- Email: [email protected]
BACILLUS | Geobacillus stearothermophilus (Formerly Bacillus stearothermophilus)
Geobacillus stearothermophilus (Formerly Bacillus stearothermophilus) P Kotzekidou, Aristotle University of Thessaloniki, Thessaloniki, Greece Ó 2014 Elsevier Ltd. All rights reserved.
Characteristics of the Species On the basis of 16S rRNA gene sequence analysis, the group 5 of the Bacillus genus has been defined as a phenotypically and phylogenetically coherent group of thermophilic bacilli displaying a high degree of similarity among their 16S rRNA gene sequences (98.5–99.2%). Based on phenotypic and genotypic characteristics, some existing Bacillus species within group 5 were reclassified into the new genus Geobacillus, and the former Bacillus stearothermophilus is now Geobacillus stearothermophilus. For simplicity, all studies previously referring to as B. stearothermophilus are referred to in this article as G. stearothermophilus. Geobacillus stearothermophilus is a thermophilic, aerobic, spore-forming bacterium with ellipsoidal spores that distend the sporangium. It is a heterogeneous species in which the distinguishing features are a maximum growth temperature of 65–75 C, a minimum growth temperature of 40 C, and a limited tolerance to acid. The bacterium does not grow at 37 C; its optimum growth is at 55 C with a fast growth rate (a generation time of w 15–20 min). Starch hydrolysis is typical, although some strains do not hydrolyze starch. Hydrolysis of casein and reduction of nitrate to nitrite are variable. Growth in 5% NaCl is scant. The heterogeneity of the species is indicated by the wide range of DNA base composition as well as the diversity of the phenotypic characters (Table 1). Minimum pH for the growth of G. stearothermophilus is 5.2; the minimum water activity (aw) for growth at optimum temperature is 0.93. Geobacillus stearothermophilus was first isolated from cream-style corn by P.J. Donk in 1917. The bacterium is a common inhabitant of soil, hot springs, desert sand, Arctic waters, ocean sediments, food, and compost. The incidence of G. stearothermophilus in foods is related to the distribution of the microorganism in soil, water, and plants. Foods that have been heated or desiccated generally possess an enriched and varied flora of bacterial spores. Especially, milk contains minerals, such as calcium, magnesium, and so on, which stimulate spore formation of Geobacillus spp. during dairy processes. Some Geobacillus strains are able to sporulate in a laboratory medium (tryptone soya broth supplemented with CaCl2, MnSO4, FeSO4, or MgCl2) with a maximum yield (105–107 spores ml1) in 12–18 h. Geobacillus stearothermophilus is included in the usual microflora of cocoa bean fermentation as well as of cocoa powder. It is the dominant microorganism of beet sugar and is isolated from pasteurized milk, ultrahigh-heat-treated milk, and milk powders. The incidence of G. stearothermophilus spores in canned foods is of particular interest. The spores enter canneries in soil, on raw foods, and in ingredients (e.g., spices, sugar, starch, and flour). The presence of G. stearothermophilus spores in some containers of any given lot of commercially sterile low-acid canned foods may be considered normal. If the food is to be distributed in nontropical regions where temperatures do not exceed about 40 C for significant periods of time, complete eradication of the microorganism is not necessary because it cannot grow at such low ambient temperatures. For tropical conditions, the thermal process must be sufficient to inactivate
Encyclopedia of Food Microbiology, Volume 1
spores of G. stearothermophilus that might otherwise germinate and multiply under these conditions. Geobacillus stearothermophilus is the typical species responsible for thermophilic flat sour spoilage of low-acid canned foods or coffee during storage in automatic vending machines. Spores or vegetative cells of G. stearothermophilus from dairy manufacturing plants attach to stainless steel surfaces and form biofilms. A doubling time of 25 min has been calculated for this organism grown as a biofilm. The formation of biofilms within the plant is the cause of contamination of manufactured dairy products. The importance of thermophilic spoilage organisms in the food industry has generated considerable interest in the factors affecting heat resistance, germination, and survival of their spores. Because it grows at high temperatures, G. stearothermophilus tends to produce heat-resistant spores. The genetic variation, however, in moist as well as dry heat resistance between different strains of G. stearothermophilus is of considerable magnitude (Table 2). The main factors affecting these discrepancies are the composition of the sporulation medium, the sporulation temperature, and the chemical state of the bacterial spore, as well as the heating conditions in terms of the water activity, the pH, and the ionic environment of the heating medium, the presence of organic substances, the composition of the atmosphere, and so on. Under dry conditions G. stearothermophilus spores show the greatest increase in heat resistance (Table 2). At high water activity, the decimal reduction at 100 C (D100-value) of G. stearothermophilus spores is no less than 800 min, and under dry conditions, the D100 is about 1000 min. There is a need for technologies that require short thermal processing times to eliminate bacterial spores in foods. The superheat steam processing and drying system, which has been applied in Asian noodles, potatoes, and potato chips, is effective for the reduction of G. stearothermophilus ATCC 10149 spores. The thermal resistance constant (z-value, i.e., the temperature increase needed for a 10-fold decrease in the D value) calculated for superheated steam-processing temperatures between 130 and 175 C is 25.4 C, which is similar to those reported for conventional steam treatment. In low-acid canned foods, D120 values of 4–5 min and z-values of 14–22 C have been reported. Values of D decrease when the pH is reduced from 7.0 to 4.0. Values of z appear to be higher when the medium is acidified, although the difference is not statistically significant. Organic acids and glucono-deltalactone have the same effect as acidulants in reducing the heat resistance of G. stearothermophilus spores. Sodium chloride reduces heat resistance of G. stearothermophilus when present at relatively low levels (i.e., less than 0.5 mol l1). The increased heat resistance of the spores of a strain of G. stearothermophilus during incomplete rehydration of dried pasta indicates possible implications in regard to food safety, as the reported D121 values range from 4.6 to 6.5 min and the z-values range from 10.7 to 15.6 C, may not be applied for products that are rehydrated during heat treatment. When a dormant heat-resistant spore is activated and germinates to form a vegetative cell, its heat resistance is lost.
