B-1 and B-2 B-cells in the pig cannot be differentiated by expression of CD5

Veterinary Immunology and Immunopathology 115 (2007) 10–16 www.elsevier.com/locate/vetimm

B-1 and B-2 B-cells in the pig cannot be differentiated by expression of CD5 Stephen M. Wilson *, Bruce N. Wilkie Department of Pathobiology, Ontario Veterinary College, University of Guelph, Guelph, Ont. N1G 2W1, Canada Received 30 January 2006; received in revised form 9 October 2006; accepted 17 October 2006

Abstract In a number of species, such as mice, humans and cattle, B-cells can be differentiated into two populations based on the surface expression of CD5, a marker normally found on T-cells. These B-cell subsets have been found to differ with regard to location, development and phenotypic characteristics. The B-1 (CD5+) B-cells have also been shown to have a more restricted immunoglobulin isotype expression profile, limited combinatorial diversity in immunoglobulin heavy chains and lower somatic hyper-mutation. They are potent producers of IL-10. In the pig, CD5+ and CD5 B-cell populations have previously been described in this laboratory. Here, we show that B-cells isolated and separated into CD5+ and CD5 populations do not differ with regard to immunoglobulin isotype or IL-10 RNA expression, nor do the immunoglobulin heavy chain V(D)J re-arrangements differ in terms of gene usage, CDR3 length and composition or the frequency of hyper-mutations. In conclusion, expression of CD5 cannot be used to differentiate between pig blood B-1 and B-2 B-cells. # 2006 Elsevier B.V. All rights reserved. Keywords: B-cell; Pig; Immunology

1. Introduction B-cells express diverse surface markers. In the mouse (Kantor, 1996) and man (Bhat et al., 1992) a population of B-cells expresses a surface phenotype that includes CD5. CD5 is found on all T-cells with its ligand, CD72, expressed on B-cells, with a possible role in cell–cell adhesion and enhancement of signaling for both cell types (Cerutti et al., 1996). In the mouse (Kantor, 1996), there are three populations of B-cells; conventional B-2 B-cells and the CD5+ B-1a and the CD5 B-1b B-cells. These cell types differ with regard to development, surface phenotype and localization within the animal

* Corresponding author. E-mail address: [email protected] (S.M. Wilson). 0165-2427/$ – see front matter # 2006 Elsevier B.V. All rights reserved. doi:10.1016/j.vetimm.2006.10.009

(Kantor, 1996). Indeed, analysis of mice revealed that within a single animal, phenotypic, developmental and functional differences have been identified between peritoneal and splenic B-1 cells (Tumang et al., 2004; Kretschmer et al., 2003) with variations in gene expression profiles, surface antigen expression, cell viability and immunoglobulin secretion. In contrast to the low numbers (15–25%) of cells within the human (Dono et al., 2004) and mouse B-cell populations that express CD5, in the rabbit (Raman and Knight, 1992) and chicken (Koskinen et al., 1998) CD5 is expressed at low levels on all B-cells. B-1 cells have been associated with a limited immunoglobulin V-region repertoire (Dono et al., 2004) and the production of low affinity, poly-reactive antibodies usually of the IgM isotype. These are predominantly autoantibody and anti-bacterial with

S.M. Wilson, B.N. Wilkie / Veterinary Immunology and Immunopathology 115 (2007) 10–16

