTAAAAATGAAAACCTGTCTTTCGACAGGTTTTTTTATTTGAAT --
588
or1405 v
648
GAAATCCGTACCGGTAAAATGAGATATGTAAACCCTGGCAATCGTTTAAATTGAAGATAGCAGTAAATGCAG ............___._....... -35 1%mer +I (Cl
t1 (PI
660 GC
720
ATAATAGAACTAAGAAAACTATGTACCAAATGTTCAGTC I
-10
AAATTTATTTTTTCCGCTACACCTATAAT 7
732
732
CAGTAAACATGAAATAACTGGACTATCAGTCTTTAATATAAAG~GGAAAAC~TAAAAGAAAATTGAATAT ................----.-----....... w II 25-mer 864
M K E EKRSSTG 804 TTAGTACATAGTGTTGTCAGTGACAGAAGAAGGAGTGCATATGATGAAAGAAGAAAAAAGGAGTTCAACAGG SD 4
Fig. 1. Features of the nt sequence upstream from rtp in E. subtilis 168. The upper section shows rtg and the upstream IR region extending just beyond IRI and IRII. The clockwise replication fork enters this region from the right and is arrested by the appropriately oriented IRI. The hairpin structure to the left of IRI represents an efficient Rho-independent transcriptional terminator for a gene immediately to its left. The lower section shows the sequence spanning the inverted repeats and the putative o* promoter for rtp; itextends into the beginning of rtp. The sequence numbering is according to Carrigan et al. (1987). IRI and IRII are defined by long convergent arrows below the sequence. The -10 and -35 regions of the putative cr* promoter, as well as the ribosome-binding site (SD), are singly underlined. The double underlining identifies the Rho-independent transcription terminator of the upstream gene. The boxed, shaded region is protected against DNase I cleavage upon binding of RTP to IRI (Lewis et al., 1990). The solid arrowhead just to the right of nt 588 represents the site of insertion of orf405 in the chromosome of B. subtilis W23. The large, vertical, solid arrows define the limits of the sequence present in plasmid pWS44. The broken underlining defines segments corresponding to primers used for tsp mapping; for the 25-mer, the primer was the complement of the sequence identified. The vertical arrows labelled + l(P) and + l(C) define the tsp (right to left) established for this sequence present in either plasmid pWS44 or after insertion into the chromosomal amyE locus, respectively. The aa sequence for the N-terminal segment of RTP is shown in single-letter form.
within 60 nt of the -35 region. It would yield a tetranucleotide loop and has a very long stretch of T residues. On the basis of the d value (+ 27) calculated according to d’Aubenton Carafa et al. (1990), this terminator would be very efficient and impede transcription from proceeding into the sequence shown in Fig. 1 from a region further upstream from it. Consistent with the conclusion that rtp is transcribed independently from a promoter downstream from this terminator is the finding that the W23 strain contains a large open reading frame (orf405) inserted at a position just 32 nt upstream from the -35 region (Ahn and Wake, 1991; see Fig. 1); orf405 reads in a direction opposite to that of rtp. It is now well established that IRI is the functional chromosomal terminator in vivo (Carrigan et al., 1991; Smith and Wake, 1992). RTP binds tightly to IRI, and the shaded segment in Fig. 1 shows the region protected against DNase I cleavage by such binding (Lewis et al., 1990). The protected region spans the -10 portion of the putative promoter, and the bound RTP would be expected to interfere with the binding of RNA polymerase at this site. These more recent observations strengthen the earlier suggestion that RTP regulates expression of its own gene.
In this paper, the promoter for rtp has been identified and found to correspond to that defined by the -10 and - 35 regions shown in Fig. 1. Both in vitro and in vivo experiments have established that RTP represses transcription from this promoter to enable RTP to autoregulate its own synthesis at the level of transcription.
RESULTS AND DISCUSSION
(a) Transcriptional
start point for rfp
Early attempts to detect mRNA for rtp in B. subtiiis by dot hybridization were inconclusive and suggested that the mRNA level was very low (N.K. Williams and R.G.W., unpublished). For this reason an E. co&B. subtilis shuttle plasmid (pWS44; Fig. 2, left panel) was constructed. It contained the sequence between the large filled arrows of Fig. 1 such that a promoter within the sequence would drive a cat (CmR) gene. Plasmid pWS44 was introduced into the B. subtilis terC-region-deleted strain SU187 (Carrigan et al., 1991), selecting for CmR, to give strain SU201. (Resistance to relatively high levels of Cm, compared with a control, established that the
9
c
-7 E
-_
=t
=i T
-t-A
A
A A A G A’
= : = -\
A A
_. I.
_.
Fig. 2. Mapping the tsp (within the sequence of Fig. 1 between large vertical arrows) present in the E. d-B. subtilis shuttle plasmid pWS44. The left panel shows the structure of pWS44. The upstream limit of the B. subtilis sequence present in pWS44, nt 582, corresponds to that in pWS27 (Smith and Wake, 1988). This was used as the starting plasmid to provide eventually (through several steps) a BamHI fragment containing nt 582-816 which was inserted into the BarnHI-cut pUC19 to yield pWS40. Plasmid pWS44 is a chimera constructed by joining the &I-cut pWS40 and PstI-cut pPL703 (Mongkolsuk et al., 1983). The right panel shows the result of mapping the tsp within the B. subtilis sequence present in pWS44. Plasmid pWS44 was introduced into B. subtilis SU187 to give SU201. SU201 was grown at 37°C in Penassay broth containing 10 pg Cm/ml and 10 pg Nm/ml. At log phase (A600nm=0.4) cells were harvested and RNA extracted according to Aiba et al. (1981). Transcripts were analysed by the T4 DNA polymerase method of Hu and Davidson (1986) using a single-stranded DNA template (gapped duplex) prepared by cutting pWS44 with PstI and digesting with T4 DNA polymerase in the absence of dNTPs. This template was also used for standard dideoxy sequencing. The primer used in the extension stage of the protocol (and for sequencing) was an lb-mer corresponding to nt 581-599 of the terC-region sequence (Fig. 1). Lane 1 is a control (no RNA), while lanes 2, 3 and 4 contained 25, 50 and 100 pg of RNA, respectively (plus 1 Kg of DNA template) in the hybridization step. Sequencing lanes are labelled with appropriate letters.
