Bacillus amyloliquefaciens supplementation alleviates immunological stress and intestinal damage in lipopolysaccharide-challenged broilers

G Model ANIFEE-13324; No. of Pages 13

ARTICLE IN PRESS Animal Feed Science and Technology xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Animal Feed Science and Technology journal homepage: www.elsevier.com/locate/anifeedsci

Bacillus amyloliquefaciens supplementation alleviates immunological stress and intestinal damage in lipopolysaccharide-challenged broilers Y. Li a , H. Zhang a , Y.P. Chen a , M.X. Yang a , L.L. Zhang a , Z.X. Lu b , Y.M. Zhou a , T. Wang a,∗ a b

College of Animal Science and Technology, Nanjing Agricultural University, Nanjing, Jiangsu 210095, China College of Food Science and Technology, Nanjing Agricultural University, Nanjing, Jiangsu 210095, China

a r t i c l e

i n f o

Article history: Received 11 May 2015 Received in revised form 1 July 2015 Accepted 2 July 2015 Available online xxx Keywords: Bacillus amyloliquefaciens Immunological stress Intestinal damage Antioxidant status Broiler

a b s t r a c t The present study investigated the effects of Bacillus amyloliquefaciens (BA) supplementation on the growth performance, intestinal integrity, antioxidant and immune status of broilers challenged with lipopolysaccharide (LPS). 192 one-day-old male Arbor Acre broilers were randomly distributed into four treatments: (1) non-challenged control; (2) LPS-challenged control; (3) LPS-challenged group + 0.5 g/kg of diet; and (4) LPS-challenged group + 1.0 g/kg of diet. Broilers were intraperitoneally injected with either 500 ␮g/kg body weight of LPS or sterile saline at 16, 18 and 20 d of age. The inclusion of 1.0 g/kg BA alleviated the compromised average daily gain caused by LPS challenge, the body weight gain in 1.0 g/kg BA supplemented group was still significantly lower than that of control (P < 0.05). Similarly, BA supplementation attenuated intestinal morphology impairment, and reduced intestinal malonaldehyde concentration and myeloperoxidase activity after LPS injection (P < 0.05). The 1.0 g/kg BA inclusion prevented the elevation of circulating diamine oxidase activity and reduction of intestinal glutathione concentration induced by LPS challenge (P < 0.05). The BA decreased interleukin (IL)-1␤, whereas increased IL-10 at both protein and transcriptional levels in jejunum, and attenuated LPS-induced elevated mRNA expression of jejunal toll-like receptor 4 (P < 0.05). Moreover, inclusion of 1.0 g/kg BA alleviated LPS-induced negative effect on the mRNA abundance of tight junctions (P < 0.05). It can therefore be postulated that BA supplementation alleviates LPS-induced intestinal mucosal damage by improving intestinal integrity and antioxidant and immune status. © 2015 Published by Elsevier B.V.

Abbreviations: ADFI, average daily feed intake; ADG, average daily gain; BA, Bacillus amyloliquefaciens; BS, Bacillus subtilis; CD14, cluster of differentiation 14; CDLN-2, cloudin3; CDLN-3, cloudin2; CFU, colony-forming units; CON, control; COR, corticosterone; DAO, diamine oxidase; FCR, feed conversion ratio; GPx, glutathione peroxidase; GSH, glutathione; IFN, interferon; IL, interleukin; LPB, lipopolysaccharide-binding protein; LPS, lipopolysaccharide; MDA, malondialdehyde; MPO, myeloperoxidase; MyD88, myeloid differentiation factor 88; OCLN, occluding; ROS, reactive oxygen species; TJs, tight junctions; TLR4, toll-like receptor 4; TNF, tumor necrosis factor; SOD, superoxide dismutase; ZO-1, zonula occludens-1. ∗ Corresponding author at: College of Animal Science and Technology, Nanjing Agricultural University, No. 1 Weigang, Nanjing, Jiangsu 210095, China. Tel.: +86 025 84395156; fax: +86 025 84396067. E-mail address: [email protected] (T. Wang). http://dx.doi.org/10.1016/j.anifeedsci.2015.07.001 0377-8401/© 2015 Published by Elsevier B.V.

Please cite this article in press as: Li, Y., et al., Bacillus amyloliquefaciens supplementation alleviates immunological stress and intestinal damage in lipopolysaccharide-challenged broilers. Anim. Feed Sci. Tech. (2015), http://dx.doi.org/10.1016/j.anifeedsci.2015.07.001

G Model ANIFEE-13324; No. of Pages 13

ARTICLE IN PRESS Y. Li et al. / Animal Feed Science and Technology xxx (2015) xxx–xxx

2

1. Introduction With the development of modern intensive farming, high stocking densities and high yield requirements make commercial broiler chickens more vulnerable to different stressors including immunological stress. The dietary use of probiotics feeding to counteract and minimize the stress is gaining increasing momentum in poultry industry (Dalloul et al., 2003). Simultaneously, the adverse effect of antibiotic feeding has encouraged a shift in favor of feeding probiotics to boost up productive performance of chickens (Fuller, 1989). Probiotics are defined as “live microorganisms which when administered in adequate amounts confer a health benefit on the host”, which play a key role in developing immunity to defend against pathogens (Hill et al., 2014). Probiotics could induce regulatory T cells or Th2 cells that could produce anti-inflammatory cytokines, interleukin (IL)-10 and IL-4 and reduce auto-reactive T-cells, which produce pro-inflammatory cytokines such as interferon (IFN)-␥ (Matsuzaki et al., 1997; Calcinaro et al., 2005; von Boehmer, 2005). Emerging evidence revealed that the surfactin lipopeptides produced by Bacillus subtilis (BS) exhibited obviously anti-inflammatory properties both in vitro and in vivo experiments (Hwang et al., 2007; Eun et al., 2008). Previous study showed that administration of Bacillus amyloliquefaciens (BA) could reduce the protein and mRNA levels of pro-inflammatory cytokines such as tumor necrosis factor (TNF) and IL-1␤ in the colon of dextran sulfate induced colitis mouse model (Hairul Islam et al., 2011). It was showed that addition of BA into broiler feed improved intestinal morphology and nutrient digestibility under normal physiological conditions (Lei et al., 2014). However, growing interest and rising demand of probiotics in poultry industry are focusing on probiotics application as a feed additive against immunological stress. To the best of our knowledge, information regarding the effects of BA on broilers under immunological stress has not been reported. Lipopolysaccharide (LPS) is widely used to induce immunological stress in broilers, which is the primary component of the outer membrane of gram-negative bacteria and serves as a potent activator of innate immune response (Takahashia et al., 1997; Xie et al., 2000). Therefore, this study was conducted to investigate the protective effects of BA inclusion on growth performance, intestinal integrity, antioxidant and immune status of broilers challenged with LPS originating from Escherichia coli. 2. Materials and methods 2.1. Experimental design, diets and management The animal care and use protocols were approved by Nanjing Agricultural University Institutional Animal Care and Use Committee. One hundred and ninety two one-day-old male Arbor Acre broiler chickens were randomly divided into four groups. Each group consisted of six replicates (one replicate per cage) with eight birds per replicate. Treatments included: (1) non-challenged control (CON; broilers fed a basal diet and were injected with sterile saline); (2) LPS-challenged control (LPS; broilers fed a basal diet and were challenged by injection with E. coli LPS); (3) LPS-challenged group + 0.5 g/kg of diet treatment (LPS-LBA; broilers fed a basal diet supplemented with 0.5 g BA per kg feed and were challenged with LPS); and (4) LPS-challenged group + 1.0 g/kg of diet treatment (LPS-HBA; broilers fed a basal diet supplemented with 1.0 g BA per kg feed and were challenged with LPS). An et al. (2008) reported improved body weight gain in broilers provided with a corn-soybean meal-based diet supplemented with 1.0 and 2.0 g BA (1.3 × 109 colony-forming units (CFU)/g) per kg diet. Considering the difference in strains, we carried out an independent experiment to choose the appropriate dose. My colleagues found that the optimum effect on growth performance of non-challenged broilers was found when BA (5.4 × 109 CFU/g) was provided at 0.5 g/kg of diet (unpublished), which is similar to the finding of An et al. (2008). Thus, 0.5 and 1.0 g/kg of diet were selected in the present study. The basal diet was formulated according to NRC (1994) to meet the nutrient requirements of the broilers (Table 1). The contents of dry matter (930.15), crude protein (968.06), ether extract (991.36) and ash (942.05) were determined using standard procedures (AOAC, 2005). The strain of BA used in the current study was BA ES-2 with 5.4 × 109 CFU/g, a wild-type strain originally isolated from the Scutellaria plant. The BA was provided by Prof. Lu from the Enzyme Engineering Laboratory at Nanjing Agricultural University, Nanjing, China. At 16, 18 and 20 d of age, birds were intraperitoneally injected with either 0.5 ml sterile saline (8.6 g/l) or a similar volume of LPS (E. coli serotype O55.B5, Sigma–Aldrich, St Louis, MO, USA) dissolved in 8.6 g/l sterile saline (1 mg/ml) at the appropriate dose of 500 ␮g/kg body weight. The doses and routes of LPS administration were referred to the previous study by Rajput et al. (2013). All birds were placed in three-level wired battery cages (135 cm × 75 cm × 60 cm; 0.13 m2 per chick), and housed in an environmentally controlled room maintained between 32 and 34 ◦ C from 1 to 7 d which was then gradually reduced to 26 ◦ C at the rate of 3–4 ◦ C per week and then kept constant thereafter. Continuous light was provided for the entire period of experiment. Feed and fresh water were available ad libitum for 21 d. Body weight of broilers were measured at 1, 15 and 21 d of the experiment, and feed intake on a cage basis was recorded at 15 and 21 d of age to calculate average daily gain (ADG), average daily feed intake (ADFI) and feed conversion ratio (FCR). 2.2. Sample collection At 20 d of the experiment, six chickens from each treatment (one bird per pen) were randomly selected and heparinized blood samples were collected from the wing vein within 2 h after LPS or sterile saline injection. Plasma samples were then taken by centrifugation at 2000 × g for 15 min at 4 ◦ C and stored at −80 ◦ C until analysis. After decapitation, the whole Please cite this article in press as: Li, Y., et al., Bacillus amyloliquefaciens supplementation alleviates immunological stress and intestinal damage in lipopolysaccharide-challenged broilers. Anim. Feed Sci. Tech. (2015), http://dx.doi.org/10.1016/j.anifeedsci.2015.07.001

