- Email: [email protected]
Autosomal dominant iron overload due to a novel mutation of ferroportin1 associated with parenchymal iron loading and cirrhosis
Journal of Hepatology 40 (2004) 710–713 www.elsevier.com/locate/jhep
Case report
Autosomal dominant iron overload due to a novel mutation of ferroportin1 associated with parenchymal iron loading and cirrhosis Daniel F. Wallace1, Roslyn M. Clark1, Hugh A.J. Harley3, V. Nathan Subramaniam1,2,* 1
Membrane Transport Laboratory, The Queensland Institute of Medical Research, 300 Herston Road, Herston, Brisbane, Qld 4006, Australia 2 Departments of Medicine and Biochemistry, The University of Queensland, Brisbane, Qld, Australia 3 Department of Gastroenterology, Hepatology and General Medicine, Royal Adelaide Hospital, Adelaide, SA, Australia
We report the identification of a novel mutation in ferroportin1 in an Australian family with autosomal dominant iron overload. The phenotype of iron overload in one member of this family is associated with high serum ferritin concentration and elevated transferrin saturation. The pattern of iron overload in the liver shows accumulation predominantly in parenchymal cells with some Kupffer cell iron loading. Although some cases of type 4 haemochromatosis have been associated with the development of liver fibrosis this is the first report of a patient with fully established cirrhosis at a relatively young age (32 years). The coexistence of sarcoidosis in this patient may contribute to the more severe phenotype. This report highlights the phenotypic variability that can occur in type 4 haemochromatosis. Some patients have predominant reticuloendothelial iron loading and normal transferrin saturation whereas others have predominant parenchymal iron loading and elevated transferrin saturation. The reasons for this variability remain to be determined. Interestingly this is the third mutation to affect asparagine 144, reinforcing the important role for this amino acid in the function of ferroportin1. q 2004 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved. Keywords: Haemochromatosis; Iron overload; Ferroportin1; Autosomal dominant; Cirrhosis
1. Introduction Hereditary haemochromatosis comprises a group of disorders which result in impaired iron homeostasis leading to excessive intestinal iron absorption and accumulation in tissues. Untreated, the build-up of iron can lead to tissue damage including cirrhosis, diabetes mellitus, arthropathy, cardiomyopathy, endocrine abnormalities and hepatocellular carcinoma [1]. The most common form (type 1) is an autosomal recessive condition caused by mutations in the HFE gene [2]. Other forms include type 2 or juvenile haemochromatosis which can be caused by mutations in the iron regulatory hormone hepcidin [3] or an as yet unidentified gene on chromosome 1 [4]. Type 3 is caused by mutations in transferrin receptor 2 [5]. Type 4 haemochromatosis is a recently described autosomal dominant iron overload condition caused by mutations in Received 20 October 2003; received in revised form 30 November 2003; accepted 4 December 2003 * Corresponding author. Tel.: þ61-7-33-62-0179; fax: þ 61-7-33620191. E-mail address: [email protected] (V.N. Subramaniam).
the ferroportin1 gene [6,7]. Ferroportin1 also known as SLC11A3, IREG1 or MTP1 encodes a highly conserved transmembrane protein responsible for iron export from cells [8 –10]. Most cases have been associated with an early rise in serum ferritin levels but normal or only mildly elevated transferrin saturations. Generally the pattern of iron distribution in the liver shows preferential accumulation in Kupffer cells and other macrophages. This is in contrast to the other three types where a rise in transferrin saturation precedes a rise in serum ferritin levels and iron accumulation is seen predominantly in parenchymal cells. Mutations in ferroportin1 were first reported by two groups almost simultaneously [6,7]. In both studies autosomal dominant iron overload was shown to associate with mutations in ferroportin1 [6,7]. An asparagine to histidine mutation (N144H) was found in a large pedigree from the Netherlands [6] and an alanine to aspartic acid (A77D) mutation in a large Italian pedigree [7]. To date nine ferroportin1 mutations have been identified, all associated with autosomal dominant iron overload [6,7,11 – 18]. These include a valine deletion V162del, which has been reported in four geographical locations (Australia, UK, Italy and
0168-8278/$30.00 q 2004 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.jhep.2003.12.008
D.F. Wallace et al. / Journal of Hepatology 40 (2004) 710–713
Greece) [11 – 14]. It has been proposed that this deletion of one of a group of three valine residues is a recurrent mutation that has occurred in different populations due to slippage mispairing [13]. Another mutation affecting asparagine 144 (N144T) has been identified in a patient from the Solomon Islands [15]. Whether this is the mutation responsible for the autosomal dominant iron overload syndrome described by Eason et al. [19] in a large Solomon Islands pedigree remains to be determined. There is some phenotypic variability between patients with mutations in ferroportin1. In some patients there is prominent iron accumulation in parenchymal cells reminiscent of HFE-related (type 1) haemochromatosis [20]. Other patients have iron accumulation almost exclusively in reticuloendothelial cells [14]. Transferrin saturation is also variable, being elevated in some patients but normal in others. Venesection as a treatment to remove excess iron has variable success. Many patients cannot tolerate regular venesection and become anaemic whereas others appear to have no problems. The reasons for this phenotypic variability are not clear. We report the identification of a novel mutation (430A . G; N144D) in the ferroportin1 gene which is associated with autosomal dominant iron overload in an Australian family. Heterozygosity for this mutation is associated with a high serum ferritin level in a mother and son. As compared with other reports of patients with mutations in ferroportin1 the son is unusual in having a high serum transferrin saturation, predominantly parenchymal iron loading and fully established cirrhosis at a relatively young age. Interestingly, this is the third reported mutation to affect asparagine 144, suggesting a critical role for this amino acid in the function of ferroportin1.