inserted sequence did indeed contain a functional promoter operative in B. subtilis.) RNA was isolated from log phase SU201 and used for mapping of the transcript from the inserted promoter by the T4 DNA polymerase method of Hu and Davidson (1986). The results are
shown in Fig. 2 (right panel). Lane 1 is a control (no RNA), while lanes 2-4 contain increasing amounts of RNA. A cluster of three specific bands, which increase in intensity with an increase in added RNA, is generated in each case. The other faint bands higher up the sequence ladder are relatively constant in intensity with the three levels of RNA used. Assuming the most intense band in the cluster to represent the limit of the extended primer blocked by the mRNA, the tsp of the latter corresponds to A* in Fig. 2, which is at nt 664 in the sequence of Fig. 1. It should be noted that the analysis for the experiment in Fig. 2 examined the sequence from nt 615 to approx. 820, establishing that there is no other significant tsp downstream from that at nt 664. These results establish that the -10 region identified in Fig. 1 constitutes part of the functional promoter. The associated -35 region (spacing of 18 nt) is the only potential candidate for this region of the promoter. To confirm that the promoter established in the plasmid system functions in the chromosome, the same region examined in Fig. 2 was first inserted into the single copy integration vector pDH32 such that it would drive the spoVG-lacZ fusion in this plasmid. The new plasmid (pMH228) was linearised and inserted into the amyE locus of B. subtilis SU187 by transformation. The transformants obtained were blue (compared with controls) on XGal plates, establishing that the inserted region had promoter activity as expected. One of the transformants (SU226) was examined in Southern transfer and hybridization experiments (data not shown) to establish the chromosomal structure shown in Fig. 3 (upper section). RNA isolated from exponentially growing SU226 was used in primer extension experiments with reverse transcriptase to see if the expected promoter was functional. Results using the 25-mer primer identified in Fig. 1 are shown in Fig. 3 (lower section). In this experiment RNAs from three strains were examined: lane 1, SU226; lane 2, SU187 (terC-region deleted); and lane 3, wt (strain 168). Panels A and B show a shorter and longer exposure of the autoradiograph, respectively. As expected, lane 2, in which the strain with the terC-region deleted was examined, shows no detectable transcript. For lane 1, in which the new strain (SU226) containing the promoter driving spoVG-1acZ at the amyE locus was examined, there is a prominent transcript in both exposures. The tsp corresponds to the A (nt 663) in the sequence of Fig. 1. This agrees well (just a single nt difference) with the tsp observed with the plasmid system and establishes that the promoter is functional when resident in the chromosome. In the case of the wt 168 strain, a barely detectable level of the same transcript appeared in the longer exposure. From three separate experiments the ratio of the transcript identified in SU226 compared with wt was
10 29 f 4 (av. dev.). The former lacks RTP (rtp gene deleted), and the result is strong evidence for the repression of transcription of rtp in the wt strain by RTP. It should also be pointed out that there was no detectable transcript in lane 3 (wt) within 180 nt upstream from nt 663. Additional 25-mers downstream from that shown in Fig. 1 were also used for primer extension in this series of experiments. The same transcript was detected in SU226 with these primers, but it was significantly less intense; it was not detectable at all in the wt (data not shown).
SU226 amyE
amyE
back
CmR
Prfp
ir
1
2
3
s@‘G-/acZ 4.6 kb
1
2
3
front
4
GATC
T
/
\
Fig. 3. Analysis of transcripts from the rtp promoter region inserted at the amyE locus in the B. subtilis chromosome. The upper section shows the structure of the region of the SU226 chromosome resulting from insertion of the Prtp-spoVG-lacZ fusion at the amyE locus. To construct SU226, the 300-bp BamHI segment of pWS40 (legend to Fig. 2) containing the rtp promoter was first inserted into the BamHI site of pDH32 (D.J. Henner, personal communication; see Shimotsu and Henner, 1986) to yield plasmid pMH228. This new plasmid contained the promoter in an orientation that would drive the spoVG-lacZ fusion. Plasmid pMH228 was linearized with PstI and inserted into the amyE locus of B. subtilis SU187 (terC-region deleted), selecting for Cms. SU226 has the genotype amyE::cat (pMH228) A rtp thyA thyB1. The lower section shows the results of examination of RNA from SU226 for transcripts from the Prtp region. RNAs from two control strains, SU187 (terCregion deleted) and wt (strain 168), were also examined. Penassay broth cultures were grown at 37°C to mid-log phase (A590nm= 0.5-0.7) in the presence of appropriate supplements (thymine at 20 pg/ml for SUl87 and SU226) and RNA extracted according to the method of Wu et al. (1989). Primer extension analysis was also performed according to the procedure of Wu et al. (1989) using a 25-mer primer, labelled with 32P at the 5’ end, complementary to the segment shown in Fig. 1. Lanes: 1, SU266; 2, SU187; 3, wt 168. A and B represent exposures of the autoradiographs for 1 and 6 days, respectively. The sequencing lanes are identified by the letters G, A, T, C. Arrows point to the tsp (sequence orientation is opposite to that in Fig. 2, and there is one nt difference; see section aI
(b) Effect of RTP on in vitro transcription from the rtp promoter To obtain direct evidence that RTP represses its own synthesis at the transcriptional level, the effect of RTP on transcription by purified CY*RNA polymerase from the rtp promoter, compared with a control promoter, was examined. The DNA templates used are shown in Fig. 4. The rtp promoter (Prtp) was present in a 560-bp fragment of plasmid pWS10 (Smith et al., 1985), while the control promoter (a CJ*promoter for the divlB gene) was present in a 790-bp fragment of plasmid pLHl1 (Harry and Wake, 1989 and in preparation). Run-off transcripts from these promoters would have sizes of 340 and 600 nt, respectively (Fig. 4). They were easily separable by gel electrophoresis. Fig. 5 (upper section) shows the effect of increasing amounts of RTP on the production of these transcripts from an approximately equimolar mixture of the two templates. Lane 1 contains no RTP. Lanes 2-6 contain increasing amounts of RTP, while lane 7 contains heat denatured RTP at the same level as that of native RTP in lane 6. It is clear that as the RTP:DNA template ratio is increased, the 340-nt rtp transcript is preferentially reduced. This was the case in several replicate experiments. At higher RTP levels transcription from the control promoter also appears to be reduced, but less Saul pWSl0
340
EcoRV
*
Haelll
pLHI1 ?
WMB l
I 600
Fig. 4. Maps of DNA templates used for in vitro transcription. The promoter for rtp (Prtp) was contained in a 560-bp fragment of plasmid pWSl0 (Smith et al., 1985). IRI and IRII are shown as short convergent arrows. The promoter for diolB (PdivIB) was contained in a 790-bp fragment of pLHl1 (Harry and Wake, 1989). The upward arrowheads under the maps represent the tsp; the sizes (in nt) of the expected runoff transcripts are given under the maps.
11 1
2
3
4
5
6
7
600-
3 E
lo_
P. $J g
0.8-
c .g b f 9 k
0.6
(c) RTP represses expression from the VQJpromoter in vivo B. subtilis SU209 is a strain in which rtp is under the
0.4
g G t
markedly. This could be accounted for by non-specific binding of RTP, which is a basic protein, to the DNA templates at these levels. There were some variations in the amount of recovered sample loaded in sequential lanes, and this was observed consistently. It was possibly due to losses during deproteinization and precipitation of reaction products prior to gel loading. The heated RTP control (lane 7) shows no preferential loss of the rtp transcript; actually it is somewhat enhanced relative to the dioZB transcript. In Fig. 5 (lower section) the amount of rtp transcript relative to the divZB transcript is plotted against the RTP:DNA template molar ratio. At a ratio of 5, transcription from the rtp promoter is preferentially reduced to approximately 50%; at a ratio of 20, this is lowered further to < 10%. With the knowledge that eight monomers of RTP would be needed to saturate IRI plus IRII adjacent to the rtp promoter of pWS10 (Lewis et al., 1990), it is concluded that RTP specifically blocks transcription by cr* RNA polymerase from the rtp promoter.
0.2_
0
5
RTP
10
20
: DNA template (molar ratio)
Fig. 5. Effect of RTP on in vitro transcription
from the
rtp promoter.