G Model ANIFEE-13324; No. of Pages 13

ARTICLE IN PRESS Y. Li et al. / Animal Feed Science and Technology xxx (2015) xxx–xxx

3

Table 1 Composition and calculated nutrient levels of basal diet (g/kg). Ingredients

Content

Maize Soybean meal Maize gluten meal Soybean oil Limestone Dicalcium phosphate l-Lysine dl-Methionine Sodium chloride Premixa Zeolite Total

570 310 39 31 13 18 1.5 1.5 3 10 3 1000

Calculated nutrient levelsb Metabolizable energy (MJ/kg) Calcium Available phosphorus Lysine Methionine Methionine + cystine Analyzed compositionc Dry matter Crude protein Ether extract Ash

12.53 9.9 4.3 10.5 5.1 8.5 895 211 57.2 48.2

a Premix provided per kilogram of diet: transretinyl acetate, 24 mg; cholecalciferol, 6 mg; all-rac-␣-tocopherol acetate, 20 mg; menadione, 1.3 mg; thiamin, 2.2 mg; riboflavin, 8 mg; nicotinamide, 40 mg; choline chloride, 400 mg; calcium pantothenate, 10 mg; pyridoxine HCl, 4 mg; biotin, 0.04 mg; folic acid, 1 mg; vitamin B12 (cobalamin), 0.013 mg; Fe (from ferrous sulfate), 80 mg; Cu (from copper sulfate), 8.0 mg; Mn (from manganese sulfate), 110 mg; Zn (from zinc oxide), 65 mg; I (from calcium iodate), 1.1 mg; Se (from sodium selenite), 0.3 mg. b The nutrient levels were as fed basis. c Values based on analysis of triplicate samples of diets.

gastrointestinal tract was then rapidly removed. The small intestine was dissected free of the mesentery and placed on a chilled stainless steel tray. After that, 5 cm segments were cut at the mid-jejunum and mid-ileum, respectively. The 5 cm intestinal segments were flushed gently with ice cold phosphate-buffered saline (pH 7.4) and then placed in 10% fresh, chilled formalin solution for histological measurements. Approximately 20 cm of jejunal and ileal segments were opened longitudinally and the contents were flushed with ice-cold phosphate-buffered saline. Mucosa was collected by scraping using a sterile glass microscope slide at 4 ◦ C, which was then rapidly frozen in liquid nitrogen and stored at −80 ◦ C until the analysis of cytokine concentration, redox status and gene expression. The cecum tissues were quickly excised, and contents were removed and cultured to determine the population of E. Coli and Lactobacillus spp. All samples were collected within 10 min after being killed.

2.3. Plasma parameters The activity of diamine oxidase (DAO) in plasma was determined using spectrophotometry method as described by Hosoda et al. (1989). The assay mixture (3.8 ml) contained 3 ml phosphate-buffered saline (0.2 mol/l, pH 7.2), 0.1 ml (0.04 g/l) horseradish peroxidase solution (Sigma–Aldrich, St Louis, MO, USA), 0.1 ml o-dianisidine–methanol solution [5 g/l of odianisidine (Sigma–Aldrich, St Louis, MO, USA) in methanol], 0.5 ml plasma sample and 0.1 ml substrate solution (1.75 g/l of cadaverine dihydrochloride, Sigma–Aldrich, St Louis, MO, USA). This mixture was incubated for 30 min at 37 ◦ C, and absorbance at 436 nm was measured to calculate DAO activity. The content of corticosterone (COR) in plasma was determined by a commercial available 125 I-RIA kit (Beijing Research institute of Biotechnology, Beijing, China) according to manufacturer’s guidelines. The inter- and intra-assay coefficients’ variance of COR were 4.5% and 3.0%, respectively. The detection limits were 50 pg/ml.

2.4. Intestinal morphology Intestinal segments for morphological analysis were dehydrated and embedded in paraffin, sectioned at 4 ␮m and stained with hematoxylin and eosin. Villus height and crypt depth of twenty well-oriented villi per segment were measured using a Nikon ECLIPSE 80i light microscope equipped with a computer-assisted morphometric system (Nikon Corporation, Tokyo, Japan). Please cite this article in press as: Li, Y., et al., Bacillus amyloliquefaciens supplementation alleviates immunological stress and intestinal damage in lipopolysaccharide-challenged broilers. Anim. Feed Sci. Tech. (2015), http://dx.doi.org/10.1016/j.anifeedsci.2015.07.001

G Model ANIFEE-13324; No. of Pages 13

ARTICLE IN PRESS Y. Li et al. / Animal Feed Science and Technology xxx (2015) xxx–xxx

4

2.5. E. coli and Lactobacillus spp. colonies assay Cecal contents (0.2 g) were diluted in 2 ml sterilized saline with 154 mmol/l sodium chloride solution, and three 10-fold serial dilutions (10−4 , 10−5 and 10−6 ) were made from diluted cecal contents. A 100 ␮l portion of the last three dilutions was spread evenly onto plates. Lactobacillus spp. were enumerated on DeMan, Rogosa, Sharpe agar for 48 h at 37 ◦ C, and E. coli colonies were determined on MacConkey agar incubated for 24 h at 37 ◦ C. The DeMan, Rogosa, Sharpe agar and MacConkey agar were purchased from Qingdao Hope Bio-Technology Co., Ltd. (Qingdao, Shandong, China). All plates with countable colonies were enumerated and averaged to express lg CFU per gram of cecal contents. 2.6. Biochemical estimations of intestinal mucosa The activities of superoxide dismutase (SOD), glutathione peroxidase (GPx) and myeloperoxidase (MPO), and the concentrations of malondialdehyde (MDA), glutathione (GSH) and protein in intestinal mucosa were determined using colorimetric kits with spectrophotometer according to the instructions of the commercial kits (Nanjing Jiancheng Institute of Bioengineering, Jiangsu, China). All results were normalized against total protein concentration in each sample for inter-sample comparison. 2.7. Intestinal cytokine assay The IL-1␤ and IL-10 125 I-RIA commercial kits (Beijing Research Institute of Biotechnology, Beijing, China) were used to determine IL-1␤ and IL-10 concentrations in intestinal mucosa according to the manufacturer’s instructions. The inter- and intra-assay coefficients of variance were <5% and <10% for IL-1␤, <12% and <13% for IL-10, respectively. The detection limits were 80 pg/ml for IL-1␤ and 0.3 ng/ml for IL-10, respectively. 2.8. Messenger RNA quantification Messenger RNA abundance in intestinal mucosa was determined according to method described by Zhang et al. (2014). RNA was isolated using TRIzol Reagent (TaKaRa Biotechnology, Dalian, Liaoning, China) from snap-frozen mucosa samples according to the manufacturer’s protocols. RNA integrity was checked on 10 g/l agarose gel with ethidium bromide staining. The RNA concentration and purity were determined from OD260/280 readings (ratio > 1.8) using a NanoDrop ND-1000 UV spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). After determining the RNA concentration, 1 ␮g of total RNA was reverse-transcribed into complementary DNA using the PrimeScriptTM RT Reagent Kit (TaKaRa Biotechnology, Dalian, Liaoning, China) according to the manufacturer’s guidelines. Real-time PCR was carried out on an ABI StepOnePlusTM Real-Time PCR system (Applied Biosystems, Grand island, NY, USA) according to the manufacturer’s instructions. The primer sequences for the target and reference genes (cluster of differentiation 14 (CD14), toll-like receptor 4 (TLR4), myeloid differentiation factor 88 (MyD88), IFN-, IL-1ˇ, IL-2, IL-4, IL-6, IL-10, occluding (OCLN), cloudin2 (CLDN-2), cloudin3 (CLDN-3), zonula occludens-1 (ZO-1) and ˇ-actin) are given in Table 2. Briefly, the reaction mixture was prepared using 2 ␮l of complementary DNA, 0.4 ␮l of forward primer, 0.4 ␮l of reverse primer, 10 ␮l of SYBR Premix Ex TaqTM (TaKaRa Biotechnology, Dalian, Liaoning, China), 0.4 ␮l of ROX Reference Dye (TaKaRa Biotechnology, Dalian, Liaoning, China), and 6.8 ␮l of doubledistilled water. Each sample was tested in duplicate. PCR consisted of a pre-run at 95 ◦ C for 30 s and 40 cycles of denaturation at 95 ◦ C for 5 s, followed by a 60 ◦ C annealing step for 30 s. The conditions of the melting curve analysis were as follows: one cycle of denaturation at 95 ◦ C for 10 s, followed by an increase in temperature from 65 to 95 ◦ C at a rate of 0.5 ◦ C/s. The relative levels of mRNA expression were calculated using the 2−CT method after normalization against the reference gene, ˇ-actin (Livak and Schmittgen, 2001). The values of CON group were used as a calibrator. 2.9. Statistical analysis The analyses were performed using the SPSS 16.0 software (SPSS, 2008). Data among groups were analyzed using oneway analysis of variance followed by post hoc Bonferroni test. Results were presented as means and their pooled standard errors. A level of P < 0.05 was accepted as statistically significant. 3. Results 3.1. Growth performance Prior to LPS challenge, BA supplementation had no effect on the growth performance of broilers (P > 0.05, Table 3). LPS challenge decreased the ADG and ADFI whereas increased the FCR of broilers fed a basal diet (P < 0.05). The decrease in ADG and ADFI was also observed for both BA supplemented groups compared with the CON group (P < 0.05). Compared with the LPS control, a higher BA inclusion (1.0 g/kg) ameliorated the compromised ADG and FCR in LPS-challenged broilers (P < 0.05). In addition, dietary BA inclusion, at either 0.5 or 1.0 g/kg, increased the ADFI of broilers than that of LPS control (P < 0.05). Please cite this article in press as: Li, Y., et al., Bacillus amyloliquefaciens supplementation alleviates immunological stress and intestinal damage in lipopolysaccharide-challenged broilers. Anim. Feed Sci. Tech. (2015), http://dx.doi.org/10.1016/j.anifeedsci.2015.07.001

