- Email: [email protected]
Babesia microti-like infections are prevalent in North American foxes
Veterinary Parasitology 172 (2010) 179–182
Contents lists available at ScienceDirect
Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar
Babesia microti-like infections are prevalent in North American foxes Adam J. Birkenheuer a,∗ , Barbara Horney b , Matthew Bailey a , McBurney Scott c , Brittany Sherbert a , Victoria Catto a , Henry S. Marr a , Angel-Tomas Camacho d , Anne E. Ballman a a
College of Veterinary Medicine, Department of Clinical Sciences, North Carolina State University College of Veterinary Medicine, 4700 Hillsborough Street, Raleigh, NC 27606, United States Atlantic Veterinary College at the University of Prince Edward Island, 550 University Avenue, Charlottetown, PE C1A 4P3, Canada c Canadian Cooperative Wildlife Health Centre, Atlantic Region, Department of Pathology and Microbiology, Atlantic Veterinary College, UPEI, 550 University Avenue, Charlottetown, PE C1A 4P3, Canada d Laboratorio Lema & Bandín, Calle Lepanto 5, bajo, Vigo 36201, Spain b
a r t i c l e
i n f o
Article history: Received 21 April 2010 Received in revised form 18 May 2010 Accepted 21 May 2010 Keywords: Babesia Tick Anemia Azotemia Piroplasmosis
a b s t r a c t Babesia microti-like organisms have recently been identified as a cause of hemolytic anemia and azotemia in European dogs. A genetically and morphologically similar B. microti-like parasite has been identified in two foxes from North America. In order to assess the prevalence of this parasite in North American wild canids we screened blood samples from coyotes (Canis latrans) and red foxes (Vulpes vulpes) from eastern Canada and red foxes and gray foxes (Urocyon cinereoargenteus) from North Carolina, USA for the presence B. microtilike DNA by polymerase chain reaction. Thirty-nine percent (50/127) of the red fox samples, 26% (8/31) of the gray fox samples and none (0/12) from the coyote samples tested positive for the presence of B. microti-like DNA. Partial 18S ribosomal ribonucleic acid and betatubulin genes from the North American B. microti-like parasites of foxes were sequenced and samples from six domestic dogs from Spain that were infected with a B. microti-like parasite were analyzed for comparison. Partial 18S ribosomal ribonucleic acid and betatubulin gene sequences from the North American B. microti-like parasites of foxes were nearly identical to those previously reported from foxes as well as those from domestic dogs from Spain characterized in this study. Interestingly, partial beta-tubulin gene sequences characterized from the B. microti-like parasites of domestic dogs from Spain in this study were different from those previously reported from a Spanish domestic dog sample which is believed to be a pseudogene. The ability of the North American B. microti-like parasite to infect and induce disease in domestic dogs remains unknown. Further studies investigating the pathogenic potential of the North American B. microti-like parasite in domestic dogs are indicated. © 2010 Published by Elsevier B.V.
1. Introduction The Babesia microti-like parasite of domestic dogs was first described in a German dog that developed clinical
∗ Corresponding author. Tel.: +1 919 513 8288; fax: +1 919 513 6336. E-mail addresses: [email protected], adam [email protected] (A.J. Birkenheuer). 0304-4017/$ – see front matter © 2010 Published by Elsevier B.V. doi:10.1016/j.vetpar.2010.05.020
babesiosis after having traveled to the Northwestern region of Spain (Zahler et al., 2000). It has been referred to in the literature as Theileria annae, Babesia annae and B. microti. In this report, it will be referred to as a B. microti-like parasite. Anemia, thrombocytopenia and azotemia are among the most common laboratory abnormalities identified in European dogs with B. microti-like infections (Camacho et al., 2001; Guitian et al., 2003; Camacho et al., 2004). Ixodes hexagonus is suspected to be the tick vector transmitting
180
A.J. Birkenheuer et al. / Veterinary Parasitology 172 (2010) 179–182
B. microti-like infections to domestic dogs (Camacho et al., 2003). The reservoir host or hosts have not been identified, but a molecular study identified B. microti-like DNA in 50% of the foxes (species not identified, n = 10) from Spain that have been tested (Criado-Fornelio et al., 2003). Information about the prevalence of B. microti-like parasites in North American canids is limited. A genetically and morphologically similar B. microti-like parasite was characterized from a fox (species not identified) captured in Cape Cod, Massachusetts and a juvenile red fox from Canada (Goethert and Telford, 2003; Clancey et al., in press). Clinical babesiosis in domestic dogs associated with this B. microti-like parasite has yet to be described in North America. The purpose of the current study was to screen North American wild canids for B. microti-like infections by PCR and to compare their partial 18S rRNA and beta-tubulin gene sequences to those from B. microti-like parasites of domestic dogs from Spain.