http://dx.doi.org/10.1016/B978-0-12-384730-0.00020-3
129
130
BACILLUS j Geobacillus stearothermophilus (Formerly Bacillus stearothermophilus)
Table 1
Differential characteristics of G. stearothermophilus
CharacteristicS
G. stearothermophilus
Morphology Width of rod (mm) Length of rod (mm) Sporangium swollen Spore shape Spore position Motility Acid from: Glucose L-arabinose D-xylose Maltose Hydrolysis of: Starch Casein Gelatin Utilization of citrate Catalase Anaerobic growth Voges–Proskauer reaction Nitrate reduction Growth in NaCl: 5% 7% Maximum growth temperature ( C) Minimum growth temperature ( C) pH range Gas from glucose
Rods 0.6–1 2–3.5 þ Ellipsoidal Terminal þ þ þ þ þ – – – 65–75 40 6.0–8.0 –
Spores frozen at 18 C or freeze dried exhibit a loss in viability and heat resistance. Heating of spores at sublethal temperatures can result in enhanced heat resistance. Activation of dormant spores by sublethal heating breaks dormancy and increases the ability of spores to germinate and grow under favorable conditions. Heat-shocked spores of G. stearothermophilus ATCC 7953 that are activated become permeabilized at the outer membrane and become susceptible to lysozyme. When G. stearothermophilus spores are plated on conventional media without prior heat shock, commonly less than 10% of the total number of spores
Table 2
Moist and dry heat resistance of G. stearothermophilus spores
Strain of G. stearothermophilus
Investigated temperature range ( C)
NCIB 8923 NCIB 8919 NCIB 8924 ATCC 7953 ATCC 7953 ATCC 7953
115–130 115–130 115–130 111–125 100–130 Up to 132 (continuous heating system) 110–120 150–170 100–160 150–180
ATCC 7953 ATCC 7953 NCA 1518 NCTC 10339
germinate; after heat activation, 50% germination occurs; and after treatment with 0.5 mol l1 hydrochloric acid, almost 100% germination results. Spores produced at 65 C are optimally activated after holding at 30 C for 6 h, resulting in increased frequency of spore germination. Sublethal heating at 80 C for 10 min may induce dormancy in some strains of G. stearothermophilus rather than activation. Optimum germination of spores is a function of temperature, time, pH, and suspending medium. After heat treatment, maximum recovery of G. stearothermophilus spores is obtained at pH 7.0 and decreases as pH falls. Phosphates in the recovery medium result in a progressive decrease in spore recovery, whereas starch improves recovery. Spores of G. stearothermophilus are used as biological indicators for verifying exposure of a product to a sterilizing process. For monitoring steam sterilization, endospores of G. stearothermophilus (strains NCTC 10007, NCIB 8157, ATCC 7953) are in current use, particularly for processes performed at 121 C or higher. Biological indicators are available commercially, either as suspensions for inoculating test pieces, or on already inoculated carriers such as filter paper, glass, or plastic. After exposure to the sterilization process, the biological indicators are cultured in appropriate media incubated under suitable conditions. Immobilized G. stearothermophilus spores are used to monitor the efficacy of a sterilization process, particularly to measure sterilizing values in aseptic processing technologies for viscous liquid foods containing particulates; they can also be used to monitor in-pack sterilization efficacy. The main immobilization matrices are alginate beads or cubes mixed with puréed potatoes, peas or meat, and polyacrylamid gel spheres. Particle dimensions vary between 0.16 and 0.5 cm. The estimated z-values for immobilized G. stearothermophilus spores were 8.5–11.8 C. Geobacillus stearothermophilus produces a wide range of enzymes, many of which are of industrial significance (Table 3). Some of them are extracellular, enabling simple recovery from fermentation broths. The microorganism presents a number of advantages for the isolation of intracellular enzymes because its cell yield is generally good. A 400 l fermentation of G. stearothermophilus NCA 1503 yields 5–8 kg of wet cell paste, equivalent to 15 g l1. The majority of enzymes produced are intrinsically thermostable, and this
Heating in phosphate buffer (pH 7) or in Ringer’s solution (pH 7.1) or in water
D-value (min)
z-value ( C)
D120 5.8 D120 5.3 D120 1.0 D121 2.1 D121 0.7 D121 0.12
13.0 11.0 8.9 8.5 13.0 13.0
D118 10.0
5.7
Dry heat D-value (min)
z-value ( C)
D160 0.08 D160 3.2–27.0 D160 0.16
19 14–22 26–29
BACILLUS j Geobacillus stearothermophilus (Formerly Bacillus stearothermophilus) Table 3
131
Enzymes produced by Geobacillus stearothermophilus
Strain of G. stearothermophilus Enzyme
Temperature optimum ( C)
pH optimum
Thermal stability retained
NCIB 8924 KP 1236
Neutral protease Neutral protease
50 80
– 7.5
503-4
a-Amylase
55–70
4.6–5.1
ATCC 12980 KP 1064
a-Amylase Pullulanase
80 60–75
5.5 6.0
100% at 65–70 C 100% at 80 C for 10 min 100% at 60 C for 18 h 100% at 70 C for 24 h 71% at 85 C for 20 h 95% at 70 C for 2 h
KP 1006
a-Glucosidase
60
6.5
All strains
Cyclodextrin glycosyltransferase Glucose isomerase
60
–
55
–
H-165 NCIB 11270 NCIB 11270 ATCC 12980
Lipase Glycerokinase Glucokinase Leucine dehydrogenase
75 – – –
5.0 – – –
98
Gellan lyase
70
5.0–8.0
US100
L-Arabinose
80
7.5
isomerase
enhanced stability is exhibited against the action of other protein denaturants, such as detergents and organic solvents. The thermostable enzymes that have found commercial application are essentially intracellular enzymes. Glycerokinase produced from G. stearothermophilus NCA 1503 is used as a clinical diagnostic for the assay of serum triacylglycerols. The same strain cloned into Escherichia coli produces lactate dehydrogenase, which is used in a clinical diagnostic kit for the assay of glutamate pyruvate transaminase and glutamate oxaloacetate transaminase. Other diagnostic enzymes produced by G. stearothermophilus NCA 1503, including phosphofructokinase, phosphoglycerate kinase, and glucose phosphate isomerase, have been used as components of clinical diagnostic assay kits. The strain also produces restriction enzymes for molecular biology, while another strain of G. stearothermophilus isolated in China produces thermostable DNA polymerase, which is used in polymerase chain reaction and DNA sequencing.