G Model

ARTICLE IN PRESS

ANIFEE-13324; No. of Pages 13

Y. Li et al. / Animal Feed Science and Technology xxx (2015) xxx–xxx

5

Table 2 Sequences for real-time PCR primers. Genea

NCBI gene bank IDb

Primer sequence, sense/antisense

Length

CD14

NM 001139478.1

132

TLR4

NM 001030693.1

MyD88

NM 001030962.1

IFN-␥

NM 205149.1

IL-1␤

NM 204524.1

IL-2

NM 001007079.1

IL-4

NM 204628.1

IL-6

NM 204628.1

IL-10

NM 001004414.2

OCLN

NM 205128.1

CLDN-2

NM 001277622.1

CLDN-3

NM 204202.1

ZO-1

XM 413773.4

␤-actin

NM 205518.1

TGGACGACTCCACCATTGAC CCATCTCCTGCACCTGAGTG AGGCACCTGAGCTTTTCCTC TACCAACGTGAGGTTGAGCC ATCCGGACACTAGAGGGAGG GGCAGAGCTCAGTGTCCATT CACTGACAAGTCAAAGCCGC ACCTTCTTCACGCCATCAGG GTACCGAGTACAACCCCTGC AGCAACGGGACGGTAATGAA GTGCCCACGCTGTGCTTAC AGGAAACCTCTCCCTGGATGTC AGGGCCGTTCGCTATTTGAA CAGAGGATTGTGCCCGAACT AGGGCCGTTCGCTATTTGAA CAGAGGATTGTGCCCGAACT GGAGCTGAGGGTGAAGTTTGA GACACAGACTGGCAGCCAAA CCGTAACCCCGAGTTGGAT ATTGAGGCGGTCGTTGATG CCTGCTCACCCTCATTGGAG GCTGAACTCACTCTTGGGCT CCCGTCCCGTTGTTGTTTTG CCCCTTCAACCTTCCCGAAA TGTAGCCACAGCAAGAGGTG CTGGAATGGCTCCTTGTGGT TTGGTTTGTCAAGCAAGCGG CCCCCACATACTGGCACTTT

96 115 87 112 82 72 72 129 214 145 126 98 100

a CD14, cluster of differentiation 14; TLR4, toll-like receptor 4; MyD88, myeloid differentiation factor 88; IFN-␥, interferon ␥; IL-1␤, interleukin 1 beta; IL-2, interleukin 2; IL-4, interleukin 4; IL-6, interleukin 6; IL-10, interleukin 10; OCLN, occluding; CLDN-2, cloudin2; CLDN-3, cloudin3; ZO-1, zonula occludens-1. b NCBI, National Center of Biotechnology Information, Bethesda, MD, USA.

Table 3 The effects of dietary Bacillus amyloliquefaciens supplementation on growth performance of lipopolysaccharide-challenged broiler. Itema

CONc

LPS

LPS-LBA

LPS-HBA

SEMd

Contraste 1

1–15 d ADGb (g/d) ADFI (g/d) FCR (g/g)

20.3 28.2 1.40

20.1 27.3 1.37

20.1 27.5 1.38

20.8 28.1 1.36

0.4 0.2 0.02

1.000 1.000 1.000

16–21 d ADG (g/d) ADFI (g/d) FCR (g/g)

71.4 106 1.49

53.0* 92* 1.76*

58.7* 99*# 1.69

63.4*# 97*# 1.54#

1.4 1.1 0.03

<0.001 <0.001 0.013

2

3

4

5

1.000 1.000 1.000

1.000 1.000 1.000

1.000 1.000 1.000

1.000 1.000 1.000

<0.001 0.004 0.098

0.023 0.001 1.000

0.119 0.004 1.000

0.001 0.032 0.035

a *

Significant different (P < 0.05) from the CON group. # Significant different (P < 0.05) from the LPS group. ADG, average daily gain; ADFI, average daily feed intake; FCR, feed conversion ratio. c CON, broilers fed a basal diet and were injected with sterile saline; LPS, broilers fed a basal diet and were challenged by injection with LPS; LPS-LBA, broilers fed a basal diet supplemented with 0.5 g/kg BA and were challenged with LPS; LPS-HBA, broilers fed a basal diet supplemented with 1.0 g/kg BA and were challenged with LPS. d SEM, total standard error of means. e Contrast: (1) CON vs. LPS; (2) CON vs. LPS-LBA; (3) CON vs. LPS-HBA; (4) LPS vs. LPS-LBA; (5) LPS vs. LPS-HBA. b

3.2. Plasma parameters In comparison with CON group, LPS injection increased the activity of DAO and the concentration of COR in the plasma of broiler fed a basal diet (P < 0.05, Table 4). The increased DAO activity induced by LPS injection was reduced by 1.0 g/kg BA inclusion (P < 0.05). However, treatment with BA did not influence circulating COR concentration of broilers (P > 0.05). 3.3. Intestinal mucosal morphology Compared with CON group, LPS group showed increased crypt depth but decreased ratio of villus height to crypt depth in ileum (P < 0.05, Table 5), as well as reductions in the villus height and the ratio of villus height to crypt depth in jejunum Please cite this article in press as: Li, Y., et al., Bacillus amyloliquefaciens supplementation alleviates immunological stress and intestinal damage in lipopolysaccharide-challenged broilers. Anim. Feed Sci. Tech. (2015), http://dx.doi.org/10.1016/j.anifeedsci.2015.07.001

G Model

ARTICLE IN PRESS

ANIFEE-13324; No. of Pages 13

Y. Li et al. / Animal Feed Science and Technology xxx (2015) xxx–xxx

6

Table 4 The effects of dietary Bacillus amyloliquefaciens supplementation on plasma parameters of lipopolysaccharide-challenged broiler. Itema

CONc

LPS

LPS-LBA

LPS-HBA

SEMd

DAOb (U/ml) COR (ng/ml)

15.6 7.67

27.4* 12.7*

20.8 9.47

19.2# 9.87

1.3 0.60

Contraste 1

2

3

4

5

0.002 0.012

0.401 1.000

1.000 0.823

0.154 0.199

0.041 0.352

a *

Significant different (P < 0.05) from the CON group. # Significant different (P < 0.05) from the LPS group. DAO, diamine oxidase; COR, corticosterone. c CON, broilers fed a basal diet and were injected with sterile saline; LPS, broilers fed a basal diet and were challenged by injection with LPS; LPS-LBA, broilers fed a basal diet supplemented with 0.5 g/kg BA and were challenged with LPS; LPS-HBA, broilers fed a basal diet supplemented with 1.0 g/kg BA and were challenged with LPS. d SEM, total standard error of means. e Contrast: (1) CON vs. LPS; (2) CON vs. LPS-LBA; (3) CON vs. LPS-HBA; (4) LPS vs. LPS-LBA; (5) LPS vs. LPS-HBA. b