2. Materials and methods 2.1. Sources of samples A convenience sample consisting of 158 foxes, 12 coyotes (Canis latrans) and 6 domestic dogs was tested. One hundred and twenty-two foxes were from Prince Edward Island (PEI), an island province on the east coast of Canada and 36 foxes from eastern North Carolina (NC), USA. All coyote samples were from PEI. Ninety-six of the foxes from PEI were legally trapped by licensed personnel; samples of heart blood were collected from the carcass less than 24 h after removal from the trap. Twenty-six of the PEI foxes were presented to the Atlantic Veterinary College hospital or Canadian Cooperative Wildlife Health Centre postmortem service due to traumatic injuries or other health problems resulting in disability or death. Eight premortem venous samples in EDTA and 18 postmortem heart blood samples (no anticoagulant) were submitted from these animals. The samples were either forwarded (chilled) immediately or frozen and then forwarded to NC for PCR testing. All of the foxes from PEI were red foxes (Vulpes vulpes). All of the coyote samples from PEI were collected postmortem from animal carcasses submitted to the Canadian Cooperative Wildlife Health Centre (CCWHC) for scanning wildlife health surveillance purposes. All foxes from NC (n = 36) were legally trapped in Hyde County, NC by licensed personnel and samples were obtained postmortem. The carcasses were either fresh or had been frozen at −20 ◦ C and thawed immediately prior to sample collection. Blood samples from NC were obtained via cardiac puncture and were then frozen at −20 ◦ C until further processing. Thirty-one of the foxes from NC were grey foxes (Urocyon cinereoargenteus) and five were red foxes. For genetic comparisons, ethylene diamine tetraacetic acid (EDTA) anticoagulated whole blood from six domestic dogs (Canis familiaris) that had samples submitted to a veterinary diagnostic laboratory in Vigo, Spain were tested. Small ring-shaped B. microti-like parasites were detected within giemsa-stained thin blood smears from all six of these dogs.
2.2. Nucleic acid isolation, polymerase chain reaction (PCR) assays and deoxyribonucleic acid (DNA) sequencing For postmortem samples, total DNA was extracted from 100 g of clotted whole blood or hemolyzed serum using a commercially available kit (QIAamp DNA blood mini kit, Qiagen, Valencia, CA). For premortem samples, total DNA was extracted from 200 l of EDTA anticoagulated whole blood using the Qiagen M48 Biorobot Workstation with the MagAttract DNA Blood Mini M48 Kit according to manufacturer’s instructions. Five microliters of DNA extract from each sample were used as template for a PCR assay designed to amplify a 229 base pair segment of B. microti-like 18S ribosomal ribonucleic acid genes (5 CTGCCTTATCATTAATTTCGCTTCCGAACG3 and 5 ATGCCCCCAACCGTTCCTATTA3 ) as described previously with minor modifications (Birkenheuer et al., 2008). Each reaction was performed in a 50 l volume and contained a 1× concentration of Quant SYBR master mix, 50 pmol of each primer. Cycling conditions were 95 ◦ C for 5 min followed with 45 cycles of 95 ◦ C for 45 s, 59 ◦ C for 45 s and 72 ◦ C for 45 s. For the melting curve analysis the temperature was increased from 66 to 85 ◦ C in 0.5 ◦ C increments (Biorad I-cycler). In addition, the amplicons were visualized by ethidium bromide staining and ultraviolet light transillumination after electrophoresis in a 2% agarose gel. A 300 base pair region of the beta-tubulin gene was amplified by PCR. Each reaction contained a 50 l volume comprised of an Amplitaq Gold master mix (5 l 10× PCR Buffer, 3 l 25 mM MgCl, 1 l 10 mM dNTP, and 1.25 units of Amplitaq Gold) 5 l of DNA, and 50 pmol of each primer. The forward and reverse primers used for each reaction were Btub F (5 GATATGTACCAAGAGCCATTCTTATG3 ) and Btub rev 380 (5 AGCAAAGTTCCCATTCCAGA3 ). Cycling conditions for the reaction were 95 ◦ C for 5 min, followed by 50 cycles of 90 ◦ C for 15 s, 52 ◦ C for 30 s, and 72 ◦ C for 1 min. The reaction was then held at 72 ◦ C for 5 min. Amplicons were visualized using ultraviolet light transillumination after gel electrophoresis in a 2% agarose gel containing ethidium bromide. All samples in which Babesia DNA was not detected were tested for the presence of PCR inhibitors using primers that amplify a partial glyceraldehyde-3phosphate dehydrogenase (GAPDH) gene/pseudogene as previously described (Birkenheuer et al., 2003). 18S rRNA and beta-tubulin amplicons from selected samples were purified using a commercially available kit (QIAquick PCR Purification Kit, Qiagen, Valencia, CA) and were directly sequenced in both directions (MClab, San Francisco, CA). 3. Results B. microti-like infections were detected in a high proportion of foxes from both PEI and NC and were not detected in any of the coyote samples. B. microti-like DNA was detected in 37% (58/158) of the fox samples. B. microti-like DNA was detected in 39% (47/122) of the fox samples from PEI and 31% (11/36) of the fox samples from NC. Thirty-nine percent (50/127) of the red fox samples (47 from PEI and 3 from NC) and 26% (8/31) of the gray fox samples tested positive
A.J. Birkenheuer et al. / Veterinary Parasitology 172 (2010) 179–182
181
Table 1 Variation between the beta-tubulin gene sequences from Babesia microti-like parasites of foxes and domestic dogs.