Methods of Detection Geobacillus stearothermophilus possesses greater heat resistance than most other organisms commonly present in foods. This characteristic is advantageous to the examination of foods and ingredients because by controlled heat treatment of samples it is possible to eliminate all organisms except the spores of heat-resistant microorganisms. Further, heat shock or activation
100% at 60 C for 30 min
100% at 80 C for 30 min 50% at 70 C for 5 h
100% at 70 C for 2.5 h 100% at 60 C for 24 h
Application Detergent and leather industry; food industry in beer and bakery products Hydrolyses a-1,4 glucosidic linkages in amylose and amylopectin Splits a-1,6 glucosidase linkages in pullulan to maltotriose Hydrolyses a-1,4 or a-1,6 linkages in short-chain saccharides Produces from starch nonreducing cyclodextrins Production of fructose syrups Assay of monoacylglycerols Assay of serum triacylglycerols Assay of creatine kinase Assay of leucine aminopeptidase Gelling agent, thickener, or stabilizer in food and pharmaceutical industries and cosmetics Safe low-calorie sweetener in food products
is necessary to induce germination of the maximum number of spores. In a standard procedure, heat treatment at 100 C for 30 min or at 106 C for 30 min (for heat-resistant spores in milk powder) followed by rapid cooling should be done. Aerobic thermophilic spore formers can be encountered in heat-shocked samples using dextrose tryptone agar after incubation at 55 C for 48 h. Dehydration of the plates during incubation is minimized by placing the plates in oxygenpermeable bags. Geobacillus stearothermophilus should be grown preferably in nutrient media supplemented with calcium and iron, as well as with manganese sulfate to promote sporulation (i.e., nutrient agar supplemented per liter with 3 mg of manganese sulfate as well as the following sterile solutions: 10 ml D-glucose 20% w/v, 0.8 ml CaCl2 5% w/v, and 0.8 ml FeCl2 5% w/v). When investigating the incidence of process-resistant spores (i.e., spores that will survive the heat treatment of low-acid canned foods that is generally accepted as adequate for elimination of Clostridium botulinum spores) in ingredients such as dry sugar, starch, flour, or spices, it is convenient to heat suitable portions of the commodities, suspended in brain–heart infusion broth with 1% added starch (pH 7), in a pressure cooker for 4 min at 120 C, followed by rapid cooling. The presence of any surviving thermophilic aerobic spore formers is demonstrated by incubating the heated samples at 50 C under aerobic conditions. Samples other than finished products must be handled so that there will be no opportunities for spore germination or
132
BACILLUS j Geobacillus stearothermophilus (Formerly Bacillus stearothermophilus)
spore production between the collection of the samples and the start of examination procedures. Geobacillus stearothermophilus includes Gram-positive rods with terminal or subterminal spores, which swell the sporangium. It is difficult to identify because of the close relationship between it and other aerobic spore-forming thermophiles. Confirmation of G. stearothermophilus requires completion of a number of tests as indicated in Table 1. The bacterium does not grow under anaerobic conditions and is negative on Voges– Proskauer test. Some strains grow in medium containing up to 5% salt. The distinguishing feature of G. stearothermophilus compared with other aerobic, thermophilic spore formers was formerly considered to be starch hydrolysis; however, the isolation of strains unable to hydrolyze starch has restricted the distinguishing features to the temperature growth range and the limited tolerance to acid. Additional tests to confirm G. stearothermophilus are presented on Table 1. The incorporation of the majority of the tests indicated in Table 1 into the wells of a microtiter plate facilitates the application of the identification scheme. This miniaturized procedure saves a considerable amount of time in operation, effort in manipulation, materials, labor, and space. Another approach to the identification of Geobacillus strains that is currently used is based on the API 50CHB identification system (BioMérieux). These highly standardized, commercially available materials eliminate the problems of interlaboratory variation in media and improve test reproducibility. The biochemical tests that have been used traditionally to identify G. stearothermophilus are time consuming, can be difficult to interpret, and do not have the taxonomic resolution required for the thermophilic bacteria. In addition to the morphological and physiological characterization presented on Table 1, the cellular fatty acid profiling in case of G. stearothermophilus indicates that the sum of iso-15:0, iso-16:0, and iso-17:0 fatty acids makes up more than 60% of the total fatty acids. Polymerase chain reaction (PCR)-based identification techniques are used for identifying and typing Geobacillus species that include random amplified polymorphic DNA, restriction fragment-length polymorphism, 16S-23S internal spacer region profiling, and gene sequence analysis of various genes, such as gyrB, recA, rpoB, spo0A, and recN. Geobacillus stearothermophilus is indistinguishable using 16S rDNA sequence analysis and multilocus sequence analysis is applied for efficient and convenient determination of Geobacillus species (Table 4). Classical genotyping techniques based on sequence variability of single or multilocus PCR-amplified genes often lack
Table 4 Target gene recA rpoB spo0A
discriminative power at the level of individual isolates within the same species or need laborious and extensive sequencing labor. Microarray-based comparative genome hybridization is a powerful tool providing high-resolution discrimination at the level of individual isolates from a single species and allowing rapid and cost-effective typing of thermophilic bacilli in a wide variety of food products. Microbiological test results obtained by standard test methods concerning the enumeration of thermophilic bacteria in milk powders are of limited value in feeding useful data to the manufacturer. Milk powder must be stored until the samples are analyzed and the results reported (i.e., for 5 days or more) and only then it can be released to the consumer. Rapid assays giving results that are close to real time are of great use to monitor manufacturing processes and provide confidence in the manufacturing process. The BactiFlowÔ (Chemunex SA, France) uses bacterial esterase activity to label viable cells for flow cytometry, and using this system, a rapid test to count thermophilic bacteria in milk powder (with a lower limit of detection of 103 cfu g1) has been developed, which gives results within 1–2 h.
Regulations The presence of G. stearothermophilus spores in ingredients for foods other than thermally processed low-acid foods is probably of no significance provided those foods are not held within the thermophilic growth range for many hours. This microorganism has no public health significance. The National Food Processors Association (NFPA) standard for the total thermophilic spore count in sugar or starch specifies that for the five samples examined, there shall be a maximum of not more than 150 spores and an average of not more than 125 spores per 10 g of sugar (or starch). The sugar and starch standard may be used as a guide to evaluate other ingredients, keeping in mind the proportion of the other ingredients in the finished product relative to the quantity of sugar or starch used. For canners, the NFPA standards for thermophilic flat sour spores (typical species is G. stearothermophilus) in sugar or starch specify that for the five samples examined, there should be a maximum of not more than 75 spores and an average of not more than 50 spores per 10 g of sugar (or starch). The typical number of thermophilic bacilli in raw milk, usually as spores, is in the range of 50 cfu ml1. During
PCR methods used for identification of Geobacillus spp. Primer sequence (5 0 – 3 0 ) F: ATTAGGTGTCGGCGGTTAT R: CCAT(G/A)TCATTGCCTTG(T/C)TT(A/G) F: TTGACAGGCCGACTAGTTCA R: CGCGTCGGTATGGTGTTTCAAT Fa: ATYATGYTVACRGCVTTYGGBCARGAAGA Ra: TAKCCTTTWATRTGIGCDGGIACRCCGATTTC
Tested food
Detection limit
Specificity G. stearothermophilus G. stearothermophilus
Milk powder
Vegetative cells: 800 cfu g1 Spores: 6400 spores g1
Geobacillus, Bacillus, Anoxybacillus
Nucleotide substitution according to the universal degenerate code: R ¼ (A/G), W ¼ (A/T), Y ¼ (C/T), K ¼ (G/T), V ¼ (A/G/C), B ¼ (T/C/G), D ¼ (A/G/T), and I ¼ (A/G/C/T).
a
BACILLUS j Geobacillus stearothermophilus (Formerly Bacillus stearothermophilus) processing, the raw milk is concentrated approximately 10-fold to form a powder, so the expected number of thermophilic bacilli is 500 cfu g1, provided that no significant growth occurred within the processing lines. A common specification limit for viable plate counts for thermophiles in milk powder is 105 cfu g1. Typically, milk powder is produced continuously over an 18–24 h processing period. With increased processing time, the number of thermophiles increases until specification limits are reached and the process run is terminated to prevent product downgrading.