Table 5 The effects of dietary Bacillus amyloliquefaciens supplementation on intestinal mucosal morphology of lipopolysaccharide-challenged broiler. Itema

CONb

LPS

LPS-LBA

LPS-HBA

SEMc

Contrastd 1

2

3

4

5

1.000 0.151

0.573 1.000

0.006 1.000

0.035 1.000

0.614 <0.001

0.330 0.049

1.000 0.300

1.000 0.129

1.000 0.019

<0.001 0.001

<0.001 0.004

0.003 0.110

0.115 1.000

0.013 0.225

Villus height (␮m) 955 Jejunum 806 Ileum

652* 725

892# 702

845# 753

31.4 16.3

0.001 0.447

Crypt depth (␮m) 154 Jejunum Ileum 131

193 161*

200 147*

177 142#

8.3 2.9 0.23 0.17

Villus height:crypt depth (␮m/␮m) Jejunum 6.24 3.60* Ileum 6.17 4.55*

4.47* 4.81*

4.80*# 5.30

a *

Significant different (P < 0.05) from the CON group. # Significant different (P < 0.05) from the LPS group. CON, broilers fed a basal diet and were injected with sterile saline; LPS, broilers fed a basal diet and were challenged by injection with LPS; LPS-LBA, broilers fed a basal diet supplemented with 0.5 g/kg BA and were challenged with LPS; LPS-HBA, broilers fed a basal diet supplemented with 1.0 g/kg BA and were challenged with LPS. c SEM, total standard error of means. d Contrast: (1) CON vs. LPS; (2) CON vs. LPS-LBA; (3) CON vs. LPS-HBA; (4) LPS vs. LPS-LBA; (5) LPS vs. LPS-HBA. b

(P < 0.05). The similar effect exerted by LPS was also observed for the crypt depth and the ratio of villus height to crypt depth in the ileum of LPS-LBA group (P < 0.05), and the ratio of villus height to crypt depth in the jejunum of both LPS-LBA and LPS-HBA group (P < 0.05). The BA groups showed a greater jejunal villus height than that of LPS group (P < 0.05). Additionally, a decreased ileal crypt depth was observed in LPS-HBA group compared with the LPS group (P < 0.05).

3.4. Microflora population The inclusion of 1.0 g/kg BA induced an increase in Lactobacillus spp. population and a decrease in E. coli population in cecal digesta compared with the LPS group (P < 0.05, Table 6). However, the similar effect was not found in LPS-LBA group (P > 0.05).

Table 6 The effects of dietary Bacillus amyloliquefaciens supplementation on Escherichia coli and Lactobacillus spp. colonies of cecal contents of lipopolysaccharidechallenged broiler. Itema

CONb

LPS

LPS-LBA

LPS-HBA

SEMc

Escherichia coli (lg CFU/g) Lactobacillus spp. (lg CFU/g)

7.50 7.85

7.95 7.39

7.43 8.39

7.12# 8.72#

0.10 0.16

Contrastd 1

2

3

4

5

0.347 1.000

1.000 0.799

0.702 0.129

0.187 0.060

0.010 0.008

a *

Significant different (P < 0.05) from the CON group. # Significant different (P < 0.05) from the LPS group. CON, broilers fed a basal diet and were injected with sterile saline; LPS, broilers fed a basal diet and were challenged by injection with LPS; LPS-LBA, broilers fed a basal diet supplemented with 0.5 g/kg BA and were challenged with LPS; LPS-HBA, broilers fed a basal diet supplemented with 1.0 g/kg BA and were challenged with LPS. c SEM, total standard error of means. d Contrast: (1) CON vs. LPS; (2) CON vs. LPS-LBA; (3) CON vs. LPS-HBA; (4) LPS vs. LPS-LBA; (5) LPS vs. LPS-HBA. b

Please cite this article in press as: Li, Y., et al., Bacillus amyloliquefaciens supplementation alleviates immunological stress and intestinal damage in lipopolysaccharide-challenged broilers. Anim. Feed Sci. Tech. (2015), http://dx.doi.org/10.1016/j.anifeedsci.2015.07.001

G Model

ARTICLE IN PRESS

ANIFEE-13324; No. of Pages 13

Y. Li et al. / Animal Feed Science and Technology xxx (2015) xxx–xxx

7

Table 7 The effects of dietary Bacillus amyloliquefaciens supplementation on intestinal antioxidant and immune status of lipopolysaccharide-challenged broiler. Itema

CONc

LPS

LPS-LBA

LPS-HBA

SEMd

Contraste 1

2

3

4

0.198 1.000

1.000 1.000

1.000 1.000

1.000 1.000

1.000 1.000

1.3 1.6

0.001 0.500

1.000 1.000

0.360 1.000

0.007 1.000

0.048 0.327

SODb (U/mg protein) Jejunum 40.3 39.1 Ileum

54.5 40.7

48.0 40.5

47.3 35.6

2.3 1.9

GPx (U/mg protein) 8.8 Jejunum Ileum 11.7

20.6* 19.4

11.3# 16.6

13.5# 10.7

5

MDA (nmol/mg protein) 0.62 Jejunum 0.35 Ileum

1.96* 0.47

1.12# 0.39

1.14# 0.30

0.14 0.02

0.001 0.354

0.406 1.000

0.369 1.000

0.030 1.000

0.033 0.061

GSH (␮mol/g protein) Jejunum 1.82 1.36 Ileum

0.71* 0.68*

1.05 0.91*

1.59# 1.22#

0.14 0.08

0.008 0.001

0.097 0.034

1.000 1.000

1.000 0.761

0.045 0.010

0.006 <0.001

1.000 0.642

1.000 1.000

0.006 0.016

0.020 <0.001

MPO (U/g protein) Jejunum 23.3 24.9 Ileum

53.3* 44.5*

23.2# 31.3#

27.4# 22.0#

3.8 2.3

a *

Significant different (P < 0.05) from the CON group. # Significant different (P < 0.05) from the LPS group. SOD, superoxide dismutase; GPx, glutathione peroxidase; MDA, malonaldehyde; GSH, glutathione; MPO, myeloperoxidase. c CON, broilers fed a basal diet and were injected with sterile saline; LPS, broilers fed a basal diet and were challenged by injection with LPS; LPS-LBA, broilers fed a basal diet supplemented with 0.5 g/kg BA and were challenged with LPS; LPS-HBA, broilers fed a basal diet supplemented with 1.0 g/kg BA and were challenged with LPS. d SEM, total standard error of means. e Contrast: (1) CON vs. LPS; (2) CON vs. LPS-LBA; (3) CON vs. LPS-HBA; (4) LPS vs. LPS-LBA; (5) LPS vs. LPS-HBA. b

3.5. Intestinal antioxidant and immune status Broilers in LPS group showed an increase in GPx activity whereas a decrease in GSH concentration in jejunum when compared with those without LPS injection (P < 0.05, Table 7). LPS administration also resulted in a decrease in ileal GSH concentration in both LPS and LPS-LBA groups (P < 0.05). A decreased jejunal GPx activity was observed in both BA supplemented groups when compared with LPS group (P < 0.05). LPS-HBA group showed a greater concentration of GSH in both jejunum and ileum than that of LPS group (P < 0.05). LPS challenge increased jejunal MDA content compared with the CON group (P < 0.05). In contrast, administration of BA (either 0.5 or 1.0 g/kg) into LPS-challenged broilers prevented the increase of MDA content (P < 0.05). Moreover, LPS group had an increased MPO activity in both jejunum and ileum than that of CON group (P < 0.05). However, a significant decreased MPO activity in both jejunum and ileum was found in LPS-LBA and LPS-HBA groups when compared with LPS group (P < 0.05). 3.6. Cytokines determination Compared to the CON group, broilers in LPS group had an increased IL-1␤ concentration in jejunum (P < 0.05, Table 8). The concentration of jejunal IL-1␤ was lower in both BA supplemented groups than that of LPS group (P < 0.05). In comparison with LPS group, BA treatment also decreased IL-1␤ concentration in the ileum of LPS-HBA group (P < 0.05). Additionally, Table 8 The effects of dietary Bacillus amyloliquefaciens supplementation on cytokines levels in the intestinal mucosa of lipopolysaccharide-challenged broiler. Itema

CONc

IL-1␤b (ng/mg protein) 0.15 Jejunum 0.14 Ileum IL-10 (ng/mg protein) Jejunum 66.8 21.3 Ileum