Cape Cod, Massachusetts fox (species not specified) AY144707 Domestic dogs (Spain) (n = 6) Red foxes (n = 15) Gray foxes (n = 7) a b
Nucleotide positiona 135
Nucleotide position 144
Nucleotide position 285
Nucleotide position 314
T
A
T
T
T T C (6/7)b
A A G
A (5/6)b A A
T A (5/15)b A
Nucleotide positions are in reference to AY144707. Remaining samples were identical to AY144707.
for the presence of B. microti-like DNA. The presence of PCR inhibition in all of the samples from which B. microti-like DNA was not detected was excluded by amplification of canine GAPDH. Partial 18S rRNA and beta-tubulin amplicons were sequenced from selected samples (n = 28), including those from red foxes from PEI (n = 12) and NC (n = 3), gray foxes from NC (n = 7) and domestic dogs from Spain (n = 6). The 18S rRNA amplicons from red foxes, gray foxes and domestic dogs that were sequenced shared ≥99.9% sequence identity with each other as well as the previously described B. microti-like 18S rRNA gene sequences identified from a Spanish dog and a Cape Cod, Massachusetts fox (GenBank acc. nos. AY144700 and AY144702, respectively). The beta-tubulin gene sequences characterized in this study from red foxes, grey foxes and domestic dogs shared ≥98.8% sequence identity with each other and the Cape Cod, Massachusetts fox that had been reported previously (AY144707). In contrast, the betatubulin gene sequences generated in this study only shared ≈86% sequence identity with the previously published beta-tubulin gene/pseudogene obtained from the Spanish dog (AY144709). There was variability at 4 nucleotide positions of the beta-tubulin genes characterized in this study (Table 1). One position with variability between samples (corresponding to position 314 in AY144707) is located within a 22 base pair intron and the remaining positions with variability occurred at the third positions of codons. The nucleotide differences did not result in any differences in the predicted beta-tubulin amino acid sequences between the domestic canine or fox samples. They all shared 100% identity with the predicted amino acid sequence from the Cape Cod, Massachusetts fox that had been reported previously (AAN62732). Comparisons with the beta-tubulin gene/pseudogene that has been previously been reported from a Spanish dog were not performed as this sequence contained a premature stop codon. 4. Discussion This study provides evidence that B. microti-like parasite infections are prevalent in North American Foxes. Based on our results, coyotes are either not infected with the B. microti-like parasite or have a lower prevalence of infection compared to foxes. The sample size of the coyotes tested in this study was small which may have contributed to an inability to detect the B. microti-like parasite in this species. Assuming that our PCR assay had 100% sensitivity, which is not likely for any PCR assay, the prevalence of the B. microti-
like parasite in the coyotes would have to have been ≥23% in order for us to have a 95% chance to detect at least one infected animal (Smith, 1995). Additionally, we found that the B. microti-like parasites of North American foxes and Spanish dogs are closely related and indeed may be identical species. In contrast to a previously published study (Goethert and Telford, 2003) we found that both the partial 18S rRNA and beta-tubulin gene sequences from both the B. microti-like parasites of North American foxes and Spanish dogs were nearly identical. The previously published beta-tubulin gene from a Spanish dog infected with B. microti-like parasites was amplified using different oligonucleotide primers and is likely to represent the amplification of a pseudogene as it contained a premature stop codon. We presume that the partial beta-tubulin genes amplified from domestic dog samples in this study are more likely to represent true genes. The mode of transmission for the B. microti-like parasite in Europe remains unknown. Based on an association between the presence of I. hexagonus ticks on dogs at the time they were diagnosed with B. microti-like infections, this tick is considered the leading candidate as a vector responsible for the infection of domestic dogs (Camacho et al., 2003). However, no transmission studies have been performed to clarify the life-cycle of this parasite in European or North American foxes or domestic dogs. The region of NC and PEI from which the samples were collected are over 1200 miles apart. Interestingly, PEI is an island with minimal evidence of endemic tick infections in wild or domestic canids. Wild canids have not been surveyed extensively for ticks on PEI but ticks have not been detected on any red fox or coyote submitted for postmortem examination in 18 years of wildlife health surveillance on PEI (CCWHC, unpublished data). Sporadic I. scapularis from PEI domestic dogs are submitted to the Atlantic Veterinary College Diagnostic Laboratory but the ticks are not considered endemic and their source is assumed to be migratory bird-borne adventitious ticks (Ogden et al., 2006). Several other piroplasm species are known to be transmitted via non-tick vectored routes such as transplacental transmission and direct inoculation, so these may also be possible routes of transmission for the B. microti-like parasite amongst wild and domestic canids. The authors believe that the high proportion of infected foxes in Europe, 50% by Criado-Fornelio et al. (2003), and North America (identified in this study) suggests that the parasite is not highly virulent to foxes. This also supports the possibility that foxes could serve as a source of infection
182
A.J. Birkenheuer et al. / Veterinary Parasitology 172 (2010) 179–182