Importance to the Food Industry Geobacillus stearothermophilus is a potential contaminant in a variety of industries where elevated temperatures (40–65 C) prevail during the manufacturing process or during product storage, such as canning, juice pasteurization, sugar refining, gelatine production, dehydrated vegetable manufacture, and dairy product manufacture. In dairy processes, the microorganism is an issue in products such as milk powder, pasteurized milk, buttermilk, and whey. Geobacillus stearothermophilus accounts for up to 65% of the thermophilic strains derived from milk powders, because the spores are able to survive the low water activity and high temperature of the drying process, the cleaning-in-place system, and the long-term storage of the final product. In addition, G. stearothermophilus produces heat-stable proteinases and lipases that survive the heat treatments applied during commercial milk powder manufacture. The enzymes remain active in milk powder during storage and would be active in milk products made from recombined milk powder. Geobacillus stearothermophilus is the typical species responsible for the thermophilic flat sour spoilage of low-acid canned foods. It ferments carbohydrates with the production of short-chain fatty acids that sour the product. Spoilage does not result in gas production and hence there is no swelling of the cans, so the ends of the container remain flat. The species is responsible for the spoilage of low-acid foods, such as canned peas, beans, corn, and asparagus, when they are maintained at a temperature above 43 C for an extended period or when cooling is carried out very slowly, if the food contains viable spores capable of germinating and growing in the product. Because flat sour spoilage does not develop unless the product is at high temperature, proper cooling after thermal processing and avoiding high temperatures during warehouse storage or distribution are essential. Spores of G. stearothermophilus enter canneries in soil, on raw foods, and in ingredients, and their population may increase at any point at which a suitable environment exists. For example, equipment – such as holding tank blanchers and warm filler bowls – may serve as a focal point for the build-up of an excessive population. The spores show exceptional resistance to destruction by heat and chemicals and therefore are difficult to eliminate in a product or in the plant. To minimize spore contamination, control of spore population in ingredients and products entering the plant, as well as the use of sound plant sanitation practices, are suggested. The application of bacteriocins as part of hurdle technology can contribute to control thermophilic spoilage in low-acid canned vegetables (corn, peas, okra, and mushrooms), when the cans are stored under warm conditions for prolonged
133
periods or to allow a reduction in heat processing without the risk of thermophilic spoilage occurring. Nisin, a polypeptide consisting of 34 amino acids, has received generally recognized as safe (GRAS) status in 1988. It is perceived to be a natural preservative and can be applied to inhibit thermophilic bacteria in canned vegetables. Enterocin AS-48, a broad spectrum cyclic antimicrobial peptide, is active against G. stearothermophilus vegetative cells and endospores in different types of canned fruit juice and vegetable foods during storage under temperature abuse conditions. An enzyme, the hen egg white lysozyme, stable at 100 C for 30 min at pH 5.3, is classified as GRAS in the United States and is approved for use in some foods. Lysozyme in heat treatment processes reduces the heat resistance of G. stearothermophilus. Dormant G. stearothermophilus spores are of no concern in commercially sterile canned foods destined for storage and distribution where temperatures will not exceed 43 C. However, canned foods in tropical locales and those intended for hot-vend service must not contain thermophilic spores capable of germination and outgrowth in the product to be considered commercially sterile. Traditional thermal processing methods cause loss of desirable properties related to texture, flavor, color, and nutrient value of foods. The most serious commercial problems with product sterility are caused by thermally resistant spores. On the other hand, consumers demand high-quality foods that are free of additives, fresh tasting, and microbiologically safe and that have an extended shelf life. The following food technologies meet these consumer demands and their effect on inactivation of G. stearothermophilus spores is briefly discussed. High-pressure processing can inactivate the vegetative form of many microorganisms; however, spores can be resistant to pressures as high as 1000 MPa. Pressure-assisted thermal sterilization process, when applied at six 5-min cycles at 600 MPa and 70 C to reduce or destroy G. stearothermophilus spores, resulted in the destruction of 106 spores ml1, whereas by static application, 800 MPa, and 60 C for 60 min, spores were reduced to 102 ml1. High-pressure CO2 treatment at 95 C and 30 MPa pressure for 120 min causes 5-log-cycle inactivation of spores of G. stearothermophilus, whereas sodium chloride and glucose have a protective effect and the level of inactivation is reduced. The heat resistance of G. stearothermophilus spores is reduced by ultrasonic treatment, as the ultrasonic treatment affects the release of calcium, dipicolinic acid, fatty acids, and other low-molecular-weight components. Using hydrogen peroxide as a sterilant for foodcontact surfaces of olefin polymers and polyethylene in aseptic packaging systems, the D25 value of G. stearothermophilus spores is 1.5 min when the concentration of H2O2 is 26%. Geobacillus stearothermophilus spores are among the most radiation resistant spore formers. Geobacillus stearothermophilus forms biofilms on the surfaces of processing equipment in sections of dairy manufacturing plants at elevated temperatures of 40–65 C – that is, preheating and evaporation sections of milk powder plants, plate heat exchangers used during the pasteurization process, centrifugal separators (used to separate cream from whole milk) operated at warm temperatures, recycle loops in butter manufacturing plants, cream heaters in anhydrous milk fat plants, and ultrafiltration plants operated at warm temperatures. Extensive biofilm formation occurs when production
134
BACILLUS j Geobacillus stearothermophilus (Formerly Bacillus stearothermophilus)
cycles are too long, the manufacturing equipment is not cleaned properly between production cycles, recycle loops are used, and contaminated ingredients or by-products are used. The prevention of biofilms focuses on altering the manufacturing conditions (such as temperature), manipulating the surface of stainless steel to reduce bacterial attachment, and developing novel sanitizers.
numbers reach >106 cfu g1, there is potential for enzymatic deterioration of the product, resulting in changes in its composition and organoleptic properties. Inadequate cooling subsequent to thermal processing is a major contributor to spoilage by G. stearothermophilus. Localized warming of sections of stacks of heat-processed foods placed too close to heating appliances is also of importance.
Importance to the Consumer
Further Reading
The prolonged heating necessary to destroy all G. stearothermophilus spores causing spoilage to low-acid canned foods would impair taste, texture, and appearance and lead to loss of nutritional value. It is therefore necessary to store canned foods at temperatures below the minimum required for growth of this microorganism. The incidence of G. stearothermophilus spores in heat-processed foods may affect the commercial life of the product without presenting a hazard for public health. The bacterium, however, can be an indicator organism for assessing the overall hygiene of the manufacturing process. High numbers of thermophilic spore-forming bacteria (>104 cfu g1) in milk powder indicate poor manufacturing practices, and when
Burgess, S.A., Lindsay, D., Flint, S.H., 2010. Thermophilic bacilli and their importance in dairy processing. International Journal of Food Microbiology 144, 215–225. Claus, D., Berkeley, R.C.W., 1986. Genus Geobacillus Colin 1872, 174. In: Sneath, P.H.A., Mair, N.S., Sharpe, M.E., Holt, J.G. (Eds.), Bergey’s Manual of Systematic Bacteriology, vol. 2. Williams and Wilkins, Baltimore, pp. 1043–1071. Nazina, T.N., Tourova, T.P., Poltaraus, A.B., et al., 2001. Taxonomic study of aerobic thermophilic bacilli: descriptions of Geobacillus subterraneous gen. nov., sp. nov. and Geobacillus uzenensis sp. nov. from petroleum reservoirs and transfer of Bacillus stearothermophilus, Bacillus thermocatenulatus, Bacillus thermoleovorans, Bacillus kaustophilus, Bacillus thermoglucosidasius and Bacillus thermodenitrificans to Geobacillus as the new combinations G. stearothermophilus, G. thermocatenulatus, G. thermoleovorans, G. kaustophilus, G. thermoglucosidasius and G. thermodenitrificans. International Journal of Systematic and Evolutionary Microbiology 51, 433–446. Sharp, R.J., Riley, P.W., White, D., 1992. Heterotrophic thermophilic Bacilli. In: Kristjansson, J.K. (Ed.), Thermophilic Bacteria. CRC Press, Boca Raton, pp. 19–50.