Approximately equimolar amounts of the DNA templates shown in Fig. 4 (20 and 27 ng for the Prtp and PdiulB fragments, respectively) were mixed in TGMK buffer [50mM TrisHCl pH 7.8/50% (v/v) glycerol/l0 mM MgCl,/SO mM KCI] in a volume of 12 ~1. RTP (Lewis et al., 1990) in TGMK (1 ~1) was added at the appropriate concentration (for the control, RTP was denatured by heating at 100°C for lo-15 min). Reaction tubes were incubated at 37°C for 10 min and cooled on ice. Then 22 ul of transcription
buffer (45 mM TrisHCl
pH 7.6/227 mM
NaCl/7 mM MgClJ227 uM EDTA/227 uM DTT/36% (v/v) glycerol/2.5 ug BSA fraction V), 5 ul B. subtilis u* RNA polymerase (2.6 mg/ml, 103-IO4 units/mg; see Helman et al., 1988) and 5 ul of a solution containing 1 mM [cL-~‘P]CTP (10 uCi) and 2 mM each of ATP, UTP and GTP were added. After a further 10 min on ice, transcription was started by shifting to 37°C. After 1 min rifampicin was added to 10 ug/ml, and the reactions were terminated after a further 5 min by addition of 200 11 0.1 M TrisHCl pH 7.9/0.2% SDS/l00 pg per ml tRNA/lO mM EDTA. After phenol extraction, the reaction products were precipitated with 0.5 vol. 7.5 M NH,.acetate plus 2.5 vol. ethanol. After washing with NH,.acetate-ethanol, the precipitate was dissolved in 4 ul DEPC (diethylpyrocarbonate)-treated water. Samples were analysed on 2% agarose-2.2 M HCHO gels as described by Maniatis et al. (1989). After electrophoresis, gels were dried and exposed for autoradiography. Autoradiographs are shown in the upper section. Lanes: l-6, RTP monomer:DNA template ratio of 0, 5, 10, 15, 20 and 40, respectively; 7, heat-denatured RTP monomer:DNA ratio of 40. The sizes of the transcripts are indicated in nt. The lower section shows the relative change in the normalized ratio of Prtp:PdiolB transcript as a function of the RTP monomer:DNA template ratio. The results represent the average of three separate experiments; bars show average deviations.
control of the IPTG-inducible spat-Z promoter (Smith and Wake, 1989). The Prtp-spoVG-lac.2 fusion, assembled in plasmid pKS7, was inserted into SU262, a derivative of SU209 (see legend to Fig. 6) at the pyr locus to give SU276. The structure of plasmid pKS7 inserted (in single copy) into SU262 to give SU276, and the structure of the relevant chromosomal regions of SU276 (confirmed by Southern transfer experiment, data not shown) are given in Fig. 6 (see legend for genotypes). The effect of rtp expression (induction by IPTG) on the production of (3Gal from the Prtp-controlled lacZ gene was examined. It should be noted that in SU276 the direction of transcription from Prtp is opposite to that of the transcription of genes of the pyr operon which flank the erm-Tn segment (see Quinn et al., 1991). Thus, transcription from chromosomal genes would be unlikely to contribute to the transcription of 1acZ. SU276 was grown in minimal medium plus supplements until mid-log phase, then diluted 50-fold into two lots of fresh media, one with and one without IPTG. The growth rates of the two cultures were identical. After seven generations, cells were harvested for (3Gal assays. Table I shows the results for four separate experiments. SU277, a control strain isogenic to SU276 but lacking the pKS7 insert, shows an insignificant level of BGal. In the absence of IPTG (no RTP), SU276 gives a level of 1523 MUG units. In the presence of IPTG, the level of PGal is reduced to 23% of that in its absence. This provides direct evidence for the in vivo repression of the rtp promoter by RTP. It should be pointed out that the decision to insert the Prtp-spoVG-1acZ fusion
12 TABLE
I
Effect of IPTG Straina
SU276 SU277
on PGal production
in E. subtilis SU276
PGalb - IPTG
+IPTG
1523+59 (n=4) 2kO.5 (n=3)
355&18 (n=4) _
“SU276 contains the pKS7 insertion, and SU277 is isogenic not contain the insertion. See the legend to Fig. 6. “Values of specific activity (&average
deviation;
dent assays) are in MUG units (picomoles
Kpnl
n = number
but does
ofindepen-
of MUG hydrolysed
per min
per ml of culture of OD= 1 at 30°C). Methods: To obtain the extracts for these assays, SU276 was grown at 37°C in GM1 1 (minus isoleucine and valine) (Smith and Wake, 1988) supplemented with uracil (50 ug/ml), tryptophan (20 ug/ml) and Cm (5 ug/ml). After reaching mid-log phase, the culture was diluted 50-fold into fresh medium (with and without 5 mM IPTG) to give Aeoo om= +- 0.005 and cultures grown to mid-log phase, A 600 nm= 0.2-0.3). Cells were then collected for BGal
SU276
assay (Nicholson of IPTG. Spat
.
em
SPOVG-IacZ
it-
Fig. 6. Plasmid chromosome Tn9I 7 portion
pKS7 and insertion,
1990). SU277 was grown
in the absence
Tn
4.6 kb -
in single copy, into the B. subtilis
at the pyr locus to give SU276. of pTV1 (Youngman,
Prtp
and Setlow,
To construct
1987) was isolated
pKS7,
the
as a PstI-EcoRI
fragment and joined to the large AatII-EcoRI fragment of pGEM3Zf(+) (Promega, Madison, WI, USA) to give plasmid pWS72. The PrtpspoVG-lacZ segment of pMH228 (see legend to Fig. 3) and the Pma gene of pBT48 (Brantl et al., 1990) were inserted into pWS72 through several steps, one involving removal of the XhoI-Sal1 portion of the em region, to yield the E. coli plasmid pKS7 (structure shown). This was linearized with EcoRI and inserted by double crossover into Tn917 at the pyr locus in B. subtilis strain SU262. SU262 is a derivative of SU209 (Smith and Wake, 1989) transformed with DNA to erythromycin resistance by the Tn917 strain (BGSC lA610) of Vandeyar and Zahler (1986). Because of difficulties in selecting directly for the single-copy PmR gene, transformation of SU262 with linearized pKS7 was performed by congression after including wt DNA and selecting first for His’ colonies. The His+ transformants were patched onto XGal plates and blue colonies checked for Pma. This gave SU276, whose chromosomal structure was established in a Southern transfer experiment. SU277 is a His+ transformant not containing the pKS7 insertion. The genotype of SU276 is pyr-83::Pma (pKS7) n pWS49 iltCl/iluCf; Q = Cambell insertion.
into the pyr locus, rather than the amyE locus, in the experiments described in this section was made because SU209, which allows the IPTG-inducible expression of rtp, is CmR, and this precludes selection by CmR for insertion of the pDH3Zbased (Cm”) plasmids into the amyE locus. The approximately fourfold lowering in PGal by RTP in these experiments compares with an approximately 30fold reduction in mRNA from Prtp in the presence of RTP found in the experiment of Fig. 3 using a different system. While the origin of the difference is not clear, the results of the two approaches in terms of repression of
rtp by its protein product are conclusive. The concentration of IPTG (5 mM) used in the approach described in this section would be expected to give an optimal production of RTP (see Smith and Wake, 1989). However, the level of production of RTP by IPTG in SU276 has not been compared directly with the level present in the wt strain. Experiments to measure directly the concentration of RTP in vivo in various B. subtilis strains under a range of conditions are in progress. While unlikely, it has not been ruled out that transcription from a region to the right of Prtp in SU276 (Fig. 6) and back through spoVG-lacZ accounts for the residual level of PGal in the presence of RTP. The gene for the replication terminator protein, Tus, of Escherichia coli is also autoregulated (Natarajan et al., 1991; Roecklein et al., 1991; Roecklein and Kuempel, 1992). It was originally suggested (Smith and Wake, 1988) that, as well as being autoregulated, expression of the rtp of B. subtilis might also be cell cycle controlled such that RTP is synthesized at the end of each round of replication. This would coincide with the release of bound RTP from IRI when the anticlockwise fork passes through IRI to fuse with the arrested clockwise fork (Lewis et al., 1990). This has so far proven difficult to test.
ACKNOWLEDGEMENTS
We thank Dr. M. Chamberlin (University of California, Berkeley) for the gift of cr* RNA polymerase. This work received financial support from the Australian Research Council and the Sir Zelman Cowan Universities Fund.
13 T.,
REFERENCES Ahn,
K.-S.
and
sequence
Wake,
R.G.:
spanning
Variations
the replication
and
coding
terminus
features
and W23 chromosomes. Gene 98 (1991) 107-I 12. Aiba, H., Adhya, S. and de Crombrugghe, B.: Evidence tional
gal promoters
1910.