LPS

0.38* 0.17 59.3 25.8

LPS-LBA

0.21# 0.14 101*# 21.4

LPS-HBA

0.26# 0.08# 123*# 31.5

SEMd

Contraste 1

2

3

4

5

0.02 0.01

<0.001 1.000

0.955 1.000

0.120 0.126

0.003 1.000

0.036 0.019

6.94 1.99

1.000 1.000

0.044 1.000

0.001 0.468

0.010 1.000

<0.001 1.000

Significant different (P < 0.05) from the CON group. # Significant different (P < 0.05) from the LPS group. IL, interleukin. c CON, broilers fed a basal diet and were injected with sterile saline; LPS, broilers fed a basal diet and were challenged by injection with LPS; LPS-LBA, broilers fed a basal diet supplemented with 0.5 g/kg BA and were challenged with LPS; LPS-HBA, broilers fed a basal diet supplemented with 1.0 g/kg BA and were challenged with LPS. d SEM, total standard error of means. e Contrast: (1) CON vs. LPS; (2) CON vs. LPS-LBA; (3) CON vs. LPS-HBA; (4) LPS vs. LPS-LBA; (5) LPS vs. LPS-HBA. a *

b

Please cite this article in press as: Li, Y., et al., Bacillus amyloliquefaciens supplementation alleviates immunological stress and intestinal damage in lipopolysaccharide-challenged broilers. Anim. Feed Sci. Tech. (2015), http://dx.doi.org/10.1016/j.anifeedsci.2015.07.001

G Model ANIFEE-13324; No. of Pages 13

8

ARTICLE IN PRESS Y. Li et al. / Animal Feed Science and Technology xxx (2015) xxx–xxx

Fig. 1. Effect of Bacillus amyloliquefaciens supplementation on the expressions of genes related to intestinal inflammatory response in broilers challenged with lipopolysaccharide. The column and its bar represented the means value and SE, n = 6, respectively. Values are expressed in arbitrary units. The mRNA level of each target gene for the CON group is assigned a value of 1 and normalized against ␤-actin. *Significant different (P < 0.05) from the CON group. # Significant different (P < 0.05) from the LPS group.

dietary BA inclusion, at either 0.5 or 1.0 g/kg, increased IL-10 concentration in jejunum compared with either CON or LPS group (P < 0.05).

3.7. Gene expression related to inflammatory response Following LPS injection, the increase in mRNA abundances of TLR4 and IL-1ˇ was found in the jejunum of broilers compared with the CON group (P < 0.05, Fig. 1). The increased TLR4 and IL-1ˇ mRNA abundances in the jejunum of broilers challenged with LPS were reduced by BA treatment (P < 0.05). The jejunal IFN- expression was lower in LPS-HBA group than that of LPS group (P < 0.05). Additionally, the mRNA expression of jejunal IL-10 was increased in both BA supplemented groups when compared with the CON group (P < 0.05). Compared with the CON group, LPS group showed significantly increased IL-1ˇ, IL-2 and IL-6 expressions in the ileum of broilers (P < 0.05, Fig. 1). The decreased mRNA abundances of IL-1ˇ and IL-2 in ileum were observed in LPS-HBA group compared with the LPS group (P < 0.05). Dietary supplementation of 1.0 g/kg BA also exerted a similar effect on mRNA abundance of ileal TLR4 (P < 0.05).

3.8. Gene expression related to tight junctions After LPS injection, a significantly increased expression was observed for jejunal CLDN-2 mRNA compared with the CON group (P < 0.05, Fig. 2). However, the elevated jejunal CLDN-2 mRNA abundance induced by LPS challenge was counteracted by 1.0 g/kg BA inclusion (P < 0.05). LPS challenge increased CLDN-2 mRNA abundance, but decreased ZO-1 expression in ileum compared with the CON group (P < 0.05, Fig. 2). In contrast, dietary supplementation of 1.0 g/kg BA resulted in decreased CLDN-2 but increased ZO-1 expressions in ileum compared with the LPS group (P < 0.05). In addition, LPS-HBA group also showed an increase in ileal OCLN expression (P < 0.05). Please cite this article in press as: Li, Y., et al., Bacillus amyloliquefaciens supplementation alleviates immunological stress and intestinal damage in lipopolysaccharide-challenged broilers. Anim. Feed Sci. Tech. (2015), http://dx.doi.org/10.1016/j.anifeedsci.2015.07.001

G Model ANIFEE-13324; No. of Pages 13

ARTICLE IN PRESS Y. Li et al. / Animal Feed Science and Technology xxx (2015) xxx–xxx

9

Fig. 2. Effect of Bacillus amyloliquefaciens supplementation on the expressions of genes related to intestinal tight junctions in broilers challenged with lipopolysaccharide. The column and its bar represented the means value and SE, n = 6, respectively. Values are expressed in arbitrary units. The mRNA level of each target gene for the CON group is assigned a value of 1 and normalized against ␤-actin. *Significant different (P < 0.05) from the CON group. # Significant different (P < 0.05) from the LPS group.

4. Discussion Immunological stress is a critical problem which threatens poultry industry. It inhibits the expression of birds’ maximum genetic potential that results in compromised performance as well as high mortality. Previous study has drawn the attention on the possibility that feeding probiotics attenuates the negative effects induced by immunological stress (Dalloul et al., 2003). Although our comprehension regarding the benefits of probiotics in poultry production has grown significantly, it is far from being complete or even satisfactory. Therefore, the present study will broaden our understanding of how a BA diet alters growth performance and intestinal health of the broilers under immunological stress. The COR is the most important adrenocortical hormone in chickens and its plasma concentration is widely used as an indicator of stress (Baert et al., 2005). As other authors have reported (Baert et al., 2005), a significant rise in plasma COR concentration was found in LPS-treated chickens in our experiment. The result indicated that broilers were stressful during the experimental procedure post-challenge. LPS challenge severely decreased performance of broilers during 6 d postchallenge, which is in agreement with the majority of studies (Xie et al., 2000; Shen et al., 2010). The compromised growth performance is probably due to the diversion of available nutrients away from growth to support immune-related processes and synthesis of various mediators such as cytokines (Xie et al., 2000; Brzek and Konarzewski, 2007; Shen et al., 2010). On the other hand, the LPS-induced intestinal dysfunction will further impair the digestion and absorption of nutrients. In this experiment, the compromised ADG and FCR of broilers suffering from LPS challenge were improved by a higher BA supplementation, indicating that BA might exert a protective effect on the growth of the broilers under immunological stress. The intestinal epithelial barrier is important in the systemic inflammatory response after LPS challenge. Its breakdown is characterized by high gut permeability and typical histologic changes such as submucosal edema, villus necrosis, inflammatory cell infiltration, reduced villus height and increased crypt depth in the mucosa (Liu et al., 2008). Shorter villus and deeper crypts lead to poor nutrient absorption, increased secretion of electrolytes and water in gastrointestinal tract and therefore compromised performance. In this study, we confirmed the negative effect of LPS challenge on the intestinal structure of Please cite this article in press as: Li, Y., et al., Bacillus amyloliquefaciens supplementation alleviates immunological stress and intestinal damage in lipopolysaccharide-challenged broilers. Anim. Feed Sci. Tech. (2015), http://dx.doi.org/10.1016/j.anifeedsci.2015.07.001

G Model ANIFEE-13324; No. of Pages 13

10

ARTICLE IN PRESS Y. Li et al. / Animal Feed Science and Technology xxx (2015) xxx–xxx