specificities for lipopolysaccharide and phosphorylcholine (Kantor, 1996). Although various studies have shown B-1 cells to have a limited combinatorial immunoglobulin V-region repertoire, others (Kantor et al., 1997) revealed that the B-1a cell subset has a more diverse repertoire than previously thought. Murine peritoneal B-cells were sorted by flow cytometry into B1a, B-1b and B-2 populations based on the expression of IgM, IgD and CD5. Sequence analysis demonstrated that although the pattern of VH gene family usage was very similar among the three B-cell subsets, and each subset used a range of gene families with a frequency distribution corresponding to the germ line complexity of each family, the actual use of specific VH genes within each family differed considerably. The three groups also exhibit characteristic patterns of diversity (D) and joining (J) gene usage (Kantor et al., 1997). In addition to combinatorial diversity as a means of expanding immunological repertoire, nucleotides can be added to the junctions between the V and D, and the D and J segments (Tonegawa, 1983). The study reported by Kantor and others (Kantor et al., 1997) revealed that 38% of the B-1a cells lacked N-region insertions at both junctions compared to 20% of B-1b cells and 7% of B-2 cells. This did not result in significant differences in the CDR3 length, although the sequences lacking N-region additions did have a tendency towards slightly shorter CDR3 lengths. CD5+ B-cells also differed from conventional B-cells in that they are potent producers of IL-10, which regulates the production of several other cytokines (O’Garra et al., 1992). The production of IL-10 also acts in an autocrine manner to promote B-1 B-cell survival (Ishida et al., 1992) and expression of CD5 has been observed to induce and enhance IL-10 production in human B-cells (Gary-Gouy et al., 2002). As a result, the expression of CD5 on B-cells may be associated with an increased cell survival. Our previously reported research characterized porcine B-cell populations and CD5 expression in response to various exogenous stimuli (Appleyard and Wilkie, 1998). This revealed that CD5+ B-cells comprised 10–20% of the pig blood lymphocytes and resembled the B-1 cell subset of other species with regard to CD5 expression, frequency and distribution within lymphoid organs. In addition, expression of CD5 was up regulated on blood lymphocytes in response to treatment with phorbol myristate acetate, lipopolysaccchraide or immobilized anti-IgM. Here, we show that expression of CD5 on pig Bcells does not discriminate between blood B-1 and B-2 B-cells based on analysis of the immunoglobulin

11

heavy chain V(D)J re-arrangement components, immunoglobulin isotype and IL-10 expression, characteristics that do differentiate B-1 and B-2 B-cells in mouse and man. 2. Materials and methods 2.1. Experimental design The study was designed to investigate whether expression of CD5 on isolated pig B-cells differentiated putative B-1 cells (CD5+) from B-2 cells (CD5 ). Bcells were isolated from blood, and IgM+CD5+ and IgM+CD5 populations selected using a dual magnetic bead (MACS, Miltenyi-Biotec, Bergisch Gladbach, Germany) sort procedure. Expression of mRNA specific for IgM, IgA, IgG and IL-10, plus analysis of the immunoglobulin heavy chain V(D)J re-arrangements were used to determine whether phenotypic and genotypic differences were evident between the two cell populations. 2.2. Animals Venous blood was obtained from the retro-orbital sinus of Yorkshire pigs at 6 weeks of age from the Arkell Research facility at the University of Guelph in accordance with institutional and Canadian animal utilization guidelines. Fifty milliliters of blood from each of three pigs was collected into Vacutainer tubes containing sodium heparin (Becton Dickinson, Franklin Lakes, USA), mixed and lymphocytes isolated as previously described (Raymond and Wilkie, 2004). In brief, 20 ml of blood was mixed with 25 ml phosphate buffered saline (PBS, 0.01 M, pH 7.4), underlayed with 7 ml Histopaque 1077 (Sigma–Aldrich, St. Louis, USA) and centrifuged (300  g, 45 min) at room temperature. Blood mononuclear cells were removed from the interface, washed three times with PBS and suspended at 5  106 cells/ml in RPMI 1640 medium containing 10% heat-inactivated fetal calf serum (CanSera International Inc., Rexdale, Ontario, Canada), 50 mM 2-mercaptoethanol (Sigma), 100 units/ml penicillin (Gibco BRL, Invitrogen, USA) and 100 mg/ml streptomycin (Gibco BRL). Forty milliliters of culture medium was added to each of two medium-sized culture flasks (Nalge Nunc International Corporation, Naperville, USA) and monocytes allowed to adhere during overnight incubation at 37 8C in 5% CO2. Cell viability was determined by Trypan Blue dye exclusion and upon isolation was over 90%.

12

S.M. Wilson, B.N. Wilkie / Veterinary Immunology and Immunopathology 115 (2007) 10–16