for domestic dogs. The detection of a B. microti-like parasite in a substantial proportion of North American foxes that is closely related to or identical to the organism responsible for hemolytic anemia, thrombocytopenia and azotemia in European dogs is concerning. The circumstances that led to the emergence of babesiosis in domestic dogs in Europe caused by the B. microti-like parasite remain unclear. One possibility is simply the increased recognition of an infection that had been present for some time. This organism was first described in a German dog that was presumed to have been infected circa 1994 during a trip to Northwest Spain (Zahler et al., 2000). Subsequently much of the information about this infection has been generated by a diagnostic laboratory in Northwest Spain that began evaluating veterinary samples in 1995 (Camacho et al., 2001, 2002, 2004). Another distinct possibility is that the B. microti-like organism actually represents a new infectious disease in domestic dogs that has “jumped” species from foxes for unknown reasons. The authors believe that the B. microti-like parasite of North American foxes represents a potential health threat to domestic dogs or, may actually already be an unrecognized cause of disease in North American domestic dogs. Hemolytic anemia, thrombocytopenia and azotemia are all frequently identified problems in North American domestic dogs, and in many cases despite intensive diagnostic investigations it is common for no underlying cause to be identified. Canine babesiosis in North America is believed to be caused primarily by B. gibsoni and B. canis vogeli. Therefore specific testing for B. microti-like parasites is not requested and in most cases not even available. The 18S rRNA gene sequence of the B. microti-like parasites only shares about 89% sequence identity with B. gibsoni or B. canis (Zahler et al., 2000). Many PCR assays designed to target B. canis or B. gibsoni may fail to detect B. microti-like parasites or detect them with substantially decreased sensitivity (Birkenheuer et al., 2003). For these reasons, it is possible that B. microti-like infections in North American domestic dogs are undetected. There is a recent case of a B. microtilike infection in a North American dog confiscated from a dog fighting operation however this dog did not have any clinical signs of babesiosis (Yeagley et al., 2009). The travel history of the dog in that report was not available so whether or not the dog became infected in the United States remains unknown. North American veterinary practitioners should be vigilant for B. microti-like infections in
domestic dogs presenting with one of more of the following signs; hemolytic anemia, thrombocytopenia, azotemia and proteinuria. Further studies evaluating the ability of the North American B. microti-like parasite of foxes to infect and induce disease in domestic dogs are clearly indicated. Acknowledgments This work was supported in part by the Sir James Dunn Animal Welfare Centre and the Merck-Merial Summer Research Internship Program. References Birkenheuer, A.J., Levy, M.G., et al., 2003. Development and evaluation of a seminested PCR for detection and differentiation of Babesia gibsoni (Asian genotype) and B. canis DNA in canine blood samples. J. Clin. Microbiol. 41 (9), 4172–4177. Birkenheuer, A.J., Marr, H.S., et al., 2008. Molecular evidence of prevalent dual piroplasma infections in North American raccoons (Procyon lotor). Parasitology 135 (Pt 1), 33–37. Camacho, A.T., Guitian, E.J., et al., 2004. Azotemia and mortality among Babesia microti-like infected dogs. J. Vet. Intern. Med. 18 (2), 141– 146. Camacho, A.T., Pallas, E., et al., 2002. Natural infection by a Babesia microtilike piroplasm in a splenectomised dog. Vet. Rec. 150 (12), 381– 382. Camacho, A.T., Pallas, E., et al., 2001. Infection of dogs in north-west Spain with a Babesia microti-like agent. Vet. Rec. 149 (18), 552–555. Camacho, A.T., Pallas, E., et al., 2003. Ixodes hexagonus is the main candidate as vector of Theileria annae in northwest Spain. Vet. Parasitol. 112 (1–2), 157–163. Clancey, N., Horney, B., Burton, S., Birkenheuer, A., McBurney, S., Tefft, K., in press. Babesia (Theileria) annae in a red fox (Vulpes vulpes) from Prince Edward Island, Canada (short communication). J. Wildl. Dis. Criado-Fornelio, A., Martinez-Marcos, A., Bulin-Sarana, A., BarbaCarretero, J.C., 2003. Molecular studies on Babesia, Theileria and Hepatozoon in southern Europe. Part I. Epizootiological aspects. Vet. Parasitol. 113, 189–201. Goethert, H.K., Telford III, S.R., 2003. What is Babesia microti? Parasitology 127 (Pt 4), 301–309. Guitian, F.J., Camacho, A.T., et al., 2003. Case-control study of canine infection by a newly recognised Babesia microti-like piroplasm. Prev. Vet. Med. 61 (2), 137–145. Ogden, N.H., Trudel, L., Artsob, H., Barker, I.K., Beauchamp, G., Charron, D.F., Drebot, M.A., Galloway, T.D., O’Handley, R., Thompson, R.A., Lindsay, L.R., 2006. Ixodes scapularis ticks collected by passive surveillance in Canada: analysis of geographic distribution and infection with Lyme borreliosis agent Borrelia burgdorferi. J. Med. Entomol. 43, 600–609. Smith, R.D. (Ed.), 1995. Veterinary Clinical Epidemiology: A Problem Oriented Approach. CRC Press LLC, Boca Raton, FL, USA, 156 pp. Yeagley, T.J., Reichard, M.V., et al., 2009. Detection of Babesia gibsoni and the canine small Babesia ‘Spanish isolate’ in blood samples obtained from dogs confiscated from dogfighting operations. J. Am. Vet. Med. Assoc. 235 (5), 535–539. Zahler, M., Rinder, H., et al., 2000. Detection of a new pathogenic Babesia microti-like species in dogs. Vet. Parasitol. 89 (3), 241–248.