Characteristics of the Species On the basis of 16S rRNA gene sequence analysis, the group 5 of the Bacillus genus has been defined as a phenotypically and phylogenetically coherent group of thermophilic bacilli displaying a high degree of similarity among their 16S rRNA gene sequences (98.5–99.2%). Based on phenotypic and genotypic characteristics, some existing Bacillus species within group 5 were reclassified into the new genus Geobacillus, and the former Bacillus stearothermophilus is now Geobacillus stearothermophilus. For simplicity, all studies previously referring to as B. stearothermophilus are referred to in this article as G. stearothermophilus. Geobacillus stearothermophilus is a thermophilic, aerobic, spore-forming bacterium with ellipsoidal spores that distend the sporangium. It is a heterogeneous species in which the distinguishing features are a maximum growth temperature of 65–75 C, a minimum growth temperature of 40 C, and a limited tolerance to acid. The bacterium does not grow at 37 C; its optimum growth is at 55 C with a fast growth rate (a generation time of w 15–20 min). Starch hydrolysis is typical, although some strains do not hydrolyze starch. Hydrolysis of casein and reduction of nitrate to nitrite are variable. Growth in 5% NaCl is scant. The heterogeneity of the species is indicated by the wide range of DNA base composition as well as the diversity of the phenotypic characters (Table 1). Minimum pH for the growth of G. stearothermophilus is 5.2; the minimum water activity (aw) for growth at optimum temperature is 0.93. Geobacillus stearothermophilus was first isolated from cream-style corn by P.J. Donk in 1917. The bacterium is a common inhabitant of soil, hot springs, desert sand, Arctic waters, ocean sediments, food, and compost. The incidence of G. stearothermophilus in foods is related to the distribution of the microorganism in soil, water, and plants. Foods that have been heated or desiccated generally possess an enriched and varied flora of bacterial spores. Especially, milk contains minerals, such as calcium, magnesium, and so on, which stimulate spore formation of Geobacillus spp. during dairy processes. Some Geobacillus strains are able to sporulate in a laboratory medium (tryptone soya broth supplemented with CaCl2, MnSO4, FeSO4, or MgCl2) with a maximum yield (105–107 spores ml1) in 12–18 h. Geobacillus stearothermophilus is included in the usual microflora of cocoa bean fermentation as well as of cocoa powder. It is the dominant microorganism of beet sugar and is isolated from pasteurized milk, ultrahigh-heat-treated milk, and milk powders. The incidence of G. stearothermophilus spores in canned foods is of particular interest. The spores enter canneries in soil, on raw foods, and in ingredients (e.g., spices, sugar, starch, and flour). The presence of G. stearothermophilus spores in some containers of any given lot of commercially sterile low-acid canned foods may be considered normal. If the food is to be distributed in nontropical regions where temperatures do not exceed about 40 C for significant periods of time, complete eradication of the microorganism is not necessary because it cannot grow at such low ambient temperatures. For tropical conditions, the thermal process must be sufficient to inactivate
Encyclopedia of Food Microbiology, Volume 1
spores of G. stearothermophilus that might otherwise germinate and multiply under these conditions. Geobacillus stearothermophilus is the typical species responsible for thermophilic flat sour spoilage of low-acid canned foods or coffee during storage in automatic vending machines. Spores or vegetative cells of G. stearothermophilus from dairy manufacturing plants attach to stainless steel surfaces and form biofilms. A doubling time of 25 min has been calculated for this organism grown as a biofilm. The formation of biofilms within the plant is the cause of contamination of manufactured dairy products. The importance of thermophilic spoilage organisms in the food industry has generated considerable interest in the factors affecting heat resistance, germination, and survival of their spores. Because it grows at high temperatures, G. stearothermophilus tends to produce heat-resistant spores. The genetic variation, however, in moist as well as dry heat resistance between different strains of G. stearothermophilus is of considerable magnitude (Table 2). The main factors affecting these discrepancies are the composition of the sporulation medium, the sporulation temperature, and the chemical state of the bacterial spore, as well as the heating conditions in terms of the water activity, the pH, and the ionic environment of the heating medium, the presence of organic substances, the composition of the atmosphere, and so on. Under dry conditions G. stearothermophilus spores show the greatest increase in heat resistance (Table 2). At high water activity, the decimal reduction at 100 C (D100-value) of G. stearothermophilus spores is no less than 800 min, and under dry conditions, the D100 is about 1000 min. There is a need for technologies that require short thermal processing times to eliminate bacterial spores in foods. The superheat steam processing and drying system, which has been applied in Asian noodles, potatoes, and potato chips, is effective for the reduction of G. stearothermophilus ATCC 10149 spores. The thermal resistance constant (z-value, i.e., the temperature increase needed for a 10-fold decrease in the D value) calculated for superheated steam-processing temperatures between 130 and 175 C is 25.4 C, which is similar to those reported for conventional steam treatment. In low-acid canned foods, D120 values of 4–5 min and z-values of 14–22 C have been reported. Values of D decrease when the pH is reduced from 7.0 to 4.0. Values of z appear to be higher when the medium is acidified, although the difference is not statistically significant. Organic acids and glucono-deltalactone have the same effect as acidulants in reducing the heat resistance of G. stearothermophilus spores. Sodium chloride reduces heat resistance of G. stearothermophilus when present at relatively low levels (i.e., less than 0.5 mol l1). The increased heat resistance of the spores of a strain of G. stearothermophilus during incomplete rehydration of dried pasta indicates possible implications in regard to food safety, as the reported D121 values range from 4.6 to 6.5 min and the z-values range from 10.7 to 15.6 C, may not be applied for products that are rehydrated during heat treatment. When a dormant heat-resistant spore is activated and germinates to form a vegetative cell, its heat resistance is lost.