broilers as evidenced by increased crypt depth, decreased villus height and villus height to crypt depth ratio. The results corroborate the findings of Hu et al. (2011). The DAO is a highly active endocellular enzyme and is abundantly expressed in the upper part of the intestinal mucosa. Under certain circumstances, intestinal mucosal cells undergo necrosis and slough off into the intestinal lumen, leading to an increase in circulating DAO activity (Li et al., 2002). Thus, circulating DAO activity is a useful indicator of intestinal permeability and mucosal injury. The increased circulatory DAO activity indicates that LPS challenge exerts a negative effect on intestinal structure and permeability of broilers. The BA supplementation could attenuate the intestinal morphologic damage of LPS-challenged broilers as demonstrated by increased villus height and decreased crypt depth. Results obtained herein are consistent with Lei et al. (2014) who reported that broilers fed a BA diet had increased villus height and greater ratio of villus height to crypt depth in jejunum, duodenum and ileum. Similarly, Sen et al. (2012) showed that supplementation of Bacillus subtilis (BS) LS 1–2 in broiler diets resulted in increased villus height and villus height to crypt depth ratio in duodenum and ileum. Meanwhile, a higher BA inclusion significantly decreased plasma DAO activity in response to LPS administration in this study, which might provide another clue for the improvement of intestinal morphologic damage. Thus, our results may provide new information regarding the potential of BA as regulator in alleviating intestinal morphologic damage and permeability of broilers under immunological stress. Probiotics play an important role in stabilizing the intestinal ecosystem of animals by improving the growth of beneficial bacteria and competing with pathogenic bacteria in the intestine (Higgins et al., 2008). The use of probiotics for poultry is based on the knowledge that the gut flora is involved in resistance to enteric infections including E. coli, Salmonella, and Campylobacter (Chateau et al., 1993; Stern et al., 2001). It may be due to the increased ratio of lactic acid bacteria to pathogenic bacteria, competition for adherence sites and nutrients and production of antimicrobial peptides. An et al. (2008) found that broilers fed a BA diet had higher numbers of Lactobacillus spp. in cecal microflora. Mallo et al. (2010) also reported that dietary BA supplementation increased Lactobacillus spp. population and reduced E. coli population in the cecal digesta of broilers. Similar results were obtained in our study. The reason for the recovery of Lactobacillus spp. after LPS injection is that BA supplementation might help Lactobacillus spp. to recolonize the gut. The BA is exogenous spore-forming bacteria which is not the principal member of normal intestinal flora. The BA cannot colonize the intestines over a long period of time, but they consume oxygen rapidly and then regulate the intestinal environment. Moreover, lactic acid produced by BA following the lactic acid path could cause a severe drop in intestinal pH (Ahmed et al., 2014). Under the modulated intestinal environment, Lactobacillus spp. will be easy to colonize and E. coli will be inhibited (Song et al., 2014). Moreover, BA is known to produce bacteriocins, which are classified into bacteriostatics or bacterocidals according to their activity spectrum and belong to peptide antibiotics group (Lisboa et al., 2006). The bacteriocin from BA is a ribonuclease called barnase, which can inhibit the growth of pathogenic bacteria (Ulyanova et al., 2011). Herzner et al. (2011) showed that the antimicrobial peptides produced by BA have been verified as bactericidal agents, called lantibiotic subtilin and mersacidin. Thereby, the reduced population of E. coli in cecal digesta observed in the present study was probably due to the effects of lactic acid and antimicrobial peptides produced by BA. These observations suggest the potential for use of BA as an alternative to antibiotics in commercial broiler production. Emerging evidence indicated that probiotics exhibited antioxidant and free radical scavenging properties in vitro (Kodali and Sen, 2008). However, few studies have focused on the effect of probiotics on intestinal antioxidant status, especially after LPS challenge. LPS can result in an increase in the production of reactive oxygen species (ROS), such as superoxide anions, hydrogen peroxide and hydroxyl radicals. The concentrations of ROS exceeding the antioxidant protection levels of cells can cause widespread damage to DNA, proteins and endogenous lipids. To protect organelles and cellular components against ROS-associated damage, cells have developed several antioxidant defense systems, including SOD, GPx and GSH. The SOD is generally recognized as one of the main antioxidant enzymes; the superoxide anion is converted to H2 O2 by SOD, which is then removed by GPx or catalase. The GSH is one of the predominant endogenous antioxidants responsible for the detoxification of ROS, removal of hydrogen and lipid peroxides, and repair of oxidatively damaged proteins. Ozdemir et al. (2007) reported that LPS-challenged induced an increase in activities of antioxidant enzymes, including SOD and GPx; nevertheless, this increase was shown to be inadequate to counteract the oxidative damage in the intestine of rats as evidenced by increased MDA content. The results presented in our study also support the findings of Ozdemir et al. (2007). The concentration of MDA is an indicator of lipid peroxidation. Lipid peroxidation occurs when there are insufficient levels of antioxidants to prevent ROS from promoting deleterious levels of oxidative damage, which may induce the destruction of biological membranes, leading to alterations of membrane function and to increased protein degradation. In the present study, dietary BA supplementation alleviated the increased levels of GPx activity and MDA concentration induced by LPS challenge, and counteracted the compromised GSH concentration after LPS injection. The BA might attenuate intestinal oxidative damage through the mechanism: (1) Bacillus species can synthesize extracellular polysaccharides, which are characterized by their ability to remove ROS (Kishk and Al-Sayed, 2007; Wang and Luo, 2007; Kodali and Sen, 2008); (2) Bacillus species can produce a new thiol, defined as bacillithiol, which is the ␣-anomeric glycoside of l-cysteinyl-d-glucosamine with l-malic acid and most probably functions as an antioxidant, may serve as a substitute for GSH (Newton et al., 2009). Thus, these results may help improve our understanding regarding the antioxidant properties of BA at the organism level, but the detail mechanism need to be further explored. Additionally, it is noteworthy that probiotics can attenuate neutrophil infiltration transepithelial migration in the intestinal mucosa under immunological stress. Neutrophil accumulation is the most important source of reactive oxygen metabolites. Infiltration of neutrophils and macrophages into the mucosa has been suggested to contribute significantly to Please cite this article in press as: Li, Y., et al., Bacillus amyloliquefaciens supplementation alleviates immunological stress and intestinal damage in lipopolysaccharide-challenged broilers. Anim. Feed Sci. Tech. (2015), http://dx.doi.org/10.1016/j.anifeedsci.2015.07.001

G Model ANIFEE-13324; No. of Pages 13

ARTICLE IN PRESS Y. Li et al. / Animal Feed Science and Technology xxx (2015) xxx–xxx

11

the tissue necrosis and mucosal dysfunction, as they represent a major source of ROS in inflamed tissues (Deniz et al., 2004). The MPO has been implicated as a participant in tissue injury during a large number of inflammatory conditions, which is a leukocyte-derived enzyme that catalyzes the formation of cytotoxic oxidants (Nicholls and Hazen, 2005). These oxidants are capable of both initiating lipid peroxidation and promoting an array of posttranslational modifications to proteins (Nicholls and Hazen, 2005). In the current study, the increased level of MPO activity in LPS group was obviously alleviated with BA treatment, indicating that BA might play a positive role in reducing inflammation caused by neutrophils. Therefore, the antioxidant properties of BA are attributable, at least in part, to the anti-inflammatory effect. Intestinal epithelial cells act as “watchdogs” for the immune system, which can signal the onset of the host innate and acquired immune responses through the production of cytokines and chemokines that are crucial for the recruitment and activation of neutrophils, macrophages, T and B cells, and dendritic cells (Miller et al., 2005). LPS challenge induces intestinal hyperpermeability and increased activity of innate immune cells. Subsequently, the LPS signaling pathway of mucosal immune system is activated. The core LPS signaling pathway starts with the liver-produced LPS-binding protein (LBP), which binds the LPS shed from bacteria and conveys it to the surface of macrophages or neutrophils in a form that can be recognized by CD14, a glycosylphosphatidylinositol-linked cell surface glycoprotein. The LBP-CD14 complex in turn activates the TLR4; stimulation of the extracellular domain of TLR4 triggers the intracellular association of MyD88 with its cytosolic domain for the activation of NF-␬B, which ultimately leads to the biosynthesis and release of potent inflammatory cytokines such as TNF-␣, IL-1, and IL-6 (Miller et al., 2005). An imbalance of pro-inflammatory cytokines and anti-inflammatory cytokines is another important mechanism of intestinal mucosal injury. In this study, we found that LPS challenge increased IL-1␤ concentration with the concomitant upregulation of TLR4 and IL-1ˇ mRNA abundances in jejunum. Meanwhile, the similar role exerted by LPS was observed for IL-1ˇ, IL-2 and IL-6 expressions in ileum. Our result was in accordance with the report by Liu et al. (2015) in which LPS increased mRNA abundance of TLR4, IL-1ˇ and IL-6 in jejunal mucosa of chickens. We suggest that increased pro-inflammatory cytokine mRNA could be due to the increases in TLR4 mRNA, rather than MyD88 and CD14. This conclusion is based on observations by others (Liu et al., 2015), in which the increased TLR4 and pro-inflammatory cytokine mRNA in the jejunum of chickens induced by LPS was not accompanied by elevated MyD88 mRNA. It has been demonstrated that surfactin lipopeptides produced by BS could decrease the mRNA abundance of the CD 40, 54 and 80, and major histocompatibility class II on macrophages, inhibiting nitric oxide production in antigen presenting cells and suppressing activation of CD4+ T cells (Eun et al., 2008). Moreover, this surfactin strongly blocked the phosphorylation of IKK and I␬B␣ and the nuclear translocation of NF-␬B (p65), and therefore might serve as a bacterium-derived antiinflammatory agent with anti-NF-␬B activity (Eun et al., 2008). Likewise, BA isolated from the soils of North East Himalayas has been shown to reduce the protein and mRNA levels of pro-inflammatory cytokines in the colon of colitis mouse induced by dextran sulfate (Hairul Islam et al., 2011). In the current study, the increased IL-1␤ concentration in jejunum induced by LPS injection was counteracted by BA supplementation. This finding, together with downregulated mRNA expressions of TLR4, IFN- and IL-1ˇ, suggested that BA could exert an active role in reducing massive production of pro-inflammatory cytokines. On the other hand, Gao et al. (2014) has recently shown that oral administration of a surfactin lipopeptide purified from a BA culture could promote the production of IL-10 in the splenocytes of NOD mice. In this work, BA supplementation promoted the transcription and synthesis of IL-10 in the jejunum of LPS-challenged broilers. The IL-10 is considered a potent inhibitor of many pro-inflammatory cytokines triggered by LPS, including TNF, IL-1␤, IL-2, IL-6 and IL-8. Jenkins et al. (1994) showed that IL-10 markedly inhibited IL-1ˇ mRNA and protein production in LPS-stimulated monocytes, which was associated with the elevated level of IL-1 receptor antagonist mRNA induced by IL-10. Taken together, the decrease in mRNA or protein levels of pro-inflammatory cytokines after BA treatment probably results from reduced mRNA expression of TLR4 and elevated transcription and synthesis of IL-10. Studies have shown that the function and permeability of the intestine may be regulated by a network of multiple cytokines, including TNF-␣, IFN-␥, and ILs, through modulation of tight junctions (TJs) proteins and regulation of junction assembly (Madara and Stafford, 1989; Xavier and Podolsky, 2007). Disruption of TJs function drastically alters paracellular permeability and is a hallmark of many pathologic states. LPS-mediated TLR4/NF-␬B signaling pathway may participate in the alterations of TJs proteins by increasing transcription and translation of downstream inflammatory mediators (Luo et al., 2012). These inflammatory mediators are released into the blood and act on local intestinal mucosal epithelial cells, resulting in impairment of the structure of TJs and the function of the intestinal barrier. Gu et al. (2011) found that decreased ZO-1 expression was correlated with increased paracellular permeability in LPS-treated mice. This protein, together with OCLN and CLDN family members, are key regulators of intestinal permeability. Previous study reported that IFN-␥ could alter paracellular permeability via direct effects on the structural TJs proteins, such as OCLN, ZO-1 (Youakim and Ahdieh, 1999). In addition, Suzuki et al. (2011) showed that IL-6 could induce the upregulation of CLDN-2, a channel protein that contributes to the formation of TJs complexes, thus increasing mucosal permeability. The upregulation of intestinal CLDN-2 expression has been implicated as the cause of inflammatory bowel diseases (Zeissig et al., 2007). The results of our study also demonstrated that LPS induction caused a significantly upregulation of CLDN-2 mRNA expression in both jejunum and ileum; meanwhile, a decreased mRNA abundance of ZO-1 was observed in the ileum of LPS-challenged broilers. However, a higher level BA included diet inhibited the upregulation of CLDN-2 and alleviated the downregulation of ZO-1 caused by LPS injection. The increased expression of ZO-1 may provide the needed building blocks to assemble TJs. These observations are probably responsible for the improvement of intestinal permeability under immunological stress. Please cite this article in press as: Li, Y., et al., Bacillus amyloliquefaciens supplementation alleviates immunological stress and intestinal damage in lipopolysaccharide-challenged broilers. Anim. Feed Sci. Tech. (2015), http://dx.doi.org/10.1016/j.anifeedsci.2015.07.001