Contents lists available at ScienceDirect
Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar
Babesia microti-like infections are prevalent in North American foxes Adam J. Birkenheuer a,∗ , Barbara Horney b , Matthew Bailey a , McBurney Scott c , Brittany Sherbert a , Victoria Catto a , Henry S. Marr a , Angel-Tomas Camacho d , Anne E. Ballman a a
College of Veterinary Medicine, Department of Clinical Sciences, North Carolina State University College of Veterinary Medicine, 4700 Hillsborough Street, Raleigh, NC 27606, United States Atlantic Veterinary College at the University of Prince Edward Island, 550 University Avenue, Charlottetown, PE C1A 4P3, Canada c Canadian Cooperative Wildlife Health Centre, Atlantic Region, Department of Pathology and Microbiology, Atlantic Veterinary College, UPEI, 550 University Avenue, Charlottetown, PE C1A 4P3, Canada d Laboratorio Lema & Bandín, Calle Lepanto 5, bajo, Vigo 36201, Spain b
a r t i c l e
i n f o
Article history: Received 21 April 2010 Received in revised form 18 May 2010 Accepted 21 May 2010 Keywords: Babesia Tick Anemia Azotemia Piroplasmosis
a b s t r a c t Babesia microti-like organisms have recently been identified as a cause of hemolytic anemia and azotemia in European dogs. A genetically and morphologically similar B. microti-like parasite has been identified in two foxes from North America. In order to assess the prevalence of this parasite in North American wild canids we screened blood samples from coyotes (Canis latrans) and red foxes (Vulpes vulpes) from eastern Canada and red foxes and gray foxes (Urocyon cinereoargenteus) from North Carolina, USA for the presence B. microtilike DNA by polymerase chain reaction. Thirty-nine percent (50/127) of the red fox samples, 26% (8/31) of the gray fox samples and none (0/12) from the coyote samples tested positive for the presence of B. microti-like DNA. Partial 18S ribosomal ribonucleic acid and betatubulin genes from the North American B. microti-like parasites of foxes were sequenced and samples from six domestic dogs from Spain that were infected with a B. microti-like parasite were analyzed for comparison. Partial 18S ribosomal ribonucleic acid and betatubulin gene sequences from the North American B. microti-like parasites of foxes were nearly identical to those previously reported from foxes as well as those from domestic dogs from Spain characterized in this study. Interestingly, partial beta-tubulin gene sequences characterized from the B. microti-like parasites of domestic dogs from Spain in this study were different from those previously reported from a Spanish domestic dog sample which is believed to be a pseudogene. The ability of the North American B. microti-like parasite to infect and induce disease in domestic dogs remains unknown. Further studies investigating the pathogenic potential of the North American B. microti-like parasite in domestic dogs are indicated. © 2010 Published by Elsevier B.V.
1. Introduction The Babesia microti-like parasite of domestic dogs was first described in a German dog that developed clinical
∗ Corresponding author. Tel.: +1 919 513 8288; fax: +1 919 513 6336. E-mail addresses: [email protected], adam [email protected] (A.J. Birkenheuer). 0304-4017/$ – see front matter © 2010 Published by Elsevier B.V. doi:10.1016/j.vetpar.2010.05.020
babesiosis after having traveled to the Northwestern region of Spain (Zahler et al., 2000). It has been referred to in the literature as Theileria annae, Babesia annae and B. microti. In this report, it will be referred to as a B. microti-like parasite. Anemia, thrombocytopenia and azotemia are among the most common laboratory abnormalities identified in European dogs with B. microti-like infections (Camacho et al., 2001; Guitian et al., 2003; Camacho et al., 2004). Ixodes hexagonus is suspected to be the tick vector transmitting
180
A.J. Birkenheuer et al. / Veterinary Parasitology 172 (2010) 179–182
B. microti-like infections to domestic dogs (Camacho et al., 2003). The reservoir host or hosts have not been identified, but a molecular study identified B. microti-like DNA in 50% of the foxes (species not identified, n = 10) from Spain that have been tested (Criado-Fornelio et al., 2003). Information about the prevalence of B. microti-like parasites in North American canids is limited. A genetically and morphologically similar B. microti-like parasite was characterized from a fox (species not identified) captured in Cape Cod, Massachusetts and a juvenile red fox from Canada (Goethert and Telford, 2003; Clancey et al., in press). Clinical babesiosis in domestic dogs associated with this B. microti-like parasite has yet to be described in North America. The purpose of the current study was to screen North American wild canids for B. microti-like infections by PCR and to compare their partial 18S rRNA and beta-tubulin gene sequences to those from B. microti-like parasites of domestic dogs from Spain.