2.3. Cell separation and flow cytometry Non-adherent cells were removed from the culture flasks, and centrifuged (300  g, 10 min) at room temperature. B-cells were isolated from the cell mixture using the auto MACS system (Miltenyi-Biotec) and initial labeling with the mouse monoclonal anti-pig IgM antibody (Clone M160, gift from Dr. K. Nielsen, ADRI, Nepean, Ontario), followed by FITC-conjugated goat anti-mouse IgG antibody (Jackson ImmunoResearch Laboratories Inc., USA) and the anti-FITC MultiSort kit (Miltenyi-Biotec) according to the manufacturer’s protocol. Immunoglobulin-M positive cells were retained and the MACS micro beads removed according to the manufacturer’s protocol. Cells were then labeled with a monoclonal antibody to CD5 (clone b53b7) (Saalmu¨ller et al., 1994), biotinylated as previously described (Crawley et al., 2003). The second separation into IgM+CD5+ and IgM+CD5 populations used antibiotin micro beads (Miltenyi-Biotec) as directed. Cell separation was confirmed using a FACScan flow cytometer and Cell Quest Pro software (Becton Dickinson, Franklin Lakes, NJ, USA). Cells were labeled with monoclonal antibodies to IgM and CD5 as above, and goat anti-mouse IgG conjugated to FITC (Jackson ImmunoResearch) and R-phycoerythrin (PE) avidin-D (Vector Laboratories, Burlingame, CA, USA) secondary antibodies were used to detect the IgM and CD5-biotin primary antibodies, respectively. Cells were washed with PBS between incubations with antibody and centrifuged (300  g 10 min) at room temperature.

4 ml MgCl2, 2 ml 10 PCR buffer, 2 ml each of dATP, dTTP, dCTP and dGTP (10 mM), 30 U (1 ml) of RNase inhibitor, 30 U of Moloney murine leukemia virus reverse transcriptase and 1 ml oligo-dT primers (50 mM). The mixture was incubated at room temperature for 10 min, then at 42 8C for 2 h and at 99 8C for 8 min (Biometra TGradient Thermocycler, Montreal Biotech, Montreal, Canada). Complementary DNAs (cDNA) were stored at 20 8C. 2.5. Polymerase chain reaction Oligonucleotide primers to porcine IgM, IgA and IgG constant regions were designed from available sequences using the Primer 3 software; (http://wwwgenome.wi.mit.edu/genome_software/other/primer3. html), and the following criteria: primer size (18–24 bases), product melting temperature (57–65 8C) and primer %GC content (45–70%). Primers and reaction conditions, for the IL-10 sequence (Reddy et al., 1996) and the immunoglobulin FR1 and JH regions have been described previously (Sun et al., 1998). All primers and sequences are listed in Table 1. PCR used the Taq PCR master mix kit (Qiagen, USA) as described with primers at 10-pmol final concentrations. PCR products for IL-10, and the immunoglobulin isotypes were electrophoresed on 2% agarose (OnBio, Richmond Hill, Ontario Canada) gels and expression was analyzed relative to the beta-2-microglobulin expression for each sample, using gel densitometry analysis (GeneSnap/GeneTools, Syngene, Cambridge, UK). 2.6. Sequence analysis

2.4. RNA extraction and RT-PCR Total RNA was extracted from IgM+CD5+ and IgM+CD5 B-cells of each of three pigs using ultrapure Trizol reagent (Invitrogen, Carlsbad, USA) according to the manufacturer’s directions. Total RNA concentration was determined spectrophotometrically (GeneQuant Pro, Amersham Pharmacia, Cambridge, UK) and sample quality (two distinct bands corresponding to the 18S and 28S rRNA) assessed by gel electrophoresis. One microgram of RNA in 4 ml of RNase-free water was mixed with 0.5 unit of DNase I (Invitrogen) in 1 ml + 1 ml of 10 DNase I Reaction Buffer (Invitrogen), incubated at room temperature for 10 min, mixed with 1 ml of 12.5 mM EDTA (Invitrogen) and incubated at 65 8C at 10 min. Reverse transcription (RT) reactions were conducted using the GeneAmp RNA-PCR Kit (Perkin-Elmer, Montreal, Canada), as follows: 1 mg of total RNA was added to

PCR products from the amplification with the FR1 and JH primer combination were gel-purified and DNA isolated from the gel using the QIAquick gel extraction kit (Qiagen) as directed. Purified products were then Table 1 Primers used in amplifications of porcine specific gene sequences Primer name

Sequence

IgA Forward IgA Reverse IgM Forward IgM Reverse IgG Forward IgG Reverse IL-10 Forward IL-10 Reverse VDJ FR1 VDJ JH

AGCTGGTGACACTGACATGC ACCATGCAGGAGAAGGTGTC AGGCTTCGAGAACCTCAACA CTCCTGTTCCGTCTCTGGTC TGGCTTCTACCCACCTGACA GACTTCTGGGTGTAGTGGTT GCTCTATTGCCTGATCTTCC GCACTCTTCACCTCCTCCAC GAGGAGAAGCTGGTGGAGT TGAGGACACGACGACTTCAA