S., Behnke. D. and Alonso, J.C.: Molecular
cation
region
Carrigan.
Nucleic
Carrigan,
with plasmids
pAMB1 and
J.A., Smith, M.T. and Wake, R.G.: Sequence
of the replication
some. Nucleic
of the repli-
Acids Res. 18 (1990) 4783-4790.
C.M., Haarsma,
features
analysis
Streptococcus agalactiae plasmid
of the conjugative
in Bacillus subtilis. Comparison
pIPSO
pSM19035.
for two func-
Escherichia coli cells. J. Biol. Chem.
in intact
256 (1981) 11905-I Brantl.
of the
subtilis 168
of Bacillus
of the Bacillus subtilis chromo-
terminus
Acids Res. 15 (1987) 8501-8509.
C.M., Pack, R.A., Smith, M.T. and Wake, R.G.: The normal
terC region manner
of the Bacillus subtilis chromosome
to arrest
the clockwise
replication
acts
in a polar
fork. J. Mol. Biol. 222
(1991) 197-207. d’Aubenton
Carafa,
Y.. Brody,
E. and Thermes,
C.: Prediction
of Rho-
independent Escherichia coli transcription terminators. A statistical analysis of their RNA stem-loop structures. J. Mol. Biol. 216 (1990) 835-858. Harry,
E.J. and Wake, R.G.: Cloning
division
initiation
in another Helmann.
and expression
gene for which a homolog
organism.
J. Bacterial.
J.D., Masiarz,
of a Bacillus subtilis
has not been identified
I71 (1989) 6835-6839.
F.R. and Chamberlin,
M.J.: Isolation
of the Bacillus subtilis crz8 factor. J. Bacterial.
acterization
and char170 (1988)
1560-1567. Hu, M.C.-T.
and Davidson,
cloned genomic venient
N.: Mapping
transcription
DNA with T4 DNA polymerase:
technique.
the
replication
J. Bacterial.
terminus
Ralston,
Identification the terminus ometry Maniatis,
conservation W23.
I71 (1989) 1402-1408.
Bacillus subtilis. Res. Microbial. P.J.,
sequence
in Bacillus subtilis 168 and
Lewis, P.J. and Wake, R.G.: Termination Lewis,
on
Gene 42 (1986) 21-29.
Lewis, P.J. and Wake, R.G.: DNA and protein at
start points
a precise and con-
G.B.,
Christopherson,
of the replication
replication
RI.
terminator
and
protein
T., Fritsch,
Wake,
binding
region of the Bacillus subtilis chromosome
of the binding.
and analysis
of chromosome
in
142 (1991) 8933900. R.G.: sites in
and stoichi-
J. Mol. Biol. 214 (1990) 73-84.
E.F. and Sambrook,
of messenger
J.: Extraction,
RNA from eukaryotic
purification,
cells. In: Maniatis,
Fritsch,
E.F.
and
Sambrook,
J.:
Molecular
Cloning.
A
Laboratory Manual, 2nd ed., Vol. 1. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. NY, 1989, pp. 7.37-7.45. Mongkolsuk, S., Chiang, Y.-W., Reynolds, R.B. and Lovett, P.S.: Restriction fragments that exert promoter activity during postexponential growth of Bacihs subtilis. J. Bacterial. 155 (1983) 189991406. Natarajan, S., Kelley, W.L. and Bastia, D.: Replication terminator protein of Escherichin coli is a transcriptional repressor of its own synthesis. Proc. Natl. Acad. Sci. USA 88 (1991) 386773871. Nicholson, W.L. and Setlow, P.: Sporulation, germination and outgrowth. In: Harwood. C.R. and Cutting, SM. (Eds.), Molecular Biological Methods for Bacillus. John Wiley & Sons, Chichester, 1990, pp. 431-443. Quinn, C.L.. Stephenson, B.T. and Switzer, R.L.: Functional organization and nucleotide sequence of the Bacillus subtilis pyrimidine biosynthetic operon. J. Biol. Chem. 266 (1991) 9113-9127. Roecklein, B.A. and Kuempel. P.L.: In vivo characterization of fus gene expression in Escherichia co/i. Mol. Microbial. 6 (1992) 165551661. Roecklein, B.A.. Pelleteir, A. and Kuempel. P.L.: The tus gene of Escherichia coli: autoregulation, analysis of flanking sequences and identification of a complementary system in Salmonella typphimurium. Res. Microbial. 142 (1991) 169-175. Shimotsu. H. and Henner, D.J.: Construction of a single-copy integration vector and its use in analysis of regulation of the trp operon of Bacillus subtilis. Gene 43 (1986) 85-94. Smith, M.T. and Wake, R.G.: DNA sequence requirements for replication fork arrest at terC in Bacillus subtilis. J. Bacterial. 170 (1988) 4083-4090. Smith. M.T. and Wake, R.G.: Expression of the rtp gene of Bacillus subtilis is required for replication fork arrest at the chromosome terminus. Gene 85 (1989) 187-192. Smith. M.T. and Wake. R.G.: Definition and polarity of action of DNA replication terminators in Bacillus subtilis. J. Mol. Biol. 227 (1992) 648-657. Smith, M.T., Aynsley, C. and Wake, R.G.: Cloning and localization of the Bacillus subtilis chromosome replication terminus, rerC. Gene 38 (1985) 9-17. Vandeyar, M.A. and Zahler, S.A.: Chromosome insertions of Tn917 in Bacillus subtilis. J. Bacterial. 167 (1986) 530-534. Wu, J.-J., Howard, M.G. and Piggot, P.J.: Regulation of transcription of the Bacillus subtilis spoIlA locus. J. Bacterial. 171 (1989) 692-698. Youngman, P.: Plasmid vectors for recovering and exploiting Tn917 transpositions in Bacillus and other Gram-positive bacteria. In: Hardy, K.G. (Eds.), Plasmids - A Practical Approach. IRL, Oxford, 1987. pp. 799103.
B.V. All rights
reserved.
7
0378-l 119/93/$06.00
GENE 07265
Autoregulation of the gene encoding the replication terminator protein of Bacillus sub tilis (Gene expression; oA promoter; rrp; transcription; terC)
K.S. Ahn, M.S. Malo, M.T. Smith and R.G. Wake Department of Biochemistry, University of Sydney, Sydney, NSW 2006, Australia Received by R.E. Yasbin: 5 February
1993; Accepted:
26 March
1993; Received at publishers:
13 May 1993
SUMMARY
One of two putative oA promoters identified previously in the region immediately upstream from the rtp gene (encoding the replication terminator protein) [Smith and Wake, J. Bacterial. 170 (1988) 4083-40901 has been shown by transcription start point (tsp) mapping to be the functional rtp promoter. In these tsp mapping experiments, it was observed that the level of mRNA from this promoter, Prtp, was increased by a factor of 30 in the absence of the replication terminator protein (RTP), consistent with the autoregulation of rtp at the level of transcription. In vitro transcription from Prtp by oA RNA polymerase has been shown to be specifically repressed by RTP. A Prtp-spoVG-lacZ fusion was inserted into the chromosome of a strain in which RTP production was inducible by IPTG. Addition of IPTG to cultures of the new strain lowered PGal production by a factor of at least four. It is concluded that rtp is autoregulated in vivo at the level of transcription.