2. Materials and methods 2.1. Sources of samples A convenience sample consisting of 158 foxes, 12 coyotes (Canis latrans) and 6 domestic dogs was tested. One hundred and twenty-two foxes were from Prince Edward Island (PEI), an island province on the east coast of Canada and 36 foxes from eastern North Carolina (NC), USA. All coyote samples were from PEI. Ninety-six of the foxes from PEI were legally trapped by licensed personnel; samples of heart blood were collected from the carcass less than 24 h after removal from the trap. Twenty-six of the PEI foxes were presented to the Atlantic Veterinary College hospital or Canadian Cooperative Wildlife Health Centre postmortem service due to traumatic injuries or other health problems resulting in disability or death. Eight premortem venous samples in EDTA and 18 postmortem heart blood samples (no anticoagulant) were submitted from these animals. The samples were either forwarded (chilled) immediately or frozen and then forwarded to NC for PCR testing. All of the foxes from PEI were red foxes (Vulpes vulpes). All of the coyote samples from PEI were collected postmortem from animal carcasses submitted to the Canadian Cooperative Wildlife Health Centre (CCWHC) for scanning wildlife health surveillance purposes. All foxes from NC (n = 36) were legally trapped in Hyde County, NC by licensed personnel and samples were obtained postmortem. The carcasses were either fresh or had been frozen at −20 ◦ C and thawed immediately prior to sample collection. Blood samples from NC were obtained via cardiac puncture and were then frozen at −20 ◦ C until further processing. Thirty-one of the foxes from NC were grey foxes (Urocyon cinereoargenteus) and five were red foxes. For genetic comparisons, ethylene diamine tetraacetic acid (EDTA) anticoagulated whole blood from six domestic dogs (Canis familiaris) that had samples submitted to a veterinary diagnostic laboratory in Vigo, Spain were tested. Small ring-shaped B. microti-like parasites were detected within giemsa-stained thin blood smears from all six of these dogs.
2.2. Nucleic acid isolation, polymerase chain reaction (PCR) assays and deoxyribonucleic acid (DNA) sequencing For postmortem samples, total DNA was extracted from 100 g of clotted whole blood or hemolyzed serum using a commercially available kit (QIAamp DNA blood mini kit, Qiagen, Valencia, CA). For premortem samples, total DNA was extracted from 200 l of EDTA anticoagulated whole blood using the Qiagen M48 Biorobot Workstation with the MagAttract DNA Blood Mini M48 Kit according to manufacturer’s instructions. Five microliters of DNA extract from each sample were used as template for a PCR assay designed to amplify a 229 base pair segment of B. microti-like 18S ribosomal ribonucleic acid genes (5 CTGCCTTATCATTAATTTCGCTTCCGAACG3 and 5 ATGCCCCCAACCGTTCCTATTA3 ) as described previously with minor modifications (Birkenheuer et al., 2008). Each reaction was performed in a 50 l volume and contained a 1× concentration of Quant SYBR master mix, 50 pmol of each primer. Cycling conditions were 95 ◦ C for 5 min followed with 45 cycles of 95 ◦ C for 45 s, 59 ◦ C for 45 s and 72 ◦ C for 45 s. For the melting curve analysis the temperature was increased from 66 to 85 ◦ C in 0.5 ◦ C increments (Biorad I-cycler). In addition, the amplicons were visualized by ethidium bromide staining and ultraviolet light transillumination after electrophoresis in a 2% agarose gel. A 300 base pair region of the beta-tubulin gene was amplified by PCR. Each reaction contained a 50 l volume comprised of an Amplitaq Gold master mix (5 l 10× PCR Buffer, 3 l 25 mM MgCl, 1 l 10 mM dNTP, and 1.25 units of Amplitaq Gold) 5 l of DNA, and 50 pmol of each primer. The forward and reverse primers used for each reaction were Btub F (5 GATATGTACCAAGAGCCATTCTTATG3 ) and Btub rev 380 (5 AGCAAAGTTCCCATTCCAGA3 ). Cycling conditions for the reaction were 95 ◦ C for 5 min, followed by 50 cycles of 90 ◦ C for 15 s, 52 ◦ C for 30 s, and 72 ◦ C for 1 min. The reaction was then held at 72 ◦ C for 5 min. Amplicons were visualized using ultraviolet light transillumination after gel electrophoresis in a 2% agarose gel containing ethidium bromide. All samples in which Babesia DNA was not detected were tested for the presence of PCR inhibitors using primers that amplify a partial glyceraldehyde-3phosphate dehydrogenase (GAPDH) gene/pseudogene as previously described (Birkenheuer et al., 2003). 18S rRNA and beta-tubulin amplicons from selected samples were purified using a commercially available kit (QIAquick PCR Purification Kit, Qiagen, Valencia, CA) and were directly sequenced in both directions (MClab, San Francisco, CA). 3. Results B. microti-like infections were detected in a high proportion of foxes from both PEI and NC and were not detected in any of the coyote samples. B. microti-like DNA was detected in 37% (58/158) of the fox samples. B. microti-like DNA was detected in 39% (47/122) of the fox samples from PEI and 31% (11/36) of the fox samples from NC. Thirty-nine percent (50/127) of the red fox samples (47 from PEI and 3 from NC) and 26% (8/31) of the gray fox samples tested positive
A.J. Birkenheuer et al. / Veterinary Parasitology 172 (2010) 179–182
181
Table 1 Variation between the beta-tubulin gene sequences from Babesia microti-like parasites of foxes and domestic dogs.