S.M. Wilson, B.N. Wilkie / Veterinary Immunology and Immunopathology 115 (2007) 10–16

cloned using the PCR cloning kit (Qiagen) as directed and used to transform chemically competent Escherichia coli cells (Sub cloning efficiency DH5a cells, Invitrogen). Aliquots of the transformed bacteria were spread onto Luria–Bertani agar (Sigma) plates containing 1 ml/l ampicillin (100 mg/ml) (Boehringer Mannheim, Germany), 2 ml/l X-gal (40 mg/ml) (Sigma) and 0.5 ml/l IPTG (100 mM) (Sigma), and incubated overnight at 37 8C. Plates were incubated at 4 8C for 2 h to enhance the blue–white selection for positive transformants. Individual colonies were picked and PCR analysis performed, as described earlier, to confirm insertion of the V(D)J amplicon. Positive colonies were then suspended in 5 ml Luria–Bertani broth (Sigma) containing 5 ml ampicillin (100 mg/ml) and incubated at 37 8C on a rotary shaker. Plasmids were purified using the GenElute plasmid miniprep kit (Sigma) as directed. Aliquots of the purified plasmid DNA were sequenced (Laboratory Services Division, University of Guelph, Guelph, Ontario) using the M13 Forward primer and BigDye sequencing reagents (Applied Biosystems, Foster City, CA, USA) and ABI 377 automated sequencers (Applied Biosystems). Sequences were analyzed using the Staden software (http://staden.sourceforge.net/), compared to the submitted germ line VH gene sequences (http://www. ebi.ac.uk). All sequences encoding productive transcripts were submitted to the European Bioinformatics Institute (Cambridge, UK) and are available under the accession numbers AM177067–AM177176. 2.7. Statistics Differences in expression of immunoglobulin isotypes and IL-10 message plus immunoglobulin V(D)J heavy chain re-arrangements between CD5+ and CD5 B-cells were analyzed using the Mann–Whitney statistical test (Minitab Statistical Software Incorporated, State College, PA, USA), and differences were regarded as significant when p  0.05. 3. Results 3.1. Flow cytometry Flow cytometric analysis of MACS-sorted B-cell populations confirmed previous reports of CD5 positivity from this laboratory (Appleyard and Wilkie, 1998). The mean value and standard deviation of three pigs for the IgM+CD5+ subset was 12.15  4.26 of the total IgM+ B-cell population, which is comparable to the reported frequency in pigs. Analysis of the isolated

13

IgM+CD5 population revealed minimal CD5 staining (<1% of total cells staining positive for IgM). 3.2. Immunoglobulin isotype and interleukin (IL)10 expression Previous studies of rodents have revealed differences in the immunoglobulin isotype expression of B-1 and B2 B-cell populations (Tarlinton et al., 1995), in addition to the characteristic, elevated expression of IL-10 within the B-1 population (O’Garra et al., 1992). PCR amplification of the immunoglobulin isotypes IgM, IgG and IgA and comparison between CD5+ and CD5 populations revealed no significant differences in IgM ( p > 1.00) or IgG ( p = 0.3827) expression. There was no detectable IgA expression in either B-cell population. There were also no significant differences between the two cell populations with regard to IL-10 expression ( p = 0.7728). 3.3. Immunoglobulin heavy chain V(D)J analysis of CD5+ and CD5 B-cell populations The pig has been shown to have a limited immunoglobulin heavy chain repertoire in the neonate, with only four VH genes used in approximately 80% of productive re-arrangements (Sun et al., 1998) and two DH gene segments used in more than 90% of transcripts. However, in other species such as mouse and human (Dono et al., 2004; Kantor et al., 1997) there are distinct differences in the usage of VDJ gene elements between B-1 and B-2 B-cell populations, including differential VH gene usage and nucleotide insertions between the V and D and D and J gene elements. Analysis of 110 sequences from the FR1 region to the JH region revealed no significant differences in VH (Fig. 1A) ( p = 0.6614) or DH gene use (Fig. 1B) ( p > 1.0), nucleotide (Fig. 2A) ( p = 0.8102) or amino acid (Fig. 2B) ( p = 0.7928) changes in the V-gene region and CDR3 length (Fig. 1C) ( p = 0.7929). Further analysis of the CDR3 sequence composition revealed no differences in the length of the DH gene segment (Fig. 1D) ( p > 1.0), or in the number of nucleotide insertions between the V and D segments (Fig. 2C) ( p > 1) or the D and J segments (Fig. 2D) ( p > 1). 4. Discussion In this study, we tested the hypothesis that expression of CD5 on isolated porcine blood B-cells was able to differentiate putative B-1 (CD5+) B-cells from B-2 (CD5 ) B-cells. The results clearly show that B-cells