INTRODUCTION
The replication terminator protein (RTP) of BaciZZus is involved in arresting the chromosomal clockwise replication fork at terC (terminus of the chromosome) as the first stage in termination of a round of replication (see review by Lewis and Wake, 1991). The protein binds to two DNA terminators defined by 47and 48-bp inverted repeats (IRI and IRII, respectively) which are located adjacent to and just upstream from the subtilis
Correspondence to; Dr. R.G. Wake, Department of Biochemistry, University of Sydney, Sydney, NSW 2006, Australia. Tel. (61-2) 6922504; Fax (61-2) 692-4726; e-mail: [email protected] Abbreviations: aa, amino acid(s); Ap, ampicillin; B., Bacillus; BGal, bgalactosidase; bp, base pair(s); Cm, chloramphenicol; IPTG, isopropylP-o-thiogalactopyranoside; IR. inverted repeat(s); kb, kilobase or 1000 bp; MUG, 4-methylumbelliferyl-P-D-galactopyranoside; Nm, neomycin; nt, nucleotide(s); orf; open reading frame; P, promoter; Pm, phleomycin; R. resistance; RTP, replication terminator protein; rtp, gene encoding RTP; tsp, transcription start point(s); wt. wild type; XGal. 5-bromo-4-chloro-3-indolyl-B-D-galactopyranoside.
gene (rtp) that encodes it (see Fig. 1, upper section). It was noted previously (Smith and Wake, 1988) that two potential crA promoters were present just upstream from rtp in the vicinity of IRI and IRII, and that the binding of RTP to IRI and IRII might function to autoregulate expression of the gene at the level of transcription. The canonical (TATAAT) -10 region (around nt 653) for one of the promoters is identified in the B. subtilis 168 sequence of Fig. 1 (lower section); it is separated by 18 nt from the putative - 35 region (TTGAAG). These - 10 and -35 regions remain unaltered in the closely related B. subtilis W23 strain (spacing reduced to 17 nt; Lewis and Wake, 1989) which has also been shown to encode and express rtp. The -10 and -35 regions of the other candidate promoter in the 168 strain (- 10 around nt 7 17, and for which the spacing is somewhat high at 20 nt) are not conserved in the W23 strain. This suggests that the - 10 and - 35 regions identified in Fig. 1 constitute the functional promoter. It should also be noted that a sequence corresponding to a Rho-independent transcriptional terminator is present just upstream from and
8
516
576
AAACAGCGGGATTATGGTCAACAAATCCTTAAAAATGAAAACCTGTCTTTCGACAGGTTTTTTTATTTGAAT --
588
or1405 v
648
GAAATCCGTACCGGTAAAATGAGATATGTAAACCCTGGCAATCGTTTAAATTGAAGATAGCAGTAAATGCAG ............___._....... -35 1%mer +I (Cl
t1 (PI
660 GC
720
ATAATAGAACTAAGAAAACTATGTACCAAATGTTCAGTC I
-10
AAATTTATTTTTTCCGCTACACCTATAAT 7
732
732
CAGTAAACATGAAATAACTGGACTATCAGTCTTTAATATAAAG~GGAAAAC~TAAAAGAAAATTGAATAT ................----.-----....... w II 25-mer 864
M K E EKRSSTG 804 TTAGTACATAGTGTTGTCAGTGACAGAAGAAGGAGTGCATATGATGAAAGAAGAAAAAAGGAGTTCAACAGG SD 4
Fig. 1. Features of the nt sequence upstream from rtp in E. subtilis 168. The upper section shows rtg and the upstream IR region extending just beyond IRI and IRII. The clockwise replication fork enters this region from the right and is arrested by the appropriately oriented IRI. The hairpin structure to the left of IRI represents an efficient Rho-independent transcriptional terminator for a gene immediately to its left. The lower section shows the sequence spanning the inverted repeats and the putative o* promoter for rtp; itextends into the beginning of rtp. The sequence numbering is according to Carrigan et al. (1987). IRI and IRII are defined by long convergent arrows below the sequence. The -10 and -35 regions of the putative cr* promoter, as well as the ribosome-binding site (SD), are singly underlined. The double underlining identifies the Rho-independent transcription terminator of the upstream gene. The boxed, shaded region is protected against DNase I cleavage upon binding of RTP to IRI (Lewis et al., 1990). The solid arrowhead just to the right of nt 588 represents the site of insertion of orf405 in the chromosome of B. subtilis W23. The large, vertical, solid arrows define the limits of the sequence present in plasmid pWS44. The broken underlining defines segments corresponding to primers used for tsp mapping; for the 25-mer, the primer was the complement of the sequence identified. The vertical arrows labelled + l(P) and + l(C) define the tsp (right to left) established for this sequence present in either plasmid pWS44 or after insertion into the chromosomal amyE locus, respectively. The aa sequence for the N-terminal segment of RTP is shown in single-letter form.
within 60 nt of the -35 region. It would yield a tetranucleotide loop and has a very long stretch of T residues. On the basis of the d value (+ 27) calculated according to d’Aubenton Carafa et al. (1990), this terminator would be very efficient and impede transcription from proceeding into the sequence shown in Fig. 1 from a region further upstream from it. Consistent with the conclusion that rtp is transcribed independently from a promoter downstream from this terminator is the finding that the W23 strain contains a large open reading frame (orf405) inserted at a position just 32 nt upstream from the -35 region (Ahn and Wake, 1991; see Fig. 1); orf405 reads in a direction opposite to that of rtp. It is now well established that IRI is the functional chromosomal terminator in vivo (Carrigan et al., 1991; Smith and Wake, 1992). RTP binds tightly to IRI, and the shaded segment in Fig. 1 shows the region protected against DNase I cleavage by such binding (Lewis et al., 1990). The protected region spans the -10 portion of the putative promoter, and the bound RTP would be expected to interfere with the binding of RNA polymerase at this site. These more recent observations strengthen the earlier suggestion that RTP regulates expression of its own gene.
In this paper, the promoter for rtp has been identified and found to correspond to that defined by the -10 and - 35 regions shown in Fig. 1. Both in vitro and in vivo experiments have established that RTP represses transcription from this promoter to enable RTP to autoregulate its own synthesis at the level of transcription.
RESULTS AND DISCUSSION
(a) Transcriptional
start point for rfp
Early attempts to detect mRNA for rtp in B. subtiiis by dot hybridization were inconclusive and suggested that the mRNA level was very low (N.K. Williams and R.G.W., unpublished). For this reason an E. co&B. subtilis shuttle plasmid (pWS44; Fig. 2, left panel) was constructed. It contained the sequence between the large filled arrows of Fig. 1 such that a promoter within the sequence would drive a cat (CmR) gene. Plasmid pWS44 was introduced into the B. subtilis terC-region-deleted strain SU187 (Carrigan et al., 1991), selecting for CmR, to give strain SU201. (Resistance to relatively high levels of Cm, compared with a control, established that the
9
c
-7 E
-_
=t
=i T
-t-A
A
A A A G A’
= : = -\
A A
_. I.
_.
Fig. 2. Mapping the tsp (within the sequence of Fig. 1 between large vertical arrows) present in the E. d-B. subtilis shuttle plasmid pWS44. The left panel shows the structure of pWS44. The upstream limit of the B. subtilis sequence present in pWS44, nt 582, corresponds to that in pWS27 (Smith and Wake, 1988). This was used as the starting plasmid to provide eventually (through several steps) a BamHI fragment containing nt 582-816 which was inserted into the BarnHI-cut pUC19 to yield pWS40. Plasmid pWS44 is a chimera constructed by joining the &I-cut pWS40 and PstI-cut pPL703 (Mongkolsuk et al., 1983). The right panel shows the result of mapping the tsp within the B. subtilis sequence present in pWS44. Plasmid pWS44 was introduced into B. subtilis SU187 to give SU201. SU201 was grown at 37°C in Penassay broth containing 10 pg Cm/ml and 10 pg Nm/ml. At log phase (A600nm=0.4) cells were harvested and RNA extracted according to Aiba et al. (1981). Transcripts were analysed by the T4 DNA polymerase method of Hu and Davidson (1986) using a single-stranded DNA template (gapped duplex) prepared by cutting pWS44 with PstI and digesting with T4 DNA polymerase in the absence of dNTPs. This template was also used for standard dideoxy sequencing. The primer used in the extension stage of the protocol (and for sequencing) was an lb-mer corresponding to nt 581-599 of the terC-region sequence (Fig. 1). Lane 1 is a control (no RNA), while lanes 2, 3 and 4 contained 25, 50 and 100 pg of RNA, respectively (plus 1 Kg of DNA template) in the hybridization step. Sequencing lanes are labelled with appropriate letters.