2. Patients and methods This study was approved by and performed in accordance with the ethical standards of the Queensland Institute of Medical Research Human Research Ethics Committee and with the Helsinki Declaration of 1975, as revised in 1983. Informed and written consent was obtained from the patients for all the studies described in this report.
2.1. Patients The proband was a female who presented at 45 years of age. She had an elevated serum ferritin of 7500 mg/l. Her liver function tests were also
711
abnormal, bilirubin of 35 mmol/l, alanine aminotransferase (ALT) of 195 U/l and aspartic aminotransferase (AST) of 107 U/l. She also had arthropathy in her left knee, hands and feet. She declined liver biopsy but underwent venesection therapy and required 122 venesections to normalise her iron stores. Venesection therapy was tolerated well with no problems associated with anaemia. Her son was diagnosed more recently at 32 years of age. He had a raised ALT of 219 U/l, raised serum ferritin of 10510 mg/l, serum iron was 53 mmol/l and transferrin saturation was 99%. His alcohol intake was not excessive (120 g per week). He also had evidence of pulmonary sarcoidosis, which was confirmed histologically. Liver biopsy demonstrated cirrhosis, a small number of non-caseating sarcoid granulomata and Perls’ stain iron grade of 3 (Fig. 1). Iron deposition was seen in hepatocytes and bile duct epithelial cells but was not particularly prominent in Kupffer cells. The hepatic iron concentration was 393 mmol/g, giving a hepatic iron index of 12.3. He is currently undergoing venesection therapy and has tolerated twice weekly phlebotomy. After 105 venesections his serum ferritin concentration had dropped to 293 mg/l. His haemoglobin level has been monitored prior to each venesection and has not fallen below 127 g/l. Neither the proband nor her son had any immunological abnormalities at presentation and have not shown any increased susceptibility towards infections. Genetic testing for HFE mutations revealed that both mother and son were heterozygous for H63D but negative for C282Y. The father of the proband died at the age of 63 from pancreatic cancer. He also had joint problems and was found to have liver damage postmortem. The proband’s brother and daughter have been tested for iron overload, but both had normal values for both serum ferritin and transferrin saturation. No other family members have been diagnosed with iron overload.
2.2. Molecular studies The eight exons of ferroportin1 were PCR amplified and sequenced from the proband and her son as previously described [11]. PCR products of ferroportin1 exon 5 (primers: forward, TCCACCAAAGACTATTTTAAACTG; reverse, CCATTTGCCAAGTTTGTGT) were used in a Tsp509I restriction endonuclease assay to detect a novel missense mutation 430A . G (N144D). A similar assay has been described previously and works for both the 430A . C (N144T) and 431A . C (N144H) mutations [15]. The presence of any of the three asparagine 144 mutations results in loss of a Tsp509I restriction endonuclease cleavage site.
3. Results and discussion Analysis of the DNA sequence of ferroportin1 in two members of a family with a severe form of apparent autosomal dominant iron overload revealed a novel single nucleotide substitution (430A . G) in exon 5 (Fig. 2A). The substitution results in a change of residue 144 from an asparagine to an aspartic acid (N144D). The presence of the 430A . G substitution was confirmed using a Tsp509I restriction endonuclease digestion assay (Fig. 2B). This assay has been previously described and can be used to detect all three mutations
Fig. 1. Liver biopsy sections from the 32-year-old male patient showing cirrhosis and predominantly parenchymal iron overload. (A) Trichrome stain of liver biopsy showing complete nodular transformation with marked fibrosis (magnification 203). (B) Perls’ stain of liver core biopsy showing a marked degree of iron overload (magnification 403). (C) Perls’ stain showing a marked degree of iron overload. Iron is present predominantly within the hepatocytes with some Kupffer cell iron. Sarcoid granuloma is also present (magnification 1003).