G Model ANIFEE-13324; No. of Pages 13

ARTICLE IN PRESS Y. Li et al. / Animal Feed Science and Technology xxx (2015) xxx–xxx

12

5. Conclusions These results indicate a protective effect of BA against LPS-induced intestinal mucosal damage and support the notion that dietary supplementation of BA is effective in improving intestinal antioxidant and immune status in broiler at early age. It should be noted, however, that BA supplementation only partially alleviates the LPS-induced alterations in the measured intestinal variables. The higher dose of BA used may be more sufficient to block the adverse effects of LPS. Conflict of interest The authors have declared that no conflict of interest exists. Acknowledgments This work was supported by grants from the National Science-Technology Support Plan Projects of China (No. 2013BAD10B02-03). The funder had no role in the design, analysis, or writing of this article. The authors thank their laboratory colleagues for their assistance. References AOAC International, 2005. Official Methods of Analysis, 18th ed. AOAC International, Washington, DC. Ahmed, S.T., Islam, M.M., Mun, H.S., Sim, H.J., Kim, Y.J., Yang, C.J., 2014. Effects of Bacillus amyloliquefaciens as a probiotic strain on growth performance, cecal microflora, and fecal noxious gas emissions of broiler chickens. Poult. Sci. 93, 1–9. An, B.K., Cho, B.L., You, S.J., Paik, H.D., Chang, H.I., Kim, S.W., Yun, C.W., Kang, C.W., 2008. Growth performance and antibody response of broiler chicks fed yeast derived ␤-glucan and single-strain probiotics. Asian-Australas. J. Anim. Sci. 21, 1027–1032. Baert, K., Duchateau, L., Boever, S.D., Cherlet, M., Backer, P.D., 2005. Antipyretic effect of oral sodium salicylate after an intravenous E. coli LPS injection in broiler chickens. Br. Poult. Sci. 46, 137–143. Brzek, P., Konarzewski, M., 2007. Relationship between avian growth rate and immune response depends on food availability. J. Exp. Biol. 210, 2361–2367. Calcinaro, F., Dionisi, S., Marinaro, M., Candeloro, P., Bonato, V., Marzotti, S., Corneli, R.B., Ferretti, E., Gulino, A., Grasso, F., Simone, C.D., Mario, U.D., Falorni, A., Boirivant, D.F., 2005. Oral probiotic administration induces interleukin-10 production and prevents spontaneous autoimmune diabetes in the non-obese diabetic mouse. Diabetologia 48, 1565–1575. Chateau, N., Castellanos, I., Deschamps, A.M., 1993. Distribution of pathogen inhibition in the Lactobacillus isolates of a commercial probiotic consortium. J. Appl. Bacteriol. 74, 36–40. Dalloul, R.A., Lillehoj, H.S., Shellem, T.A., Doerr, J.A., 2003. Enhanced mucosal immunity against Eimeria acervulina in broilers fed a Lactobacillus-based probiotics. Poult. Sci. 82, 62–66. Deniz, M., Cetinel, S., Kurtel, H., 2004. Blood flow alterations in TNBS-induced colitis: role of endothelin receptors. Inflamm. Res. 53, 329–336. Eun, B.S., Lee, Y.G., Kim, B.H., Shen, T., Lee, S.Y., Park, H.J., Park, S.C., Rhee, M.H., Cho, J.Y., 2008. Surfactin blocks NO production in lipopolysaccharide-activated macrophages by inhibiting NF-kappaB activation. J. Microbiol. Biotechnol. 18, 1984–1989. Fuller, R., 1989. Probiotics in man and animal. J. Appl. Bacteriol. 66, 365–378. Gao, Z., Zhao, X., Yang, T., Shan, J., Shang, L., Mai, H., Qi, G., 2014. Immunomodulation therapy of diabetes by oral administration of a surfactin lipopeptide in NOD mice. Vaccine 32, 6812–6819. Gu, L., Li, N., Gong, J., Li, Q., Zhu, W., Li, J., 2011. Berberine ameliorates intestinal epithelial tight-junction damage and down-regulates myosin light chain kinase pathways in a mouse model of endotoxinemia. J. Infect. Dis. 203, 1602–1612. Hairul Islam, V.I., Praksh Babu, N., Pnadikumar, P., Ignacimuthu, S., 2011. Isolation and characterization of putative probiotic bacteria strain, Bacillus amyloliquefaciens, from North East Himalayan Soil based on in vitro and in vivo functional properties. Probiotics Antimicrob. Prot. 3, 175–185. Herzner, A.M., Dischinger, J., Szekat, C., Josten, M., Schmitz, S., Yakeleba, A., Reinartz, R., Jansen, A., Sahl, H.G., Piel, J., Bierbaum, G., 2011. Expression of the lantibiotic mersacidin in Bacillus amyloliquefaciens FZB42. PLoS ONE 6, e22389. Higgins, S.E., Higgins, J.P., Wolfenden, A.D., Henderson, S.N., Torres-Rodriguez, A., Tellez, G., Hargis, B., 2008. Evaluation of a Lactobacillus-based probiotic culture for the reduction of Salmonella enteritidis in neonatal broiler chicks. Poult. Sci. 87, 27–31. Hill, C., Guarner, F., Reid, G., Gibson, G.R., Merenstein, D.J., Pot, B., Morelli, L., Canani, R.B., Flint, H.J., Salminen, S., Calder, P.C., Sanders, M.E., 2014. Expert consensus document. The International Scientific Association for Probiotics and Prebiotics consensus statement on the scope and appropriate use of the term probiotic. Nat. Rev. Gastroenterol. Hepatol. 11, 506–514. Hosoda, N., Nishi, M., Nakagawa, M., Hiramatsu, Y., Hioki, K., Yamamoto, M., 1989. Structural and functional alterations in the gut of parenterally or enterally fed rats. J. Surg. Res. 47, 129–133. Hu, X., Guo, Y., Li, J., Yan, G., Bun, S., Huang, B., 2011. Effects of an early lipopolysaccharide challenge on growth and small intestinal structure and function of broiler chickens. Can. J. Anim. Sci. 91, 379–384. Hwang, Y.H., Park, B.K., Lim, J.H., Kim, M.S., Park, S.C., Hwang, M.H., Yun, H.I., 2007. Lipopolysaccharide-binding and neutralizing activities of surfactin C in experimental models of septic shock. Eur. J. Pharmacol. 556, 166–171. Jenkins, J.K., Malyak, M., Arend, W.P., 1994. The effects of interleukin-10 on interleukin-1 receptor antagonist and interleukin-1 beta production in human monocytes and neutrophils. Lymphokine Cytokine Res. 13, 47–54. Kishk, Y.F.M., Al-Sayed, H.M.A., 2007. Free-radical scavenging and antioxidative activities of some polysaccharides in emulsions. LWT Food. Sci. Technol. 40, 270–277. Kodali, V.P., Sen, R., 2008. Antioxidant and free radical scavenging activities of an exopolysaccharide from a probiotic bacterium. Biotechnol. J. 3, 245–251. Lei, X.J., Ru, Y.J., Zhang, H.F., 2014. Effect of Bacillus amyloliquefaciens-based direct-fed microbials and antibiotic on performance, nutrient digestibility, cecal microflora, and intestinal morphology in broiler chickens. Appl. Poult. Res. 23, 486–493. Li, J.Y., Lu, Y., Hu, S., Sun, D., Yao, Y.M., 2002. Preventive effect of glutamine on intestinal barrier dysfunction induced by severe trauma. World J. Gastroenterol. 8, 168–171. Lisboa, M.P., Bonatto, D., Bizani, D., Henriques, J.A., Brandelli, A., 2006. Characterization of a bacteriocin like substance produced by Bacillus amyloliquifaciens isolated from the Brazilian Atlantic forest. Int. Microbiol. 9, 111–118. Liu, Y., Huang, J., Hou, Y., Zhu, H., Zhao, S., Ding, B., Yin, Y., Yi, G., Shi, J., Fan, W., 2008. Dietary arginine supplementation alleviates intestinal mucosal disruption induced by Escherichia coli lipopolysaccharide in weaned pigs. Br. J. Nutr. 100, 552–560. Liu, L., Shen, J., Zhao, C., Wang, X., Yao, J., Gong, Y., Yang, X., 2015. Dietary Astragalus polysaccharide alleviated immunological stress in broilers exposed to lipopolysaccharide. Int. J. Biol. Macromol. 72, 624–632. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods 25, 402–408.