Cape Cod, Massachusetts fox (species not specified) AY144707 Domestic dogs (Spain) (n = 6) Red foxes (n = 15) Gray foxes (n = 7) a b
Nucleotide positiona 135
Nucleotide position 144
Nucleotide position 285
Nucleotide position 314
T
A
T
T
T T C (6/7)b
A A G
A (5/6)b A A
T A (5/15)b A
Nucleotide positions are in reference to AY144707. Remaining samples were identical to AY144707.
for the presence of B. microti-like DNA. The presence of PCR inhibition in all of the samples from which B. microti-like DNA was not detected was excluded by amplification of canine GAPDH. Partial 18S rRNA and beta-tubulin amplicons were sequenced from selected samples (n = 28), including those from red foxes from PEI (n = 12) and NC (n = 3), gray foxes from NC (n = 7) and domestic dogs from Spain (n = 6). The 18S rRNA amplicons from red foxes, gray foxes and domestic dogs that were sequenced shared ≥99.9% sequence identity with each other as well as the previously described B. microti-like 18S rRNA gene sequences identified from a Spanish dog and a Cape Cod, Massachusetts fox (GenBank acc. nos. AY144700 and AY144702, respectively). The beta-tubulin gene sequences characterized in this study from red foxes, grey foxes and domestic dogs shared ≥98.8% sequence identity with each other and the Cape Cod, Massachusetts fox that had been reported previously (AY144707). In contrast, the betatubulin gene sequences generated in this study only shared ≈86% sequence identity with the previously published beta-tubulin gene/pseudogene obtained from the Spanish dog (AY144709). There was variability at 4 nucleotide positions of the beta-tubulin genes characterized in this study (Table 1). One position with variability between samples (corresponding to position 314 in AY144707) is located within a 22 base pair intron and the remaining positions with variability occurred at the third positions of codons. The nucleotide differences did not result in any differences in the predicted beta-tubulin amino acid sequences between the domestic canine or fox samples. They all shared 100% identity with the predicted amino acid sequence from the Cape Cod, Massachusetts fox that had been reported previously (AAN62732). Comparisons with the beta-tubulin gene/pseudogene that has been previously been reported from a Spanish dog were not performed as this sequence contained a premature stop codon. 4. Discussion This study provides evidence that B. microti-like parasite infections are prevalent in North American Foxes. Based on our results, coyotes are either not infected with the B. microti-like parasite or have a lower prevalence of infection compared to foxes. The sample size of the coyotes tested in this study was small which may have contributed to an inability to detect the B. microti-like parasite in this species. Assuming that our PCR assay had 100% sensitivity, which is not likely for any PCR assay, the prevalence of the B. microti-
like parasite in the coyotes would have to have been ≥23% in order for us to have a 95% chance to detect at least one infected animal (Smith, 1995). Additionally, we found that the B. microti-like parasites of North American foxes and Spanish dogs are closely related and indeed may be identical species. In contrast to a previously published study (Goethert and Telford, 2003) we found that both the partial 18S rRNA and beta-tubulin gene sequences from both the B. microti-like parasites of North American foxes and Spanish dogs were nearly identical. The previously published beta-tubulin gene from a Spanish dog infected with B. microti-like parasites was amplified using different oligonucleotide primers and is likely to represent the amplification of a pseudogene as it contained a premature stop codon. We presume that the partial beta-tubulin genes amplified from domestic dog samples in this study are more likely to represent true genes. The mode of transmission for the B. microti-like parasite in Europe remains unknown. Based on an association between the presence of I. hexagonus ticks on dogs at the time they were diagnosed with B. microti-like infections, this tick is considered the leading candidate as a vector responsible for the infection of domestic dogs (Camacho et al., 2003). However, no transmission studies have been performed to clarify the life-cycle of this parasite in European or North American foxes or domestic dogs. The region of NC and PEI from which the samples were collected are over 1200 miles apart. Interestingly, PEI is an island with minimal evidence of endemic tick infections in wild or domestic canids. Wild canids have not been surveyed extensively for ticks on PEI but ticks have not been detected on any red fox or coyote submitted for postmortem examination in 18 years of wildlife health surveillance on PEI (CCWHC, unpublished data). Sporadic I. scapularis from PEI domestic dogs are submitted to the Atlantic Veterinary College Diagnostic Laboratory but the ticks are not considered endemic and their source is assumed to be migratory bird-borne adventitious ticks (Ogden et al., 2006). Several other piroplasm species are known to be transmitted via non-tick vectored routes such as transplacental transmission and direct inoculation, so these may also be possible routes of transmission for the B. microti-like parasite amongst wild and domestic canids. The authors believe that the high proportion of infected foxes in Europe, 50% by Criado-Fornelio et al. (2003), and North America (identified in this study) suggests that the parasite is not highly virulent to foxes. This also supports the possibility that foxes could serve as a source of infection
182
A.J. Birkenheuer et al. / Veterinary Parasitology 172 (2010) 179–182