14

S.M. Wilson, B.N. Wilkie / Veterinary Immunology and Immunopathology 115 (2007) 10–16

Fig. 1. Immunoglobulin heavy chain V(D)J re-arrangement sequence analysis in IgM+CD5+ (diagonal hatching) and IgM+CD5 (horizontal hatching) B-cells. Results show the percent frequency of (A) VH gene usage; (B) DH gene usage; (C) the length of the CDR3 segment (nucleotides); and (D) the length of detectable DH gene segments within the CDR3 (nucleotides).

Fig. 2. Immunoglobulin heavy chain V(D)J re-arrangement sequence analysis in IgM+CD5+ (diagonal hatching) and IgM+CD5 (horizontal hatching) B-cells. Results show the percent frequency of (A) the number of nucleotide changes in the sequence from the start of FR1 to the end of FR3; (B) the number of amino acid changes in the sequence from the start of FR1 to the end of FR3; (C) the number of nucleotide insertions into the V–D junction; and (D) the number of nucleotide insertions into the D–J junction.

S.M. Wilson, B.N. Wilkie / Veterinary Immunology and Immunopathology 115 (2007) 10–16

isolated from blood cannot be distinguished on the basis of CD5 expression as belonging to B-1 or B-2 populations. Although the B-1 cells were thought to mainly express IgM with the B-2 B-cells able to switch immunoglobulin isotype more readily, a number of studies of human and pig cells have shown that B-cells, which produce the natural antibody repertoire, have the capacity to undergo immunoglobulin isotype class switching. Studies of human B-cell repertoire (Schettino et al., 1997) and isolated mono-reactive B-2 B-cells and poly-reactive B-1 B-cells revealed B-cells which expressed surface IgG as well as IgM, thereby showing isotype class switching could occur. Investigations into the development and repertoire of natural antibodies in pigs (Cukrowska et al., 1996) revealed that serum immunoglobulins were detected at day 44 of gestation, with IgM predominating but IgG and IgA were also present. When fetal hepatic lymphocytes were activated with a variety of B-cell stimulators, they responded mainly by producing IgM but with a minor secretion of IgG and IgA. The same study also demonstrated that B-cells which produced natural antibodies, and as such were defined as B-1 B-cells, did not express CD5 (Cukrowska et al., 1996). Although there have been numerous reports of differences in immunoglobulin V-region combinatorial diversity between B-1 and B-2 B-cells, here we show no significant difference between CD5+ and CD5 B-cells in the pig. In mouse and human B-1 and B-2 B-cells, there are similarities in gene family use but variations in the genes from those families that are actually used (Kantor et al., 1997; Schettino et al., 1997). However, in the pig there is only one defined gene family (Sun et al., 1994) containing limited VH gene segments, so this comparison cannot be made. Due to evidence of limited combinatorial diversity in the pig, with heavy chain rearrangements at 6 weeks of age still using the neonatal/ fetal repertoire (Butler et al., 2000), it could be that this analysis does not correlate with studies performed in species, such as mice and man, which have a greater immunoglobulin combinatorial repertoire. The development of B-cells in the pig may be more closely related to the situation in cattle (Naessens, 1997) and rabbits (Raman and Knight, 1992), rather than to humans and mice, in that all B-cells are B-1. Reports have suggested that due to the absence of IgD surface expression (Naessens, 1997) bovine B-cells differ phenotypically from ‘classical’ B-cells and closely resemble B-1 B-cells from man and mice. Although the pig has recently been shown to possess Ig d genes (Zhao et al., 2002), no surface expression has been observed. In rabbits (Raman and Knight, 1992), all B-