Please cite this article in press as: Li, Y., et al., Bacillus amyloliquefaciens supplementation alleviates immunological stress and intestinal damage in lipopolysaccharide-challenged broilers. Anim. Feed Sci. Tech. (2015), http://dx.doi.org/10.1016/j.anifeedsci.2015.07.001

G Model ANIFEE-13324; No. of Pages 13

ARTICLE IN PRESS Y. Li et al. / Animal Feed Science and Technology xxx (2015) xxx–xxx

13

Luo, H., Guo, P., Zhou, Q., 2012. Role of TLR4/NF-kappaB in damage to intestinal mucosa barrier function and bacterial translocation in rats exposed to hypoxia. PLoS ONE 7, e46291. Madara, J.L., Stafford, J., 1989. Interferon-gamma directly affects barrier function of cultured intestinal epithelial monolayers. J. Clin. Invest. 83, 724–727. Mallo, J.J., Gracia, M.I., Honrubia, P., Sedano, G., 2010. Use of a Bacillus amyloliquefaciens probiotic in broiler farms. Poult. Sci. 89, 815. Matsuzaki, T., Nagata, Y., Kado, S., Uchida, K., Kato, I., Hashimoto, S., Yokokura, T., 1997. Prevention of onset in an insulin-dependent diabetes mellitus model, NOD mice, by oral feeding of Lactobacillus casei. APMIS 105, 643–649. Miller, S.I., Ernst, R.K., Bader, M.W., 2005. LPS, TLR4 and infectious disease diversity. Nat. Rev. Microbiol. 3, 36–46. NRC, 1994. Nutrient Requirements of Poultry, 9th revised ed. National Academy Press, Washington, DC. Newton, G.L., Rawat, M., La Clair, J.J., Jothivasan, V.K., Budiarto, T., Hamilton, C.J., Claiborne, A., Helmann, J.D., Fahey, R.C., 2009. Bacillithiol is an antioxidant thiol produced in Bacilli. Nat. Chem. Biol. 5, 625–627. Nicholls, S.J., Hazen, S.L., 2005. Myeloperoxidase and cardiovascular disease. Arterioscler. Thromb. Vasc. Biol. 25, 1102–1111. Ozdemir, D., Uysal, N., Tugyan, K., Gonenc, S., Acikgoz, O., Aksu, I., Ozkan, H., 2007. The effect of melatonin on endotoxemia-induced intestinal apoptosis and oxidative stress in infant rats. Intensive Care Med. 33, 511–516. Rajput, N., Naeem, M., Ali, S., Zhang, J., Zhang, L., Wang, T., 2013. The effect of dietary supplementation with the natural carotenoids curcumin and lutein on broiler pigmentation and immunity. Poult. Sci. 92, 1177–1185. Sen, S., Ingale, S.L., Kim, Y.W., Kim, J.S., Kim, K.H., Lohakare, J.D., Kim, E.K., Kim, H.S., Ryu, M.H., Kwon, I.K., Chae, B.J., 2012. Effect of supplementation of Bacillus subtilis LS 1-2 to broiler diets on growth performance, nutrient retention, caecal microbiology and small intestinal morphology. Res. Vet. Sci. 93, 264–268. Shen, Y.B., Piao, X.S., Kim, S.W., Wang, L., Liu, P., 2010. The effects of berberine on the magnitude of the acute inflammatory response induced by Escherichia coli lipopolysaccharide in broiler chickens. Poult. Sci. 89, 13–19. Song, J., Xiao, K., Ke, Y.L., Jiao, L.F., Hu, C.H., Diao, Q.Y., Shi, B., Zou, X.T., 2014. Effect of a probiotic mixture on intestinal microflora, morphology, and barrier integrity of broilers subjected to heat stress. Poult. Sci. 93, 581–588. SPSS, 2008. Statistical Software Package for the Social Sciences 16.0. Chicago, IL. Stern, N.J., Cox, N.A., Bailey, J.S., Berrang, M.E., Musgrove, M.T., 2001. Comparison of mucosal competitive exclusion and competitive exclusion treatment to reduce Salmonella and Campylobacter spp. colonization in broiler chickens. Poult. Sci. 80, 156–160. Suzuki, T., Yoshinaga, N., Tanabe, S., 2011. Interleukin-6 (IL-6) regulates claudin-2 expression and tight junction permeability in intestinal epithelium. J. Biol. Chem. 286, 31263–31271. Takahashia, K., Ohtaa, N., Akibaa, Y., 1997. Influences of dietary methionine and cysteine on metabolic responses to immunological stress by Escherichia coli lipopolysaccharide injection, and mitogenic response in broiler chickens. Br. J. Nutr. 78, 815–821. Ulyanova, V., Vershinina, V., Ilinskaya, O., 2011. Barnase and binase: twins with distinct fates. FEBS J. 278, 3633–3643. von Boehmer, H., 2005. Mechanisms of suppression by suppressor T cells. Nat. Immunol. 6, 338–344. Wang, Z., Luo, L., 2007. Antioxidant activities of different fractions of polysaccharide purified from Gynostemma pentaphyllum. Carbohydr. Polym. 68, 54–58. Xavier, R.J., Podolsky, D.K., 2007. Unravelling the pathogenesis of inflammatory bowel disease. Nature 448, 427–434. Xie, H., Rath, N.C., Huff, G.R., Huff, W.E., Balog, J.M., 2000. Effects of Salmonella typhimurium lipopolysaccharide on broiler chickens. Poult. Sci. 79, 33–40. Youakim, A., Ahdieh, M., 1999. Interferon-gamma decreases barrier function in T84 cells by reducing ZO-1 levels and disrupting apical actin. Am. J. Physiol. 276, G1279–G1288. Zeissig, S., Burgel, N., Gunzel, D., Richter, J., Mankertz, J., Wahnschaffe, U., Kroesen, A.J., Zeitz, M., Fromm, M., Schulzke, J.D., 2007. Changes in expression and distribution of claudin 2, 5 and 8 lead to discontinuous tight junctions and barrier dysfunction in active Crohn’s disease. Gut 56, 61–72. Zhang, H., Chen, Y.P., Li, Y., Yang, L., Wang, J.J., Wang, T., 2014. Medium-chain TAG attenuate hepatic oxidative damage in intra-uterine growth-retarded weanling piglets by improving the metabolic efficiency of the glutathione redox cycle. Br. J. Nutr. 112, 876–885.

Please cite this article in press as: Li, Y., et al., Bacillus amyloliquefaciens supplementation alleviates immunological stress and intestinal damage in lipopolysaccharide-challenged broilers. Anim. Feed Sci. Tech. (2015), http://dx.doi.org/10.1016/j.anifeedsci.2015.07.001