for domestic dogs. The detection of a B. microti-like parasite in a substantial proportion of North American foxes that is closely related to or identical to the organism responsible for hemolytic anemia, thrombocytopenia and azotemia in European dogs is concerning. The circumstances that led to the emergence of babesiosis in domestic dogs in Europe caused by the B. microti-like parasite remain unclear. One possibility is simply the increased recognition of an infection that had been present for some time. This organism was first described in a German dog that was presumed to have been infected circa 1994 during a trip to Northwest Spain (Zahler et al., 2000). Subsequently much of the information about this infection has been generated by a diagnostic laboratory in Northwest Spain that began evaluating veterinary samples in 1995 (Camacho et al., 2001, 2002, 2004). Another distinct possibility is that the B. microti-like organism actually represents a new infectious disease in domestic dogs that has “jumped” species from foxes for unknown reasons. The authors believe that the B. microti-like parasite of North American foxes represents a potential health threat to domestic dogs or, may actually already be an unrecognized cause of disease in North American domestic dogs. Hemolytic anemia, thrombocytopenia and azotemia are all frequently identified problems in North American domestic dogs, and in many cases despite intensive diagnostic investigations it is common for no underlying cause to be identified. Canine babesiosis in North America is believed to be caused primarily by B. gibsoni and B. canis vogeli. Therefore specific testing for B. microti-like parasites is not requested and in most cases not even available. The 18S rRNA gene sequence of the B. microti-like parasites only shares about 89% sequence identity with B. gibsoni or B. canis (Zahler et al., 2000). Many PCR assays designed to target B. canis or B. gibsoni may fail to detect B. microti-like parasites or detect them with substantially decreased sensitivity (Birkenheuer et al., 2003). For these reasons, it is possible that B. microti-like infections in North American domestic dogs are undetected. There is a recent case of a B. microtilike infection in a North American dog confiscated from a dog fighting operation however this dog did not have any clinical signs of babesiosis (Yeagley et al., 2009). The travel history of the dog in that report was not available so whether or not the dog became infected in the United States remains unknown. North American veterinary practitioners should be vigilant for B. microti-like infections in
domestic dogs presenting with one of more of the following signs; hemolytic anemia, thrombocytopenia, azotemia and proteinuria. Further studies evaluating the ability of the North American B. microti-like parasite of foxes to infect and induce disease in domestic dogs are clearly indicated. Acknowledgments This work was supported in part by the Sir James Dunn Animal Welfare Centre and the Merck-Merial Summer Research Internship Program. References Birkenheuer, A.J., Levy, M.G., et al., 2003. Development and evaluation of a seminested PCR for detection and differentiation of Babesia gibsoni (Asian genotype) and B. canis DNA in canine blood samples. J. Clin. Microbiol. 41 (9), 4172–4177. Birkenheuer, A.J., Marr, H.S., et al., 2008. Molecular evidence of prevalent dual piroplasma infections in North American raccoons (Procyon lotor). Parasitology 135 (Pt 1), 33–37. Camacho, A.T., Guitian, E.J., et al., 2004. Azotemia and mortality among Babesia microti-like infected dogs. J. Vet. Intern. Med. 18 (2), 141– 146. Camacho, A.T., Pallas, E., et al., 2002. Natural infection by a Babesia microtilike piroplasm in a splenectomised dog. Vet. Rec. 150 (12), 381– 382. Camacho, A.T., Pallas, E., et al., 2001. Infection of dogs in north-west Spain with a Babesia microti-like agent. Vet. Rec. 149 (18), 552–555. Camacho, A.T., Pallas, E., et al., 2003. Ixodes hexagonus is the main candidate as vector of Theileria annae in northwest Spain. Vet. Parasitol. 112 (1–2), 157–163. Clancey, N., Horney, B., Burton, S., Birkenheuer, A., McBurney, S., Tefft, K., in press. Babesia (Theileria) annae in a red fox (Vulpes vulpes) from Prince Edward Island, Canada (short communication). J. Wildl. Dis. Criado-Fornelio, A., Martinez-Marcos, A., Bulin-Sarana, A., BarbaCarretero, J.C., 2003. Molecular studies on Babesia, Theileria and Hepatozoon in southern Europe. Part I. Epizootiological aspects. Vet. Parasitol. 113, 189–201. Goethert, H.K., Telford III, S.R., 2003. What is Babesia microti? Parasitology 127 (Pt 4), 301–309. Guitian, F.J., Camacho, A.T., et al., 2003. Case-control study of canine infection by a newly recognised Babesia microti-like piroplasm. Prev. Vet. Med. 61 (2), 137–145. Ogden, N.H., Trudel, L., Artsob, H., Barker, I.K., Beauchamp, G., Charron, D.F., Drebot, M.A., Galloway, T.D., O’Handley, R., Thompson, R.A., Lindsay, L.R., 2006. Ixodes scapularis ticks collected by passive surveillance in Canada: analysis of geographic distribution and infection with Lyme borreliosis agent Borrelia burgdorferi. J. Med. Entomol. 43, 600–609. Smith, R.D. (Ed.), 1995. Veterinary Clinical Epidemiology: A Problem Oriented Approach. CRC Press LLC, Boca Raton, FL, USA, 156 pp. Yeagley, T.J., Reichard, M.V., et al., 2009. Detection of Babesia gibsoni and the canine small Babesia ‘Spanish isolate’ in blood samples obtained from dogs confiscated from dogfighting operations. J. Am. Vet. Med. Assoc. 235 (5), 535–539. Zahler, M., Rinder, H., et al., 2000. Detection of a new pathogenic Babesia microti-like species in dogs. Vet. Parasitol. 89 (3), 241–248.