712
D.F. Wallace et al. / Journal of Hepatology 40 (2004) 710–713
affecting asparagine 144 (N144H, N144T and N144D). In a previous study describing the N144T mutation we analysed a control group comprising 100 normal Australian controls [15]. Using the Tsp509I assay all the controls were negative suggesting that all three N144 mutations are rare in the general population [15]. Therefore the N144D mutation reported here likely represents a disease-causing mutation. The phenotype of iron overload in this family conforms to the more parenchymal distribution of iron overload that has been seen in some patients with ferroportin1 mutations [20]. The proband presented with a raised serum ferritin concentration, but transferrin saturation was not measured and she declined liver biopsy, hence a full evaluation of her phenotype cannot be made. However, her son aged 32 years had a raised serum ferritin concentration and transferrin saturation of 99%. He had a raised ALT and liver biopsy showed cirrhosis and iron accumulation predominantly in parenchymal cells. Although many of the patients reported with ferroportin1 mutations have fibrosis, to our knowledge this is the first report of a patient with fully established cirrhosis. It is possible that granulomatous inflammation associated with sarcoidosis may have been a cofactor contributing to fibrosis [21]. The reasons for the wide phenotypic spectrum observed in type 4 haemochromatosis are not clear. Some patients have low transferrin saturations and iron deposition exclusively in reticuloendothelial cells whereas others including the 32-year-old male presented here have raised transferrin saturations and iron predominantly in parenchymal cells. It has been suggested that the particular ferroportin1 mutation a patient carries may play a role in this phenotypic variability [14]. However, patients carrying the same mutation can have contrasting phenotypes. In the Italian family carrying the A77D mutation both the predominantly parenchymal and predominantly reticuloendothelial phenotypes were seen in the same family [7,20]. Age at diagnosis may also play a role. In our study describing the V162del mutation in an Australian family the younger patients had normal transferrin saturations and predominant Kupffer cell iron, whereas those diagnosed at an older age had elevated transferrin saturation and more iron in hepatocytes [11]. Other genetic and environmental factors such as diet and alcohol are also likely to contribute to this phenotypic variability. The tissue distribution of iron in overload disorders is important in the development of tissue damage. Excess iron stores in parenchymal cells appears to be more toxic than in reticuloendothelial cells and it is the iron within parenchymal cells which leads to tissue damage [22]. Therefore, it is likely that the patients who have parenchymal iron loading have a greater risk of developing liver fibrosis. Analysis of biopsy data from the published cases suggests that this is the case. A high transferrin saturation, serum ferritin and age are also associated with the presence of fibrosis. Patients with raised transferrin saturations are also more likely to
Fig. 2. Detection of mutations by DNA sequencing and restriction endonuclease polymorphism. (A) Shows the DNA sequence of wild-type (top panel) and mutant ferroportin1 (bottom panel). (B) PCR products of ferroportin1 exon 5 digested with Tsp509I. Lane 1, proband; lane 2, son of proband; lanes 3 and 4, wild type control DNA. The PCR product is 461 bp in length. When digested with Tsp509I the wild type PCR product yields four fragments of 137, 87, 114 and 123 bp. The 430A > G substitution causes loss of a Tsp509I restriction site and hence yields only three fragments of 224, 114 and 123 bp. The samples in lanes 1 and 2 are heterozygous for the 430A > G substitution and therefore contain both wild type and mutant banding patterns. M, DNA size marker.
tolerate iron removal by venesection better than patients who have lower amounts of circulating iron. The mutation we have identified in an Australian family affects the same amino acid as the Dutch [6] and Solomon Islands [15] mutations. However, in this instance the asparagine at position 144 is replaced by an aspartic acid. Asparagine 144 and the region surrounding it are highly conserved across species. A non-conservative change from an asparagine (amide group) to an aspartic acid (acidic group) would be expected to disrupt the function of ferroportin1.
D.F. Wallace et al. / Journal of Hepatology 40 (2004) 710–713
In conclusion, we have identified a novel mutation in ferroportin1 (N144D) in an Australian family with autosomal dominant iron overload. This mutation is associated with high transferrin saturation, parenchymal iron loading and cirrhosis in one member of the family. This case emphasises the wide spectrum of phenotypes observed among patients carrying ferroportin1 mutations and may provide insights into the role of ferroportin1 in iron homeostasis. Further studies will be required to determine the factors that contribute to phenotypic variability in type 4 haemochromatosis.
Acknowledgements The authors gratefully acknowledge the immense support and encouragement of the patients and their family. We thank Drs Steve Pieterse and Costanzo Fusco for images of liver biopsies. This work was supported by grants from the Haemochromatosis Society of Australia, National Health and Medical Research Council of Australia (953219) and National Institutes of Health, USA (5R01DK057648-02).