http://dx.doi.org/10.1016/B978-0-12-384730-0.00020-3
129
130
BACILLUS j Geobacillus stearothermophilus (Formerly Bacillus stearothermophilus)
Table 1
Differential characteristics of G. stearothermophilus
CharacteristicS
G. stearothermophilus
Morphology Width of rod (mm) Length of rod (mm) Sporangium swollen Spore shape Spore position Motility Acid from: Glucose L-arabinose D-xylose Maltose Hydrolysis of: Starch Casein Gelatin Utilization of citrate Catalase Anaerobic growth Voges–Proskauer reaction Nitrate reduction Growth in NaCl: 5% 7% Maximum growth temperature ( C) Minimum growth temperature ( C) pH range Gas from glucose
Rods 0.6–1 2–3.5 þ Ellipsoidal Terminal þ þ þ þ þ – – – 65–75 40 6.0–8.0 –
Spores frozen at 18 C or freeze dried exhibit a loss in viability and heat resistance. Heating of spores at sublethal temperatures can result in enhanced heat resistance. Activation of dormant spores by sublethal heating breaks dormancy and increases the ability of spores to germinate and grow under favorable conditions. Heat-shocked spores of G. stearothermophilus ATCC 7953 that are activated become permeabilized at the outer membrane and become susceptible to lysozyme. When G. stearothermophilus spores are plated on conventional media without prior heat shock, commonly less than 10% of the total number of spores
Table 2
Moist and dry heat resistance of G. stearothermophilus spores
Strain of G. stearothermophilus
Investigated temperature range ( C)
NCIB 8923 NCIB 8919 NCIB 8924 ATCC 7953 ATCC 7953 ATCC 7953
115–130 115–130 115–130 111–125 100–130 Up to 132 (continuous heating system) 110–120 150–170 100–160 150–180
ATCC 7953 ATCC 7953 NCA 1518 NCTC 10339
germinate; after heat activation, 50% germination occurs; and after treatment with 0.5 mol l1 hydrochloric acid, almost 100% germination results. Spores produced at 65 C are optimally activated after holding at 30 C for 6 h, resulting in increased frequency of spore germination. Sublethal heating at 80 C for 10 min may induce dormancy in some strains of G. stearothermophilus rather than activation. Optimum germination of spores is a function of temperature, time, pH, and suspending medium. After heat treatment, maximum recovery of G. stearothermophilus spores is obtained at pH 7.0 and decreases as pH falls. Phosphates in the recovery medium result in a progressive decrease in spore recovery, whereas starch improves recovery. Spores of G. stearothermophilus are used as biological indicators for verifying exposure of a product to a sterilizing process. For monitoring steam sterilization, endospores of G. stearothermophilus (strains NCTC 10007, NCIB 8157, ATCC 7953) are in current use, particularly for processes performed at 121 C or higher. Biological indicators are available commercially, either as suspensions for inoculating test pieces, or on already inoculated carriers such as filter paper, glass, or plastic. After exposure to the sterilization process, the biological indicators are cultured in appropriate media incubated under suitable conditions. Immobilized G. stearothermophilus spores are used to monitor the efficacy of a sterilization process, particularly to measure sterilizing values in aseptic processing technologies for viscous liquid foods containing particulates; they can also be used to monitor in-pack sterilization efficacy. The main immobilization matrices are alginate beads or cubes mixed with puréed potatoes, peas or meat, and polyacrylamid gel spheres. Particle dimensions vary between 0.16 and 0.5 cm. The estimated z-values for immobilized G. stearothermophilus spores were 8.5–11.8 C. Geobacillus stearothermophilus produces a wide range of enzymes, many of which are of industrial significance (Table 3). Some of them are extracellular, enabling simple recovery from fermentation broths. The microorganism presents a number of advantages for the isolation of intracellular enzymes because its cell yield is generally good. A 400 l fermentation of G. stearothermophilus NCA 1503 yields 5–8 kg of wet cell paste, equivalent to 15 g l1. The majority of enzymes produced are intrinsically thermostable, and this
Heating in phosphate buffer (pH 7) or in Ringer’s solution (pH 7.1) or in water
D-value (min)
z-value ( C)
D120 5.8 D120 5.3 D120 1.0 D121 2.1 D121 0.7 D121 0.12
13.0 11.0 8.9 8.5 13.0 13.0
D118 10.0
5.7
Dry heat D-value (min)
z-value ( C)
D160 0.08 D160 3.2–27.0 D160 0.16
19 14–22 26–29
BACILLUS j Geobacillus stearothermophilus (Formerly Bacillus stearothermophilus) Table 3
131
Enzymes produced by Geobacillus stearothermophilus
Strain of G. stearothermophilus Enzyme
Temperature optimum ( C)
pH optimum
Thermal stability retained
NCIB 8924 KP 1236
Neutral protease Neutral protease
50 80
– 7.5
503-4
a-Amylase
55–70
4.6–5.1
ATCC 12980 KP 1064
a-Amylase Pullulanase
80 60–75
5.5 6.0
100% at 65–70 C 100% at 80 C for 10 min 100% at 60 C for 18 h 100% at 70 C for 24 h 71% at 85 C for 20 h 95% at 70 C for 2 h
KP 1006
a-Glucosidase
60
6.5
All strains
Cyclodextrin glycosyltransferase Glucose isomerase
60
–
55
–
H-165 NCIB 11270 NCIB 11270 ATCC 12980
Lipase Glycerokinase Glucokinase Leucine dehydrogenase
75 – – –
5.0 – – –
98
Gellan lyase
70
5.0–8.0
US100
L-Arabinose
80
7.5
isomerase
enhanced stability is exhibited against the action of other protein denaturants, such as detergents and organic solvents. The thermostable enzymes that have found commercial application are essentially intracellular enzymes. Glycerokinase produced from G. stearothermophilus NCA 1503 is used as a clinical diagnostic for the assay of serum triacylglycerols. The same strain cloned into Escherichia coli produces lactate dehydrogenase, which is used in a clinical diagnostic kit for the assay of glutamate pyruvate transaminase and glutamate oxaloacetate transaminase. Other diagnostic enzymes produced by G. stearothermophilus NCA 1503, including phosphofructokinase, phosphoglycerate kinase, and glucose phosphate isomerase, have been used as components of clinical diagnostic assay kits. The strain also produces restriction enzymes for molecular biology, while another strain of G. stearothermophilus isolated in China produces thermostable DNA polymerase, which is used in polymerase chain reaction and DNA sequencing.