15

cells have been shown to express CD5 and have limited VH gene usage (Becker et al., 1990), a situation that is repeated in the pig. It may be that as described previously for pig B-cells (Appleyard and Wilkie, 1998), expression of CD5 is purely a result of B-cell activation and not a marker of B-cell lineage or differentiation phenotypes. As for sheep blood B-cells (Chevallier et al., 1998) it may be that in pigs, although B-1 and B-2 B-cells exist, they cannot be discriminated on the basis of expression of CD5 and that other surface markers, such as CD1 1b expression, may be more informative. In addition, there may be differences in B-1 B-cell populations isolated from different anatomical sites, such that expression of CD5 may be a suitable marker for differentiating pig Bcell subsets in some sites but not in others, such as blood. This present study does clarify issues raised from previous studies in this laboratory (Crawley et al., 2003, 2005) whereby immunoglobulin isotype expression was examined in blood B-cells. The question arose as to whether immunoglobulin isotype expression was different in mixed as apposed to segregated CD5+ or CD5 populations, in that the CD5+ B-cells may not switch immunoglobulin isotypes and the presumably switchable CD5 B-cells may then be a more appropriate population to examine when analyzing immunoglobulin isotype related issues. As we have shown, there were no significant differences in the expression of IgM or IgG between the CD5+ and CD5 populations, validating the previous studies using a mixed population of B-cells. Other immunological compartments, such as the peritoneal cavity, were not examined as previous studies in this laboratory never successfully retrieved cells of this phenotype from this site. Also, the selection of only one time point should be sufficient if the hypothesis that CD5+ cells express IgM and have characteristic immunoglobulin V-region configurations is correct, the age of the animals used should make no difference. In conclusion, we found no evidence to suggest that expression of CD5 on B-cells isolated from pig blood can be used to differentiate B-1 from B-2 lymphocytes. Acknowledgement This work was supported by a grant to B. N. Wilkie from the Natural Sciences and Engineering Research Council of Canada. References Appleyard, G.D., Wilkie, B.N., 1998. Characterization of porcine CD5 and CD5+ B-cells. Clin. Exp. Immunol. 111 (1), 225–230.

16

S.M. Wilson, B.N. Wilkie / Veterinary Immunology and Immunopathology 115 (2007) 10–16

Becker, R.S., Suter, M., Knight, K.L., 1990. Restricted utilization of VH and DH genes in leukemic rabbit B-cells. Eur. J. Immunol. 20 (2), 397–402. Bhat, N.M., Kantor, A.B., Bieber, M.M., Stall, A.M., Herzenberg, L.A., Teng, N.N., 1992. The ontogeny and functional characteristics of human B-1 (CD5+) B-cells. Int. Immunol. 4 (2), 243–252. Butler, J.E., Sun, J., Weber, P., Navarro, P., Francis, D., 2000. Antibody repertoire development in fetal and newborn piglets, III. Colonization of the gastrointestinal tract selectively diversifies the pre-immune repertoire in mucosal lymphoid tissues. Immunology 100 (1), 119–130. Cerutti, A., Trentin, L., Zambello, R., Sancetta, R., Milani, A., Tassinari, C., Adami, F., Agostini, C., Semenzato, G., 1996. The CD5/CD72 receptor system is coexpressed with several functionally relevant counterstructures on human B-cells and delivers a critical signaling activity. J. Immunol. 157 (5), 1854–1862. Chevallier, N., Berthelemy, M., Laine, V., Le Rhun, D., Femenia, F., Polack, B., Naessens, J., Levy, D., Schwartz-Cornil, I., 1998. B-1like cells exist in sheep. Characterization of their phenotype and behaviour. Immunology 95 (2), 178–184. Crawley, A., Raymond, C., Wilkie, B.N., 2003. Control of immunoglobulin isotype production by porcine B-cells cultured with cytokines. Vet. Immunol. Immunopathol. 91 (2), 141–154. Crawley, A.M., Mallard, B., Wilkie, B.N., 2005. Genetic selection for high and low immune response in pigs: effects on immunoglobulin isotype expression. Vet. Immunol. Immunopathol. 108 (1–2), 71– 76. Cukrowska, B., Sinkora, J., Rehakova, Z., Sinkora, M., Splichal, I., Tuckova, L., Avrameas, S., Saalmu¨ller, A., Barot-Ciorbaru, R., Tlaskalova-Hogenova, H., 1996. Isotype and antibody specificity of spontaneously formed immunoglobulins in pig fetuses and germ-free piglets: production by CD5 B-cells. Immunology 88 (4), 611–617. Dono, M., Cerruti, G., Zupo, S., 2004. The CD5+ B-cell. Int. J. Biochem. Cell Biol. 36 (11), 2105–2111. Gary-Gouy, H., Harriague, J., Bismuth, G., Platzer, C., Schmitt, C., Dalloul, A.H., 2002. Human CD5 promotes B-cell survival through stimulation of autocrine IL-10 production. Blood 100 (13), 4537–4543. Ishida, H., Hastings, R., Kearney, J., Howard, M., 1992. Continuous anti-interleukin 10 antibody administration depletes mice of Ly-1 B-cells but not conventional B-cells. J. Exp. Med. 175 (5), 1213– 1220. Kantor, A.B., 1996. V-gene usage and N-region insertions in B-1a, B1b and conventional B cells. Semin. Immunol. 8 (1), 29–35. Kantor, A.B., Merrill, C.E., Herzenberg, L.A., Hillson, J.L., 1997. An unbiased analysis of V(H)-D-J(H) sequences from B-1a, B-1b, and conventional B-cells. J. Immunol. 158 (3), 1175–1186.