References [1] Bothwell TH, Charlton RW, Motulsky AG. Hemochromatosis. In: Scriver CR, Beaudet AL, Sly WS, Valle D, editors. The metabolic and molecular bases of inherited disease, 7th ed. New York, NY: McGraw-Hill; 1995. p. 2237–2269. [2] Feder JN, Gnirke A, Thomas W, Tsuchihashi Z, Ruddy DA, Basava A, et al. A novel MHC class I-like gene is mutated in patients with hereditary haemochromatosis. Nat Genet 1996;13:399–408. [3] Roetto A, Papanikolaou G, Politou M, Alberti F, Girelli D, Christakis J, et al. Mutant antimicrobial peptide hepcidin is associated with severe juvenile hemochromatosis. Nat Genet 2003;33:21–22. [4] Roetto A, Totaro A, Cazzola M, Cicilano M, Bosio S, D’Ascola G, et al. The juvenile hemochromatosis locus maps to chromosome 1q. Am J Hum Genet 1999;64:1388 –1393. [5] Camaschella C, Roetto A, Cali A, De Gobbi M, Garozzo G, Carella M, et al. The gene TfR2 is mutated in a new type of haemochromatosis mapping to 7q22. Nat Genet 2000;25:14–15. [6] Njajou OT, Vaessen N, Joosse M, Berghuis B, van Dongen JW, Breuning MH, et al. A mutation in SLC11A3 is associated with autosomal dominant hemochromatosis. Nat Genet 2001;28:213–214. [7] Montosi G, Donovan A, Totaro A, Garuti C, Pignatti E, Cassanelli S, et al. Autosomal dominant hemochromatosis is associated with a mutation in the ferroportin (SLC11A3) gene. J Clin Invest 2001;108: 619–623.
713
[8] Donovan A, Brownlie A, Zhou Y, Shepard J, Pratt SJ, Moynihan J, et al. Positional cloning of zebrafish ferroportin1 identifies a conserved vertebrate iron exporter. Nature 2000;403:778– 781. [9] McKie AT, Marciani P, Rolfs A, Brennan K, Wehr K, Barrow D, et al. A novel duodenal iron-regulated transporter, IREG1, implicated in the basolateral transfer of iron to the circulation. Mol Cell 2000;5: 299–309. [10] Abboud S, Haile DJ. A novel mammalian iron-regulated protein involved in intracellular iron metabolism. J Biol Chem 2000;275: 19906– 19912. [11] Wallace DF, Pedersen P, Dixon JL, Stephenson P, Searle JW, Powell LW, et al. Novel mutation in ferroportin1 is associated with autosomal dominant hemochromatosis. Blood 2002;100:692 –694. [12] Devalia V, Carter K, Walker AP, Perkins SJ, Worwood M, May A, et al. Autosomal dominant reticuloendothelial iron overload associated with a 3-base pair deletion in the ferroportin 1 gene (SLC11A3). Blood 2002;100:695–697. [13] Roetto A, Merryweather-Clarke AT, Daraio F, Livesey K, Pointon JJ, Barbabietola G, et al. A valine deletion of ferroportin 1: a common mutation in hemochromastosis type 4. Blood 2002;100:733– 734. [14] Cazzola M, Cremonesi L, Papaioannou M, Soriani N, Kioumi A, Charalambidou A, et al. Genetic hyperferritinaemia and reticuloendothelial iron overload associated with a three base pair deletion in the coding region of the ferroportin gene (SLC11A3). Br J Haematol 2002;119:539 –546. [15] Arden KE, Wallace DF, Dixon JL, Summerville L, Searle JW, Anderson GJ, et al. A novel mutation in ferroportin1 is associated with haemochromatosis in a Solomon Islands patient. Gut 2003;52: 1215– 1217. [16] Jouanolle AM, Douabin-Gicquel V, Halimi C, Loreal O, Fergelot P, Delacour T, et al. Novel mutation in ferroportin 1 gene is associated with autosomal dominant iron overload. J Hepatol 2003;39:286–289. [17] Rivard SR, Lanzara C, Grimard D, Carella M, Simard H, Ficarella R, et al. Autosomal dominant reticuloendothelial iron overload (HFE type 4) due to a new missense mutation in the FERROPORTIN 1 gene (SLC11A3) in a large French-Canadian family. Haematologica 2003; 88:824–826. [18] Hetet G, Devaux I, Soufir N, Grandchamp B, Beaumont C. Molecular analyses of patients with hyperferritinemia and normal serum iron values reveal both L ferritin IRE and 3 new ferroportin (slc11A3) mutations. Blood 2003;102:1904–1910. [19] Eason RJ, Adams PC, Aston CE, Searle J. Familial iron overload with possible autosomal dominant inheritance. Aust N Z J Med 1990;20: 226–230. [20] Pietrangelo A, Montosi G, Totaro A, Garuti C, Conte D, Cassanelli S, et al. Hereditary hemochromatosis in adults without pathogenic mutations in the hemochromatosis gene. N Engl J Med 1999;341: 725–732. [21] Devaney K, Goodman ZD, Epstein MS, Zimmerman HJ, Ishak KG. Hepatic sarcoidosis. Clinicopathologic features in 100 patients. Am J Surg Pathol 1993;17:1272 –1280. [22] Halliday JW, Searle J. Hepatic iron deposition in human disease and animal models. Biometals 1996;9:205–209.