inserted sequence did indeed contain a functional promoter operative in B. subtilis.) RNA was isolated from log phase SU201 and used for mapping of the transcript from the inserted promoter by the T4 DNA polymerase method of Hu and Davidson (1986). The results are
shown in Fig. 2 (right panel). Lane 1 is a control (no RNA), while lanes 2-4 contain increasing amounts of RNA. A cluster of three specific bands, which increase in intensity with an increase in added RNA, is generated in each case. The other faint bands higher up the sequence ladder are relatively constant in intensity with the three levels of RNA used. Assuming the most intense band in the cluster to represent the limit of the extended primer blocked by the mRNA, the tsp of the latter corresponds to A* in Fig. 2, which is at nt 664 in the sequence of Fig. 1. It should be noted that the analysis for the experiment in Fig. 2 examined the sequence from nt 615 to approx. 820, establishing that there is no other significant tsp downstream from that at nt 664. These results establish that the -10 region identified in Fig. 1 constitutes part of the functional promoter. The associated -35 region (spacing of 18 nt) is the only potential candidate for this region of the promoter. To confirm that the promoter established in the plasmid system functions in the chromosome, the same region examined in Fig. 2 was first inserted into the single copy integration vector pDH32 such that it would drive the spoVG-lacZ fusion in this plasmid. The new plasmid (pMH228) was linearised and inserted into the amyE locus of B. subtilis SU187 by transformation. The transformants obtained were blue (compared with controls) on XGal plates, establishing that the inserted region had promoter activity as expected. One of the transformants (SU226) was examined in Southern transfer and hybridization experiments (data not shown) to establish the chromosomal structure shown in Fig. 3 (upper section). RNA isolated from exponentially growing SU226 was used in primer extension experiments with reverse transcriptase to see if the expected promoter was functional. Results using the 25-mer primer identified in Fig. 1 are shown in Fig. 3 (lower section). In this experiment RNAs from three strains were examined: lane 1, SU226; lane 2, SU187 (terC-region deleted); and lane 3, wt (strain 168). Panels A and B show a shorter and longer exposure of the autoradiograph, respectively. As expected, lane 2, in which the strain with the terC-region deleted was examined, shows no detectable transcript. For lane 1, in which the new strain (SU226) containing the promoter driving spoVG-1acZ at the amyE locus was examined, there is a prominent transcript in both exposures. The tsp corresponds to the A (nt 663) in the sequence of Fig. 1. This agrees well (just a single nt difference) with the tsp observed with the plasmid system and establishes that the promoter is functional when resident in the chromosome. In the case of the wt 168 strain, a barely detectable level of the same transcript appeared in the longer exposure. From three separate experiments the ratio of the transcript identified in SU226 compared with wt was
10 29 f 4 (av. dev.). The former lacks RTP (rtp gene deleted), and the result is strong evidence for the repression of transcription of rtp in the wt strain by RTP. It should also be pointed out that there was no detectable transcript in lane 3 (wt) within 180 nt upstream from nt 663. Additional 25-mers downstream from that shown in Fig. 1 were also used for primer extension in this series of experiments. The same transcript was detected in SU226 with these primers, but it was significantly less intense; it was not detectable at all in the wt (data not shown).
SU226 amyE
amyE
back
CmR
Prfp
ir
1
2
3
s@‘G-/acZ 4.6 kb
1
2
3
front
4
GATC
T
/
\
Fig. 3. Analysis of transcripts from the rtp promoter region inserted at the amyE locus in the B. subtilis chromosome. The upper section shows the structure of the region of the SU226 chromosome resulting from insertion of the Prtp-spoVG-lacZ fusion at the amyE locus. To construct SU226, the 300-bp BamHI segment of pWS40 (legend to Fig. 2) containing the rtp promoter was first inserted into the BamHI site of pDH32 (D.J. Henner, personal communication; see Shimotsu and Henner, 1986) to yield plasmid pMH228. This new plasmid contained the promoter in an orientation that would drive the spoVG-lacZ fusion. Plasmid pMH228 was linearized with PstI and inserted into the amyE locus of B. subtilis SU187 (terC-region deleted), selecting for Cms. SU226 has the genotype amyE::cat (pMH228) A rtp thyA thyB1. The lower section shows the results of examination of RNA from SU226 for transcripts from the Prtp region. RNAs from two control strains, SU187 (terCregion deleted) and wt (strain 168), were also examined. Penassay broth cultures were grown at 37°C to mid-log phase (A590nm= 0.5-0.7) in the presence of appropriate supplements (thymine at 20 pg/ml for SUl87 and SU226) and RNA extracted according to the method of Wu et al. (1989). Primer extension analysis was also performed according to the procedure of Wu et al. (1989) using a 25-mer primer, labelled with 32P at the 5’ end, complementary to the segment shown in Fig. 1. Lanes: 1, SU266; 2, SU187; 3, wt 168. A and B represent exposures of the autoradiographs for 1 and 6 days, respectively. The sequencing lanes are identified by the letters G, A, T, C. Arrows point to the tsp (sequence orientation is opposite to that in Fig. 2, and there is one nt difference; see section aI
(b) Effect of RTP on in vitro transcription from the rtp promoter To obtain direct evidence that RTP represses its own synthesis at the transcriptional level, the effect of RTP on transcription by purified CY*RNA polymerase from the rtp promoter, compared with a control promoter, was examined. The DNA templates used are shown in Fig. 4. The rtp promoter (Prtp) was present in a 560-bp fragment of plasmid pWS10 (Smith et al., 1985), while the control promoter (a CJ*promoter for the divlB gene) was present in a 790-bp fragment of plasmid pLHl1 (Harry and Wake, 1989 and in preparation). Run-off transcripts from these promoters would have sizes of 340 and 600 nt, respectively (Fig. 4). They were easily separable by gel electrophoresis. Fig. 5 (upper section) shows the effect of increasing amounts of RTP on the production of these transcripts from an approximately equimolar mixture of the two templates. Lane 1 contains no RTP. Lanes 2-6 contain increasing amounts of RTP, while lane 7 contains heat denatured RTP at the same level as that of native RTP in lane 6. It is clear that as the RTP:DNA template ratio is increased, the 340-nt rtp transcript is preferentially reduced. This was the case in several replicate experiments. At higher RTP levels transcription from the control promoter also appears to be reduced, but less Saul pWSl0
340
EcoRV
*
Haelll
pLHI1 ?
WMB l
I 600
Fig. 4. Maps of DNA templates used for in vitro transcription. The promoter for rtp (Prtp) was contained in a 560-bp fragment of plasmid pWSl0 (Smith et al., 1985). IRI and IRII are shown as short convergent arrows. The promoter for diolB (PdivIB) was contained in a 790-bp fragment of pLHl1 (Harry and Wake, 1989). The upward arrowheads under the maps represent the tsp; the sizes (in nt) of the expected runoff transcripts are given under the maps.