Koskinen, R., Gobel, T.W., Tregaskes, C.A., Young, J.R., Vainio, O., 1998. The structure of avian CD5 implies a conserved function. J. Immunol. 160 (10), 4943–4950. Kretschmer, K., Jungebloud, A., Stopkowicz, J., Stoermann, B., Hoffmann, R., Weiss, S., 2003. Antibody repertoire and gene expression profile: implications for different developmental and functional traits of splenic and peritoneal B-1 lymphocytes. J. Immunol. 171 (3), 1192–1201. Naessens, J., 1997. Surface Ig on B lymphocytes from cattle and sheep. Int. Immunol. 9 (3), 349–354. O’Garra, A., Chang, R., Go, N., Hastings, R., Haughton, G., Howard, M., 1992. Ly-1 B (B-1) cells are the main source of B-cell-derived interleukin-10. Eur. J. Immunol. 22 (3), 711–717. Raman, C., Knight, K.L., 1992. CD5+ B-cells predominate in peripheral tissues of rabbit. J. Immunol. 149 (12), 3858–3864. Raymond, C.R., Wilkie, B.N., 2004. Th-1/Th-2 type cytokine profiles of pig T-cells cultured with antigen-treated monocyte-derived dendritic cells. Vaccine 22 (8), 1016–1023. Reddy, N.R., Wilkie, B.N., Mallard, B.A., 1996. Construction of an internal control to quantitate multiple porcine cytokine mRNAs by RT-PCR. Biotechniques 21 (5), 868–870 872, 875. Saalmu¨ller, A., Aasted, B., Canals, A., Dominguez, J., Goldman, T., Lunney, J.K., Maurer, S., Pescovitz, M.D., Pospisil, R., Salmon, H., et al., 1994. Analyses of monoclonal antibodies reactive with porcine CD5. Vet. Immunol. Immunopathol. 43 (1–3), 237–242. Schettino, E.W., Chai, S.K., Kasaian, M.T., Schroeder Jr., H.W., Casali, P., 1997. VHDJH gene sequences and antigen reactivity of monoclonal antibodies produced by human B-1 cells: evidence for somatic selection. J. Immunol. 158 (5), 2477–2489. Sun, J., Kacskovics, I., Brown, W.R., Butler, J.E., 1994. Expressed swine VH genes belong to a small VH gene family homologous to human VHIII. J. Immunol. 153 (12), 5618–5627. Sun, J., Hayward, C., Shinde, R., Christenson, R., Ford, S.P., Butler, J.E., 1998. Antibody repertoire development in fetal and neonatal piglets. I. Four VH genes account for 80 percent of VH usage during 84 days of fetal life. J. Immunol. 161 (9), 5070–5078. Tarlinton, D.M., McLean, M., Nossal, G.J., 1995. B1 and B2 cells differ in their potential to switch immunoglobulin isotype. Eur. J. Immunol. 25 (12), 3388–3393. Tonegawa, S., 1983. Somatic generation of antibody diversity. Nature 302 (5909), 575–581. Tumang, J.R., Hastings, W.D., Bai, C., Rothstein, T.L., 2004. Peritoneal and splenic B-1 cells are separable by phenotypic, functional, and transcriptomic characteristics. Eur. J. Immunol. 34 (8), 2158–2167. Zhao, Y., Kaskovics, I., Pan, Q., Liberles, D.A., Geli, J., Davis, S.K., Rabbani, H., Hammarstrom, L., 2002. Ariodactyl IgD: the missing link. J. Immunol. 169, 4408–4416.