Case report
Autosomal dominant iron overload due to a novel mutation of ferroportin1 associated with parenchymal iron loading and cirrhosis Daniel F. Wallace1, Roslyn M. Clark1, Hugh A.J. Harley3, V. Nathan Subramaniam1,2,* 1
Membrane Transport Laboratory, The Queensland Institute of Medical Research, 300 Herston Road, Herston, Brisbane, Qld 4006, Australia 2 Departments of Medicine and Biochemistry, The University of Queensland, Brisbane, Qld, Australia 3 Department of Gastroenterology, Hepatology and General Medicine, Royal Adelaide Hospital, Adelaide, SA, Australia
We report the identification of a novel mutation in ferroportin1 in an Australian family with autosomal dominant iron overload. The phenotype of iron overload in one member of this family is associated with high serum ferritin concentration and elevated transferrin saturation. The pattern of iron overload in the liver shows accumulation predominantly in parenchymal cells with some Kupffer cell iron loading. Although some cases of type 4 haemochromatosis have been associated with the development of liver fibrosis this is the first report of a patient with fully established cirrhosis at a relatively young age (32 years). The coexistence of sarcoidosis in this patient may contribute to the more severe phenotype. This report highlights the phenotypic variability that can occur in type 4 haemochromatosis. Some patients have predominant reticuloendothelial iron loading and normal transferrin saturation whereas others have predominant parenchymal iron loading and elevated transferrin saturation. The reasons for this variability remain to be determined. Interestingly this is the third mutation to affect asparagine 144, reinforcing the important role for this amino acid in the function of ferroportin1. q 2004 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved. Keywords: Haemochromatosis; Iron overload; Ferroportin1; Autosomal dominant; Cirrhosis
1. Introduction Hereditary haemochromatosis comprises a group of disorders which result in impaired iron homeostasis leading to excessive intestinal iron absorption and accumulation in tissues. Untreated, the build-up of iron can lead to tissue damage including cirrhosis, diabetes mellitus, arthropathy, cardiomyopathy, endocrine abnormalities and hepatocellular carcinoma [1]. The most common form (type 1) is an autosomal recessive condition caused by mutations in the HFE gene [2]. Other forms include type 2 or juvenile haemochromatosis which can be caused by mutations in the iron regulatory hormone hepcidin [3] or an as yet unidentified gene on chromosome 1 [4]. Type 3 is caused by mutations in transferrin receptor 2 [5]. Type 4 haemochromatosis is a recently described autosomal dominant iron overload condition caused by mutations in Received 20 October 2003; received in revised form 30 November 2003; accepted 4 December 2003 * Corresponding author. Tel.: þ61-7-33-62-0179; fax: þ 61-7-33620191. E-mail address: [email protected] (V.N. Subramaniam).
the ferroportin1 gene [6,7]. Ferroportin1 also known as SLC11A3, IREG1 or MTP1 encodes a highly conserved transmembrane protein responsible for iron export from cells [8 –10]. Most cases have been associated with an early rise in serum ferritin levels but normal or only mildly elevated transferrin saturations. Generally the pattern of iron distribution in the liver shows preferential accumulation in Kupffer cells and other macrophages. This is in contrast to the other three types where a rise in transferrin saturation precedes a rise in serum ferritin levels and iron accumulation is seen predominantly in parenchymal cells. Mutations in ferroportin1 were first reported by two groups almost simultaneously [6,7]. In both studies autosomal dominant iron overload was shown to associate with mutations in ferroportin1 [6,7]. An asparagine to histidine mutation (N144H) was found in a large pedigree from the Netherlands [6] and an alanine to aspartic acid (A77D) mutation in a large Italian pedigree [7]. To date nine ferroportin1 mutations have been identified, all associated with autosomal dominant iron overload [6,7,11 – 18]. These include a valine deletion V162del, which has been reported in four geographical locations (Australia, UK, Italy and
0168-8278/$30.00 q 2004 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.jhep.2003.12.008
D.F. Wallace et al. / Journal of Hepatology 40 (2004) 710–713
Greece) [11 – 14]. It has been proposed that this deletion of one of a group of three valine residues is a recurrent mutation that has occurred in different populations due to slippage mispairing [13]. Another mutation affecting asparagine 144 (N144T) has been identified in a patient from the Solomon Islands [15]. Whether this is the mutation responsible for the autosomal dominant iron overload syndrome described by Eason et al. [19] in a large Solomon Islands pedigree remains to be determined. There is some phenotypic variability between patients with mutations in ferroportin1. In some patients there is prominent iron accumulation in parenchymal cells reminiscent of HFE-related (type 1) haemochromatosis [20]. Other patients have iron accumulation almost exclusively in reticuloendothelial cells [14]. Transferrin saturation is also variable, being elevated in some patients but normal in others. Venesection as a treatment to remove excess iron has variable success. Many patients cannot tolerate regular venesection and become anaemic whereas others appear to have no problems. The reasons for this phenotypic variability are not clear. We report the identification of a novel mutation (430A . G; N144D) in the ferroportin1 gene which is associated with autosomal dominant iron overload in an Australian family. Heterozygosity for this mutation is associated with a high serum ferritin level in a mother and son. As compared with other reports of patients with mutations in ferroportin1 the son is unusual in having a high serum transferrin saturation, predominantly parenchymal iron loading and fully established cirrhosis at a relatively young age. Interestingly, this is the third reported mutation to affect asparagine 144, suggesting a critical role for this amino acid in the function of ferroportin1.