11 1
2
3
4
5
6
7
600-
3 E
lo_
P. $J g
0.8-
c .g b f 9 k
0.6
(c) RTP represses expression from the VQJpromoter in vivo B. subtilis SU209 is a strain in which rtp is under the
0.4
g G t
markedly. This could be accounted for by non-specific binding of RTP, which is a basic protein, to the DNA templates at these levels. There were some variations in the amount of recovered sample loaded in sequential lanes, and this was observed consistently. It was possibly due to losses during deproteinization and precipitation of reaction products prior to gel loading. The heated RTP control (lane 7) shows no preferential loss of the rtp transcript; actually it is somewhat enhanced relative to the dioZB transcript. In Fig. 5 (lower section) the amount of rtp transcript relative to the divZB transcript is plotted against the RTP:DNA template molar ratio. At a ratio of 5, transcription from the rtp promoter is preferentially reduced to approximately 50%; at a ratio of 20, this is lowered further to < 10%. With the knowledge that eight monomers of RTP would be needed to saturate IRI plus IRII adjacent to the rtp promoter of pWS10 (Lewis et al., 1990), it is concluded that RTP specifically blocks transcription by cr* RNA polymerase from the rtp promoter.
0.2_
0
5
RTP
10
20
: DNA template (molar ratio)
Fig. 5. Effect of RTP on in vitro transcription
from the
rtp promoter.
Approximately equimolar amounts of the DNA templates shown in Fig. 4 (20 and 27 ng for the Prtp and PdiulB fragments, respectively) were mixed in TGMK buffer [50mM TrisHCl pH 7.8/50% (v/v) glycerol/l0 mM MgCl,/SO mM KCI] in a volume of 12 ~1. RTP (Lewis et al., 1990) in TGMK (1 ~1) was added at the appropriate concentration (for the control, RTP was denatured by heating at 100°C for lo-15 min). Reaction tubes were incubated at 37°C for 10 min and cooled on ice. Then 22 ul of transcription
buffer (45 mM TrisHCl
pH 7.6/227 mM
NaCl/7 mM MgClJ227 uM EDTA/227 uM DTT/36% (v/v) glycerol/2.5 ug BSA fraction V), 5 ul B. subtilis u* RNA polymerase (2.6 mg/ml, 103-IO4 units/mg; see Helman et al., 1988) and 5 ul of a solution containing 1 mM [cL-~‘P]CTP (10 uCi) and 2 mM each of ATP, UTP and GTP were added. After a further 10 min on ice, transcription was started by shifting to 37°C. After 1 min rifampicin was added to 10 ug/ml, and the reactions were terminated after a further 5 min by addition of 200 11 0.1 M TrisHCl pH 7.9/0.2% SDS/l00 pg per ml tRNA/lO mM EDTA. After phenol extraction, the reaction products were precipitated with 0.5 vol. 7.5 M NH,.acetate plus 2.5 vol. ethanol. After washing with NH,.acetate-ethanol, the precipitate was dissolved in 4 ul DEPC (diethylpyrocarbonate)-treated water. Samples were analysed on 2% agarose-2.2 M HCHO gels as described by Maniatis et al. (1989). After electrophoresis, gels were dried and exposed for autoradiography. Autoradiographs are shown in the upper section. Lanes: l-6, RTP monomer:DNA template ratio of 0, 5, 10, 15, 20 and 40, respectively; 7, heat-denatured RTP monomer:DNA ratio of 40. The sizes of the transcripts are indicated in nt. The lower section shows the relative change in the normalized ratio of Prtp:PdiolB transcript as a function of the RTP monomer:DNA template ratio. The results represent the average of three separate experiments; bars show average deviations.
control of the IPTG-inducible spat-Z promoter (Smith and Wake, 1989). The Prtp-spoVG-lac.2 fusion, assembled in plasmid pKS7, was inserted into SU262, a derivative of SU209 (see legend to Fig. 6) at the pyr locus to give SU276. The structure of plasmid pKS7 inserted (in single copy) into SU262 to give SU276, and the structure of the relevant chromosomal regions of SU276 (confirmed by Southern transfer experiment, data not shown) are given in Fig. 6 (see legend for genotypes). The effect of rtp expression (induction by IPTG) on the production of (3Gal from the Prtp-controlled lacZ gene was examined. It should be noted that in SU276 the direction of transcription from Prtp is opposite to that of the transcription of genes of the pyr operon which flank the erm-Tn segment (see Quinn et al., 1991). Thus, transcription from chromosomal genes would be unlikely to contribute to the transcription of 1acZ. SU276 was grown in minimal medium plus supplements until mid-log phase, then diluted 50-fold into two lots of fresh media, one with and one without IPTG. The growth rates of the two cultures were identical. After seven generations, cells were harvested for (3Gal assays. Table I shows the results for four separate experiments. SU277, a control strain isogenic to SU276 but lacking the pKS7 insert, shows an insignificant level of BGal. In the absence of IPTG (no RTP), SU276 gives a level of 1523 MUG units. In the presence of IPTG, the level of PGal is reduced to 23% of that in its absence. This provides direct evidence for the in vivo repression of the rtp promoter by RTP. It should be pointed out that the decision to insert the Prtp-spoVG-1acZ fusion
12 TABLE
I
Effect of IPTG Straina
SU276 SU277
on PGal production
in E. subtilis SU276
PGalb - IPTG
+IPTG
1523+59 (n=4) 2kO.5 (n=3)
355&18 (n=4) _
“SU276 contains the pKS7 insertion, and SU277 is isogenic not contain the insertion. See the legend to Fig. 6. “Values of specific activity (&average
deviation;
dent assays) are in MUG units (picomoles
Kpnl
n = number
but does
ofindepen-
of MUG hydrolysed
per min
per ml of culture of OD= 1 at 30°C). Methods: To obtain the extracts for these assays, SU276 was grown at 37°C in GM1 1 (minus isoleucine and valine) (Smith and Wake, 1988) supplemented with uracil (50 ug/ml), tryptophan (20 ug/ml) and Cm (5 ug/ml). After reaching mid-log phase, the culture was diluted 50-fold into fresh medium (with and without 5 mM IPTG) to give Aeoo om= +- 0.005 and cultures grown to mid-log phase, A 600 nm= 0.2-0.3). Cells were then collected for BGal
SU276
assay (Nicholson of IPTG. Spat
.
em
SPOVG-IacZ
it-
Fig. 6. Plasmid chromosome Tn9I 7 portion
pKS7 and insertion,
1990). SU277 was grown
in the absence
Tn
4.6 kb -
in single copy, into the B. subtilis
at the pyr locus to give SU276. of pTV1 (Youngman,
Prtp
and Setlow,
To construct
1987) was isolated
pKS7,
the
as a PstI-EcoRI
fragment and joined to the large AatII-EcoRI fragment of pGEM3Zf(+) (Promega, Madison, WI, USA) to give plasmid pWS72. The PrtpspoVG-lacZ segment of pMH228 (see legend to Fig. 3) and the Pma gene of pBT48 (Brantl et al., 1990) were inserted into pWS72 through several steps, one involving removal of the XhoI-Sal1 portion of the em region, to yield the E. coli plasmid pKS7 (structure shown). This was linearized with EcoRI and inserted by double crossover into Tn917 at the pyr locus in B. subtilis strain SU262. SU262 is a derivative of SU209 (Smith and Wake, 1989) transformed with DNA to erythromycin resistance by the Tn917 strain (BGSC lA610) of Vandeyar and Zahler (1986). Because of difficulties in selecting directly for the single-copy PmR gene, transformation of SU262 with linearized pKS7 was performed by congression after including wt DNA and selecting first for His’ colonies. The His+ transformants were patched onto XGal plates and blue colonies checked for Pma. This gave SU276, whose chromosomal structure was established in a Southern transfer experiment. SU277 is a His+ transformant not containing the pKS7 insertion. The genotype of SU276 is pyr-83::Pma (pKS7) n pWS49 iltCl/iluCf; Q = Cambell insertion.