Methods of Detection Geobacillus stearothermophilus possesses greater heat resistance than most other organisms commonly present in foods. This characteristic is advantageous to the examination of foods and ingredients because by controlled heat treatment of samples it is possible to eliminate all organisms except the spores of heat-resistant microorganisms. Further, heat shock or activation
100% at 60 C for 30 min
100% at 80 C for 30 min 50% at 70 C for 5 h
100% at 70 C for 2.5 h 100% at 60 C for 24 h
Application Detergent and leather industry; food industry in beer and bakery products Hydrolyses a-1,4 glucosidic linkages in amylose and amylopectin Splits a-1,6 glucosidase linkages in pullulan to maltotriose Hydrolyses a-1,4 or a-1,6 linkages in short-chain saccharides Produces from starch nonreducing cyclodextrins Production of fructose syrups Assay of monoacylglycerols Assay of serum triacylglycerols Assay of creatine kinase Assay of leucine aminopeptidase Gelling agent, thickener, or stabilizer in food and pharmaceutical industries and cosmetics Safe low-calorie sweetener in food products
is necessary to induce germination of the maximum number of spores. In a standard procedure, heat treatment at 100 C for 30 min or at 106 C for 30 min (for heat-resistant spores in milk powder) followed by rapid cooling should be done. Aerobic thermophilic spore formers can be encountered in heat-shocked samples using dextrose tryptone agar after incubation at 55 C for 48 h. Dehydration of the plates during incubation is minimized by placing the plates in oxygenpermeable bags. Geobacillus stearothermophilus should be grown preferably in nutrient media supplemented with calcium and iron, as well as with manganese sulfate to promote sporulation (i.e., nutrient agar supplemented per liter with 3 mg of manganese sulfate as well as the following sterile solutions: 10 ml D-glucose 20% w/v, 0.8 ml CaCl2 5% w/v, and 0.8 ml FeCl2 5% w/v). When investigating the incidence of process-resistant spores (i.e., spores that will survive the heat treatment of low-acid canned foods that is generally accepted as adequate for elimination of Clostridium botulinum spores) in ingredients such as dry sugar, starch, flour, or spices, it is convenient to heat suitable portions of the commodities, suspended in brain–heart infusion broth with 1% added starch (pH 7), in a pressure cooker for 4 min at 120 C, followed by rapid cooling. The presence of any surviving thermophilic aerobic spore formers is demonstrated by incubating the heated samples at 50 C under aerobic conditions. Samples other than finished products must be handled so that there will be no opportunities for spore germination or
132
BACILLUS j Geobacillus stearothermophilus (Formerly Bacillus stearothermophilus)
spore production between the collection of the samples and the start of examination procedures. Geobacillus stearothermophilus includes Gram-positive rods with terminal or subterminal spores, which swell the sporangium. It is difficult to identify because of the close relationship between it and other aerobic spore-forming thermophiles. Confirmation of G. stearothermophilus requires completion of a number of tests as indicated in Table 1. The bacterium does not grow under anaerobic conditions and is negative on Voges– Proskauer test. Some strains grow in medium containing up to 5% salt. The distinguishing feature of G. stearothermophilus compared with other aerobic, thermophilic spore formers was formerly considered to be starch hydrolysis; however, the isolation of strains unable to hydrolyze starch has restricted the distinguishing features to the temperature growth range and the limited tolerance to acid. Additional tests to confirm G. stearothermophilus are presented on Table 1. The incorporation of the majority of the tests indicated in Table 1 into the wells of a microtiter plate facilitates the application of the identification scheme. This miniaturized procedure saves a considerable amount of time in operation, effort in manipulation, materials, labor, and space. Another approach to the identification of Geobacillus strains that is currently used is based on the API 50CHB identification system (BioMérieux). These highly standardized, commercially available materials eliminate the problems of interlaboratory variation in media and improve test reproducibility. The biochemical tests that have been used traditionally to identify G. stearothermophilus are time consuming, can be difficult to interpret, and do not have the taxonomic resolution required for the thermophilic bacteria. In addition to the morphological and physiological characterization presented on Table 1, the cellular fatty acid profiling in case of G. stearothermophilus indicates that the sum of iso-15:0, iso-16:0, and iso-17:0 fatty acids makes up more than 60% of the total fatty acids. Polymerase chain reaction (PCR)-based identification techniques are used for identifying and typing Geobacillus species that include random amplified polymorphic DNA, restriction fragment-length polymorphism, 16S-23S internal spacer region profiling, and gene sequence analysis of various genes, such as gyrB, recA, rpoB, spo0A, and recN. Geobacillus stearothermophilus is indistinguishable using 16S rDNA sequence analysis and multilocus sequence analysis is applied for efficient and convenient determination of Geobacillus species (Table 4). Classical genotyping techniques based on sequence variability of single or multilocus PCR-amplified genes often lack
Table 4 Target gene recA rpoB spo0A
discriminative power at the level of individual isolates within the same species or need laborious and extensive sequencing labor. Microarray-based comparative genome hybridization is a powerful tool providing high-resolution discrimination at the level of individual isolates from a single species and allowing rapid and cost-effective typing of thermophilic bacilli in a wide variety of food products. Microbiological test results obtained by standard test methods concerning the enumeration of thermophilic bacteria in milk powders are of limited value in feeding useful data to the manufacturer. Milk powder must be stored until the samples are analyzed and the results reported (i.e., for 5 days or more) and only then it can be released to the consumer. Rapid assays giving results that are close to real time are of great use to monitor manufacturing processes and provide confidence in the manufacturing process. The BactiFlowÔ (Chemunex SA, France) uses bacterial esterase activity to label viable cells for flow cytometry, and using this system, a rapid test to count thermophilic bacteria in milk powder (with a lower limit of detection of 103 cfu g1) has been developed, which gives results within 1–2 h.
Regulations The presence of G. stearothermophilus spores in ingredients for foods other than thermally processed low-acid foods is probably of no significance provided those foods are not held within the thermophilic growth range for many hours. This microorganism has no public health significance. The National Food Processors Association (NFPA) standard for the total thermophilic spore count in sugar or starch specifies that for the five samples examined, there shall be a maximum of not more than 150 spores and an average of not more than 125 spores per 10 g of sugar (or starch). The sugar and starch standard may be used as a guide to evaluate other ingredients, keeping in mind the proportion of the other ingredients in the finished product relative to the quantity of sugar or starch used. For canners, the NFPA standards for thermophilic flat sour spores (typical species is G. stearothermophilus) in sugar or starch specify that for the five samples examined, there should be a maximum of not more than 75 spores and an average of not more than 50 spores per 10 g of sugar (or starch). The typical number of thermophilic bacilli in raw milk, usually as spores, is in the range of 50 cfu ml1. During
PCR methods used for identification of Geobacillus spp. Primer sequence (5 0 – 3 0 ) F: ATTAGGTGTCGGCGGTTAT R: CCAT(G/A)TCATTGCCTTG(T/C)TT(A/G) F: TTGACAGGCCGACTAGTTCA R: CGCGTCGGTATGGTGTTTCAAT Fa: ATYATGYTVACRGCVTTYGGBCARGAAGA Ra: TAKCCTTTWATRTGIGCDGGIACRCCGATTTC
Tested food
Detection limit
Specificity G. stearothermophilus G. stearothermophilus
Milk powder
Vegetative cells: 800 cfu g1 Spores: 6400 spores g1
Geobacillus, Bacillus, Anoxybacillus
Nucleotide substitution according to the universal degenerate code: R ¼ (A/G), W ¼ (A/T), Y ¼ (C/T), K ¼ (G/T), V ¼ (A/G/C), B ¼ (T/C/G), D ¼ (A/G/T), and I ¼ (A/G/C/T).
a
BACILLUS j Geobacillus stearothermophilus (Formerly Bacillus stearothermophilus) processing, the raw milk is concentrated approximately 10-fold to form a powder, so the expected number of thermophilic bacilli is 500 cfu g1, provided that no significant growth occurred within the processing lines. A common specification limit for viable plate counts for thermophiles in milk powder is 105 cfu g1. Typically, milk powder is produced continuously over an 18–24 h processing period. With increased processing time, the number of thermophiles increases until specification limits are reached and the process run is terminated to prevent product downgrading.