2. Patients and methods This study was approved by and performed in accordance with the ethical standards of the Queensland Institute of Medical Research Human Research Ethics Committee and with the Helsinki Declaration of 1975, as revised in 1983. Informed and written consent was obtained from the patients for all the studies described in this report.
2.1. Patients The proband was a female who presented at 45 years of age. She had an elevated serum ferritin of 7500 mg/l. Her liver function tests were also
711
abnormal, bilirubin of 35 mmol/l, alanine aminotransferase (ALT) of 195 U/l and aspartic aminotransferase (AST) of 107 U/l. She also had arthropathy in her left knee, hands and feet. She declined liver biopsy but underwent venesection therapy and required 122 venesections to normalise her iron stores. Venesection therapy was tolerated well with no problems associated with anaemia. Her son was diagnosed more recently at 32 years of age. He had a raised ALT of 219 U/l, raised serum ferritin of 10510 mg/l, serum iron was 53 mmol/l and transferrin saturation was 99%. His alcohol intake was not excessive (120 g per week). He also had evidence of pulmonary sarcoidosis, which was confirmed histologically. Liver biopsy demonstrated cirrhosis, a small number of non-caseating sarcoid granulomata and Perls’ stain iron grade of 3 (Fig. 1). Iron deposition was seen in hepatocytes and bile duct epithelial cells but was not particularly prominent in Kupffer cells. The hepatic iron concentration was 393 mmol/g, giving a hepatic iron index of 12.3. He is currently undergoing venesection therapy and has tolerated twice weekly phlebotomy. After 105 venesections his serum ferritin concentration had dropped to 293 mg/l. His haemoglobin level has been monitored prior to each venesection and has not fallen below 127 g/l. Neither the proband nor her son had any immunological abnormalities at presentation and have not shown any increased susceptibility towards infections. Genetic testing for HFE mutations revealed that both mother and son were heterozygous for H63D but negative for C282Y. The father of the proband died at the age of 63 from pancreatic cancer. He also had joint problems and was found to have liver damage postmortem. The proband’s brother and daughter have been tested for iron overload, but both had normal values for both serum ferritin and transferrin saturation. No other family members have been diagnosed with iron overload.
2.2. Molecular studies The eight exons of ferroportin1 were PCR amplified and sequenced from the proband and her son as previously described [11]. PCR products of ferroportin1 exon 5 (primers: forward, TCCACCAAAGACTATTTTAAACTG; reverse, CCATTTGCCAAGTTTGTGT) were used in a Tsp509I restriction endonuclease assay to detect a novel missense mutation 430A . G (N144D). A similar assay has been described previously and works for both the 430A . C (N144T) and 431A . C (N144H) mutations [15]. The presence of any of the three asparagine 144 mutations results in loss of a Tsp509I restriction endonuclease cleavage site.
3. Results and discussion Analysis of the DNA sequence of ferroportin1 in two members of a family with a severe form of apparent autosomal dominant iron overload revealed a novel single nucleotide substitution (430A . G) in exon 5 (Fig. 2A). The substitution results in a change of residue 144 from an asparagine to an aspartic acid (N144D). The presence of the 430A . G substitution was confirmed using a Tsp509I restriction endonuclease digestion assay (Fig. 2B). This assay has been previously described and can be used to detect all three mutations
Fig. 1. Liver biopsy sections from the 32-year-old male patient showing cirrhosis and predominantly parenchymal iron overload. (A) Trichrome stain of liver biopsy showing complete nodular transformation with marked fibrosis (magnification 203). (B) Perls’ stain of liver core biopsy showing a marked degree of iron overload (magnification 403). (C) Perls’ stain showing a marked degree of iron overload. Iron is present predominantly within the hepatocytes with some Kupffer cell iron. Sarcoid granuloma is also present (magnification 1003).