into the pyr locus, rather than the amyE locus, in the experiments described in this section was made because SU209, which allows the IPTG-inducible expression of rtp, is CmR, and this precludes selection by CmR for insertion of the pDH3Zbased (Cm”) plasmids into the amyE locus. The approximately fourfold lowering in PGal by RTP in these experiments compares with an approximately 30fold reduction in mRNA from Prtp in the presence of RTP found in the experiment of Fig. 3 using a different system. While the origin of the difference is not clear, the results of the two approaches in terms of repression of
rtp by its protein product are conclusive. The concentration of IPTG (5 mM) used in the approach described in this section would be expected to give an optimal production of RTP (see Smith and Wake, 1989). However, the level of production of RTP by IPTG in SU276 has not been compared directly with the level present in the wt strain. Experiments to measure directly the concentration of RTP in vivo in various B. subtilis strains under a range of conditions are in progress. While unlikely, it has not been ruled out that transcription from a region to the right of Prtp in SU276 (Fig. 6) and back through spoVG-lacZ accounts for the residual level of PGal in the presence of RTP. The gene for the replication terminator protein, Tus, of Escherichia coli is also autoregulated (Natarajan et al., 1991; Roecklein et al., 1991; Roecklein and Kuempel, 1992). It was originally suggested (Smith and Wake, 1988) that, as well as being autoregulated, expression of the rtp of B. subtilis might also be cell cycle controlled such that RTP is synthesized at the end of each round of replication. This would coincide with the release of bound RTP from IRI when the anticlockwise fork passes through IRI to fuse with the arrested clockwise fork (Lewis et al., 1990). This has so far proven difficult to test.
ACKNOWLEDGEMENTS
We thank Dr. M. Chamberlin (University of California, Berkeley) for the gift of cr* RNA polymerase. This work received financial support from the Australian Research Council and the Sir Zelman Cowan Universities Fund.
13 T.,
REFERENCES Ahn,
K.-S.
and
sequence
Wake,
R.G.:
spanning
Variations
the replication
and
coding
terminus
features
and W23 chromosomes. Gene 98 (1991) 107-I 12. Aiba, H., Adhya, S. and de Crombrugghe, B.: Evidence tional
gal promoters
1910.
S., Behnke. D. and Alonso, J.C.: Molecular
cation
region
Carrigan.
Nucleic
Carrigan,
with plasmids
pAMB1 and
J.A., Smith, M.T. and Wake, R.G.: Sequence
of the replication
some. Nucleic
of the repli-
Acids Res. 18 (1990) 4783-4790.
C.M., Haarsma,
features
analysis
Streptococcus agalactiae plasmid
of the conjugative
in Bacillus subtilis. Comparison
pIPSO
pSM19035.
for two func-
Escherichia coli cells. J. Biol. Chem.
in intact
256 (1981) 11905-I Brantl.
of the
subtilis 168
of Bacillus
of the Bacillus subtilis chromo-
terminus
Acids Res. 15 (1987) 8501-8509.
C.M., Pack, R.A., Smith, M.T. and Wake, R.G.: The normal
terC region manner
of the Bacillus subtilis chromosome
to arrest
the clockwise
replication
acts
in a polar
fork. J. Mol. Biol. 222
(1991) 197-207. d’Aubenton
Carafa,
Y.. Brody,
E. and Thermes,
C.: Prediction
of Rho-
independent Escherichia coli transcription terminators. A statistical analysis of their RNA stem-loop structures. J. Mol. Biol. 216 (1990) 835-858. Harry,
E.J. and Wake, R.G.: Cloning
division
initiation
in another Helmann.
and expression
gene for which a homolog
organism.
J. Bacterial.
J.D., Masiarz,
of a Bacillus subtilis
has not been identified
I71 (1989) 6835-6839.
F.R. and Chamberlin,
M.J.: Isolation
of the Bacillus subtilis crz8 factor. J. Bacterial.
acterization
and char170 (1988)
1560-1567. Hu, M.C.-T.
and Davidson,
cloned genomic venient
N.: Mapping
transcription
DNA with T4 DNA polymerase:
technique.
the
replication
J. Bacterial.
terminus
Ralston,
Identification the terminus ometry Maniatis,
conservation W23.
I71 (1989) 1402-1408.
Bacillus subtilis. Res. Microbial. P.J.,
sequence
in Bacillus subtilis 168 and
Lewis, P.J. and Wake, R.G.: Termination Lewis,
on
Gene 42 (1986) 21-29.
Lewis, P.J. and Wake, R.G.: DNA and protein at
start points
a precise and con-
G.B.,
Christopherson,
of the replication
replication
RI.
terminator
and
protein
T., Fritsch,
Wake,
binding
region of the Bacillus subtilis chromosome
of the binding.
and analysis
of chromosome
in
142 (1991) 8933900. R.G.: sites in
and stoichi-
J. Mol. Biol. 214 (1990) 73-84.
E.F. and Sambrook,
of messenger
J.: Extraction,
RNA from eukaryotic
purification,
cells. In: Maniatis,
Fritsch,
E.F.
and
Sambrook,
J.:
Molecular
Cloning.
A
Laboratory Manual, 2nd ed., Vol. 1. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. NY, 1989, pp. 7.37-7.45. Mongkolsuk, S., Chiang, Y.-W., Reynolds, R.B. and Lovett, P.S.: Restriction fragments that exert promoter activity during postexponential growth of Bacihs subtilis. J. Bacterial. 155 (1983) 189991406. Natarajan, S., Kelley, W.L. and Bastia, D.: Replication terminator protein of Escherichin coli is a transcriptional repressor of its own synthesis. Proc. Natl. Acad. Sci. USA 88 (1991) 386773871. Nicholson, W.L. and Setlow, P.: Sporulation, germination and outgrowth. In: Harwood. C.R. and Cutting, SM. (Eds.), Molecular Biological Methods for Bacillus. John Wiley & Sons, Chichester, 1990, pp. 431-443. Quinn, C.L.. Stephenson, B.T. and Switzer, R.L.: Functional organization and nucleotide sequence of the Bacillus subtilis pyrimidine biosynthetic operon. J. Biol. Chem. 266 (1991) 9113-9127. Roecklein, B.A. and Kuempel. P.L.: In vivo characterization of fus gene expression in Escherichia co/i. Mol. Microbial. 6 (1992) 165551661. Roecklein, B.A.. Pelleteir, A. and Kuempel. P.L.: The tus gene of Escherichia coli: autoregulation, analysis of flanking sequences and identification of a complementary system in Salmonella typphimurium. Res. Microbial. 142 (1991) 169-175. Shimotsu. H. and Henner, D.J.: Construction of a single-copy integration vector and its use in analysis of regulation of the trp operon of Bacillus subtilis. Gene 43 (1986) 85-94. Smith, M.T. and Wake, R.G.: DNA sequence requirements for replication fork arrest at terC in Bacillus subtilis. J. Bacterial. 170 (1988) 4083-4090. Smith. M.T. and Wake, R.G.: Expression of the rtp gene of Bacillus subtilis is required for replication fork arrest at the chromosome terminus. Gene 85 (1989) 187-192. Smith. M.T. and Wake. R.G.: Definition and polarity of action of DNA replication terminators in Bacillus subtilis. J. Mol. Biol. 227 (1992) 648-657. Smith, M.T., Aynsley, C. and Wake, R.G.: Cloning and localization of the Bacillus subtilis chromosome replication terminus, rerC. Gene 38 (1985) 9-17. Vandeyar, M.A. and Zahler, S.A.: Chromosome insertions of Tn917 in Bacillus subtilis. J. Bacterial. 167 (1986) 530-534. Wu, J.-J., Howard, M.G. and Piggot, P.J.: Regulation of transcription of the Bacillus subtilis spoIlA locus. J. Bacterial. 171 (1989) 692-698. Youngman, P.: Plasmid vectors for recovering and exploiting Tn917 transpositions in Bacillus and other Gram-positive bacteria. In: Hardy, K.G. (Eds.), Plasmids - A Practical Approach. IRL, Oxford, 1987. pp. 799103.