Importance to the Food Industry Geobacillus stearothermophilus is a potential contaminant in a variety of industries where elevated temperatures (40–65 C) prevail during the manufacturing process or during product storage, such as canning, juice pasteurization, sugar refining, gelatine production, dehydrated vegetable manufacture, and dairy product manufacture. In dairy processes, the microorganism is an issue in products such as milk powder, pasteurized milk, buttermilk, and whey. Geobacillus stearothermophilus accounts for up to 65% of the thermophilic strains derived from milk powders, because the spores are able to survive the low water activity and high temperature of the drying process, the cleaning-in-place system, and the long-term storage of the final product. In addition, G. stearothermophilus produces heat-stable proteinases and lipases that survive the heat treatments applied during commercial milk powder manufacture. The enzymes remain active in milk powder during storage and would be active in milk products made from recombined milk powder. Geobacillus stearothermophilus is the typical species responsible for the thermophilic flat sour spoilage of low-acid canned foods. It ferments carbohydrates with the production of short-chain fatty acids that sour the product. Spoilage does not result in gas production and hence there is no swelling of the cans, so the ends of the container remain flat. The species is responsible for the spoilage of low-acid foods, such as canned peas, beans, corn, and asparagus, when they are maintained at a temperature above 43 C for an extended period or when cooling is carried out very slowly, if the food contains viable spores capable of germinating and growing in the product. Because flat sour spoilage does not develop unless the product is at high temperature, proper cooling after thermal processing and avoiding high temperatures during warehouse storage or distribution are essential. Spores of G. stearothermophilus enter canneries in soil, on raw foods, and in ingredients, and their population may increase at any point at which a suitable environment exists. For example, equipment – such as holding tank blanchers and warm filler bowls – may serve as a focal point for the build-up of an excessive population. The spores show exceptional resistance to destruction by heat and chemicals and therefore are difficult to eliminate in a product or in the plant. To minimize spore contamination, control of spore population in ingredients and products entering the plant, as well as the use of sound plant sanitation practices, are suggested. The application of bacteriocins as part of hurdle technology can contribute to control thermophilic spoilage in low-acid canned vegetables (corn, peas, okra, and mushrooms), when the cans are stored under warm conditions for prolonged
133
periods or to allow a reduction in heat processing without the risk of thermophilic spoilage occurring. Nisin, a polypeptide consisting of 34 amino acids, has received generally recognized as safe (GRAS) status in 1988. It is perceived to be a natural preservative and can be applied to inhibit thermophilic bacteria in canned vegetables. Enterocin AS-48, a broad spectrum cyclic antimicrobial peptide, is active against G. stearothermophilus vegetative cells and endospores in different types of canned fruit juice and vegetable foods during storage under temperature abuse conditions. An enzyme, the hen egg white lysozyme, stable at 100 C for 30 min at pH 5.3, is classified as GRAS in the United States and is approved for use in some foods. Lysozyme in heat treatment processes reduces the heat resistance of G. stearothermophilus. Dormant G. stearothermophilus spores are of no concern in commercially sterile canned foods destined for storage and distribution where temperatures will not exceed 43 C. However, canned foods in tropical locales and those intended for hot-vend service must not contain thermophilic spores capable of germination and outgrowth in the product to be considered commercially sterile. Traditional thermal processing methods cause loss of desirable properties related to texture, flavor, color, and nutrient value of foods. The most serious commercial problems with product sterility are caused by thermally resistant spores. On the other hand, consumers demand high-quality foods that are free of additives, fresh tasting, and microbiologically safe and that have an extended shelf life. The following food technologies meet these consumer demands and their effect on inactivation of G. stearothermophilus spores is briefly discussed. High-pressure processing can inactivate the vegetative form of many microorganisms; however, spores can be resistant to pressures as high as 1000 MPa. Pressure-assisted thermal sterilization process, when applied at six 5-min cycles at 600 MPa and 70 C to reduce or destroy G. stearothermophilus spores, resulted in the destruction of 106 spores ml1, whereas by static application, 800 MPa, and 60 C for 60 min, spores were reduced to 102 ml1. High-pressure CO2 treatment at 95 C and 30 MPa pressure for 120 min causes 5-log-cycle inactivation of spores of G. stearothermophilus, whereas sodium chloride and glucose have a protective effect and the level of inactivation is reduced. The heat resistance of G. stearothermophilus spores is reduced by ultrasonic treatment, as the ultrasonic treatment affects the release of calcium, dipicolinic acid, fatty acids, and other low-molecular-weight components. Using hydrogen peroxide as a sterilant for foodcontact surfaces of olefin polymers and polyethylene in aseptic packaging systems, the D25 value of G. stearothermophilus spores is 1.5 min when the concentration of H2O2 is 26%. Geobacillus stearothermophilus spores are among the most radiation resistant spore formers. Geobacillus stearothermophilus forms biofilms on the surfaces of processing equipment in sections of dairy manufacturing plants at elevated temperatures of 40–65 C – that is, preheating and evaporation sections of milk powder plants, plate heat exchangers used during the pasteurization process, centrifugal separators (used to separate cream from whole milk) operated at warm temperatures, recycle loops in butter manufacturing plants, cream heaters in anhydrous milk fat plants, and ultrafiltration plants operated at warm temperatures. Extensive biofilm formation occurs when production
134
BACILLUS j Geobacillus stearothermophilus (Formerly Bacillus stearothermophilus)
cycles are too long, the manufacturing equipment is not cleaned properly between production cycles, recycle loops are used, and contaminated ingredients or by-products are used. The prevention of biofilms focuses on altering the manufacturing conditions (such as temperature), manipulating the surface of stainless steel to reduce bacterial attachment, and developing novel sanitizers.
numbers reach >106 cfu g1, there is potential for enzymatic deterioration of the product, resulting in changes in its composition and organoleptic properties. Inadequate cooling subsequent to thermal processing is a major contributor to spoilage by G. stearothermophilus. Localized warming of sections of stacks of heat-processed foods placed too close to heating appliances is also of importance.
Importance to the Consumer
Further Reading
The prolonged heating necessary to destroy all G. stearothermophilus spores causing spoilage to low-acid canned foods would impair taste, texture, and appearance and lead to loss of nutritional value. It is therefore necessary to store canned foods at temperatures below the minimum required for growth of this microorganism. The incidence of G. stearothermophilus spores in heat-processed foods may affect the commercial life of the product without presenting a hazard for public health. The bacterium, however, can be an indicator organism for assessing the overall hygiene of the manufacturing process. High numbers of thermophilic spore-forming bacteria (>104 cfu g1) in milk powder indicate poor manufacturing practices, and when
Burgess, S.A., Lindsay, D., Flint, S.H., 2010. Thermophilic bacilli and their importance in dairy processing. International Journal of Food Microbiology 144, 215–225. Claus, D., Berkeley, R.C.W., 1986. Genus Geobacillus Colin 1872, 174. In: Sneath, P.H.A., Mair, N.S., Sharpe, M.E., Holt, J.G. (Eds.), Bergey’s Manual of Systematic Bacteriology, vol. 2. Williams and Wilkins, Baltimore, pp. 1043–1071. Nazina, T.N., Tourova, T.P., Poltaraus, A.B., et al., 2001. Taxonomic study of aerobic thermophilic bacilli: descriptions of Geobacillus subterraneous gen. nov., sp. nov. and Geobacillus uzenensis sp. nov. from petroleum reservoirs and transfer of Bacillus stearothermophilus, Bacillus thermocatenulatus, Bacillus thermoleovorans, Bacillus kaustophilus, Bacillus thermoglucosidasius and Bacillus thermodenitrificans to Geobacillus as the new combinations G. stearothermophilus, G. thermocatenulatus, G. thermoleovorans, G. kaustophilus, G. thermoglucosidasius and G. thermodenitrificans. International Journal of Systematic and Evolutionary Microbiology 51, 433–446. Sharp, R.J., Riley, P.W., White, D., 1992. Heterotrophic thermophilic Bacilli. In: Kristjansson, J.K. (Ed.), Thermophilic Bacteria. CRC Press, Boca Raton, pp. 19–50.