712
D.F. Wallace et al. / Journal of Hepatology 40 (2004) 710–713
affecting asparagine 144 (N144H, N144T and N144D). In a previous study describing the N144T mutation we analysed a control group comprising 100 normal Australian controls [15]. Using the Tsp509I assay all the controls were negative suggesting that all three N144 mutations are rare in the general population [15]. Therefore the N144D mutation reported here likely represents a disease-causing mutation. The phenotype of iron overload in this family conforms to the more parenchymal distribution of iron overload that has been seen in some patients with ferroportin1 mutations [20]. The proband presented with a raised serum ferritin concentration, but transferrin saturation was not measured and she declined liver biopsy, hence a full evaluation of her phenotype cannot be made. However, her son aged 32 years had a raised serum ferritin concentration and transferrin saturation of 99%. He had a raised ALT and liver biopsy showed cirrhosis and iron accumulation predominantly in parenchymal cells. Although many of the patients reported with ferroportin1 mutations have fibrosis, to our knowledge this is the first report of a patient with fully established cirrhosis. It is possible that granulomatous inflammation associated with sarcoidosis may have been a cofactor contributing to fibrosis [21]. The reasons for the wide phenotypic spectrum observed in type 4 haemochromatosis are not clear. Some patients have low transferrin saturations and iron deposition exclusively in reticuloendothelial cells whereas others including the 32-year-old male presented here have raised transferrin saturations and iron predominantly in parenchymal cells. It has been suggested that the particular ferroportin1 mutation a patient carries may play a role in this phenotypic variability [14]. However, patients carrying the same mutation can have contrasting phenotypes. In the Italian family carrying the A77D mutation both the predominantly parenchymal and predominantly reticuloendothelial phenotypes were seen in the same family [7,20]. Age at diagnosis may also play a role. In our study describing the V162del mutation in an Australian family the younger patients had normal transferrin saturations and predominant Kupffer cell iron, whereas those diagnosed at an older age had elevated transferrin saturation and more iron in hepatocytes [11]. Other genetic and environmental factors such as diet and alcohol are also likely to contribute to this phenotypic variability. The tissue distribution of iron in overload disorders is important in the development of tissue damage. Excess iron stores in parenchymal cells appears to be more toxic than in reticuloendothelial cells and it is the iron within parenchymal cells which leads to tissue damage [22]. Therefore, it is likely that the patients who have parenchymal iron loading have a greater risk of developing liver fibrosis. Analysis of biopsy data from the published cases suggests that this is the case. A high transferrin saturation, serum ferritin and age are also associated with the presence of fibrosis. Patients with raised transferrin saturations are also more likely to
Fig. 2. Detection of mutations by DNA sequencing and restriction endonuclease polymorphism. (A) Shows the DNA sequence of wild-type (top panel) and mutant ferroportin1 (bottom panel). (B) PCR products of ferroportin1 exon 5 digested with Tsp509I. Lane 1, proband; lane 2, son of proband; lanes 3 and 4, wild type control DNA. The PCR product is 461 bp in length. When digested with Tsp509I the wild type PCR product yields four fragments of 137, 87, 114 and 123 bp. The 430A > G substitution causes loss of a Tsp509I restriction site and hence yields only three fragments of 224, 114 and 123 bp. The samples in lanes 1 and 2 are heterozygous for the 430A > G substitution and therefore contain both wild type and mutant banding patterns. M, DNA size marker.
tolerate iron removal by venesection better than patients who have lower amounts of circulating iron. The mutation we have identified in an Australian family affects the same amino acid as the Dutch [6] and Solomon Islands [15] mutations. However, in this instance the asparagine at position 144 is replaced by an aspartic acid. Asparagine 144 and the region surrounding it are highly conserved across species. A non-conservative change from an asparagine (amide group) to an aspartic acid (acidic group) would be expected to disrupt the function of ferroportin1.
D.F. Wallace et al. / Journal of Hepatology 40 (2004) 710–713
In conclusion, we have identified a novel mutation in ferroportin1 (N144D) in an Australian family with autosomal dominant iron overload. This mutation is associated with high transferrin saturation, parenchymal iron loading and cirrhosis in one member of the family. This case emphasises the wide spectrum of phenotypes observed among patients carrying ferroportin1 mutations and may provide insights into the role of ferroportin1 in iron homeostasis. Further studies will be required to determine the factors that contribute to phenotypic variability in type 4 haemochromatosis.
Acknowledgements The authors gratefully acknowledge the immense support and encouragement of the patients and their family. We thank Drs Steve Pieterse and Costanzo Fusco for images of liver biopsies. This work was supported by grants from the Haemochromatosis Society of Australia, National Health and Medical Research Council of Australia (953219) and National Institutes of Health, USA (5R01DK057648-02).
References [1] Bothwell TH, Charlton RW, Motulsky AG. Hemochromatosis. In: Scriver CR, Beaudet AL, Sly WS, Valle D, editors. The metabolic and molecular bases of inherited disease, 7th ed. New York, NY: McGraw-Hill; 1995. p. 2237–2269. [2] Feder JN, Gnirke A, Thomas W, Tsuchihashi Z, Ruddy DA, Basava A, et al. A novel MHC class I-like gene is mutated in patients with hereditary haemochromatosis. Nat Genet 1996;13:399–408. [3] Roetto A, Papanikolaou G, Politou M, Alberti F, Girelli D, Christakis J, et al. Mutant antimicrobial peptide hepcidin is associated with severe juvenile hemochromatosis. Nat Genet 2003;33:21–22. [4] Roetto A, Totaro A, Cazzola M, Cicilano M, Bosio S, D’Ascola G, et al. The juvenile hemochromatosis locus maps to chromosome 1q. Am J Hum Genet 1999;64:1388 –1393. [5] Camaschella C, Roetto A, Cali A, De Gobbi M, Garozzo G, Carella M, et al. The gene TfR2 is mutated in a new type of haemochromatosis mapping to 7q22. Nat Genet 2000;25:14–15. [6] Njajou OT, Vaessen N, Joosse M, Berghuis B, van Dongen JW, Breuning MH, et al. A mutation in SLC11A3 is associated with autosomal dominant hemochromatosis. Nat Genet 2001;28:213–214. [7] Montosi G, Donovan A, Totaro A, Garuti C, Pignatti E, Cassanelli S, et al. Autosomal dominant hemochromatosis is associated with a mutation in the ferroportin (SLC11A3) gene. J Clin Invest 2001;108: 619–623.
713
[8] Donovan A, Brownlie A, Zhou Y, Shepard J, Pratt SJ, Moynihan J, et al. Positional cloning of zebrafish ferroportin1 identifies a conserved vertebrate iron exporter. Nature 2000;403:778– 781. [9] McKie AT, Marciani P, Rolfs A, Brennan K, Wehr K, Barrow D, et al. A novel duodenal iron-regulated transporter, IREG1, implicated in the basolateral transfer of iron to the circulation. Mol Cell 2000;5: 299–309. [10] Abboud S, Haile DJ. A novel mammalian iron-regulated protein involved in intracellular iron metabolism. J Biol Chem 2000;275: 19906– 19912. [11] Wallace DF, Pedersen P, Dixon JL, Stephenson P, Searle JW, Powell LW, et al. Novel mutation in ferroportin1 is associated with autosomal dominant hemochromatosis. Blood 2002;100:692 –694. [12] Devalia V, Carter K, Walker AP, Perkins SJ, Worwood M, May A, et al. Autosomal dominant reticuloendothelial iron overload associated with a 3-base pair deletion in the ferroportin 1 gene (SLC11A3). Blood 2002;100:695–697. [13] Roetto A, Merryweather-Clarke AT, Daraio F, Livesey K, Pointon JJ, Barbabietola G, et al. A valine deletion of ferroportin 1: a common mutation in hemochromastosis type 4. Blood 2002;100:733– 734. [14] Cazzola M, Cremonesi L, Papaioannou M, Soriani N, Kioumi A, Charalambidou A, et al. Genetic hyperferritinaemia and reticuloendothelial iron overload associated with a three base pair deletion in the coding region of the ferroportin gene (SLC11A3). Br J Haematol 2002;119:539 –546. [15] Arden KE, Wallace DF, Dixon JL, Summerville L, Searle JW, Anderson GJ, et al. A novel mutation in ferroportin1 is associated with haemochromatosis in a Solomon Islands patient. Gut 2003;52: 1215– 1217. [16] Jouanolle AM, Douabin-Gicquel V, Halimi C, Loreal O, Fergelot P, Delacour T, et al. Novel mutation in ferroportin 1 gene is associated with autosomal dominant iron overload. J Hepatol 2003;39:286–289. [17] Rivard SR, Lanzara C, Grimard D, Carella M, Simard H, Ficarella R, et al. Autosomal dominant reticuloendothelial iron overload (HFE type 4) due to a new missense mutation in the FERROPORTIN 1 gene (SLC11A3) in a large French-Canadian family. Haematologica 2003; 88:824–826. [18] Hetet G, Devaux I, Soufir N, Grandchamp B, Beaumont C. Molecular analyses of patients with hyperferritinemia and normal serum iron values reveal both L ferritin IRE and 3 new ferroportin (slc11A3) mutations. Blood 2003;102:1904–1910. [19] Eason RJ, Adams PC, Aston CE, Searle J. Familial iron overload with possible autosomal dominant inheritance. Aust N Z J Med 1990;20: 226–230. [20] Pietrangelo A, Montosi G, Totaro A, Garuti C, Conte D, Cassanelli S, et al. Hereditary hemochromatosis in adults without pathogenic mutations in the hemochromatosis gene. N Engl J Med 1999;341: 725–732. [21] Devaney K, Goodman ZD, Epstein MS, Zimmerman HJ, Ishak KG. Hepatic sarcoidosis. Clinicopathologic features in 100 patients. Am J Surg Pathol 1993;17:1272 –1280. [22] Halliday JW, Searle J. Hepatic iron deposition in human disease and animal models. Biometals 1996;9:205–209.