Bacillus subtilis RNAase III cleavage sites in phage SP82 early mRNA

Cell, Vol. 33, 907-913,

July 1983. CopyrIght

Q 1983 by MIT

0092.6674/63/070907-07

Bacillus subtilis RNAase Ill Cleavage in Phage SP82 Early mRNA Antonito T. Panganiban* and H. Ft. Whiteley Department of Microbiology University of Washington Seattle, Washington 98195

and Immunology

SC-42

We have determined the DNA sequence encoding three sites in Bacillus subtilis phage SP82 early mRNA that are cleaved by a B. subtilis processing endonuclease. The products generated by cleavage of the RNA were sequenced to determine the exact points of RNA strand scission. We propose that the RNA surrounding each processing site forms a stable stem-loop structure and that cleavage occurs at the 5- side of specific adenosine residues located on the loop. The model is consistent with our previous observations that the active site of the enzyme recognizes double-stranded RNA. Sl mapping experiments with RNA-DNA hybrids established that the same cleavage sites are used both in vivo and in vitro. Examination of the B. subtilis processing sites on SP82 mRNA reveals distinctive features of primary and secondary structure that are not present in any of the E. coli RNAase Ill processing sites previously studied. Introduction The early genes of B. subtilis phage SP82 are transcribed by the host RNA polymerase, yielding several long overlapping major RNA species (Figure 1 and Panganiban and Whiteley, 1981). Some of these primary transcripts are subsequently processed by a B. subtilis endonuclease generating shorter molecules (Downard and Whiteley, 1981; Panganiban and Whiteley, submitted). At present, the biological function of processing in this system is unknown since translation of SP82 mRNA is not affected by processing (Panganiban and Whiteley, submitted). The same enzyme also processes a large RNA molecule produced by in vitro transcription of a cloned B. subtilis 16s rRNA gene. The latter transcript is cleaved in a spacer region between the 16s and 23s rRNA genes lacking tRNA genes. E. coli RNAase Ill also processes phage mRNAs (specifically, T7 mRNAs) and precursor rRNAs; the latter are cleaved in the spacer region between the E. coli 16s and 23s rRNA genes. Both the B. subtilis processing enzyme (Panganiban and Whiteley, submitted) and E. coli RNAase Ill (Dunn, 1976) are competitively inhibited by double-stranded RNAs and can be purified to homogeneity by affinity chromatography on columns of polylpolyC, indicating that both recognize double-stranded regions. These similarities in properties suggest that the B. subtilis processing enzyme is the functional analog of E. * Present address. McArdle Laboratory for Cancer Wlsconsln. Madison, Wisconsin 53706.

Research,

University

of

$02.00/O

Sites

coli RNAase III. Provisionally, we have given this enzyme the trivial name “Bs-RNAase Ill” to indicate its role in the maturation of phage RNAs and precursor rRNAs. The overall role and extent of mRNA processing in procaryotic cells is not clear. The most thoroughly studied example is the cleavage of T7 mRNA by E. coli RNAase Ill (Dunn and Studier, 1973). Several cleavage sites in T7 mRNA have been subjected to sequence analysis, and conservation in secondary structure around each of the processing sites has been observed (Oakely and Coleman, 1977; Robertson and Barany, 1979; Robertson et al., 1977; Rosenberg and Kramer, 1977). Sites possessing secondary RNA structure similar to those at the T7 cleavage sites have been found in E. coli rpl JL-rpoBC mRNA and in the X N gene transcript; these sites are also cleaved by RNAase Ill (Lozeron et al., 1976, 1977; Barry et al., 1980). RNAase Ill is also involved in retroregulation of the X int gene and the T7 1.2 gene (Gottesman et al., 1982). Although E. coli RNAase Ill and Bs-RNAase Ill both process rRNA precursors and certain phage mRNAs, and have a high affinity for double-stranded RNA, each enzyme is highly specific (Panganiban and Whiteley, submitted). Thus, 1) the E. coli RNAase Ill does not cleave SP82 RNA and the B. subtilis enzyme does not cleave T7 mRNA; 2) each enzyme cleaves only the homologous precursor rRNA, 3) the E. coli enzyme can nonspecifically degrade double-stranded RNAs and synthetic duplex polymers such as polyAU (Robertson et al., 1968; Crouch, 1974) but the B. subtilis enzyme does not have this activity; 4) the specificity of cleavage by E. coli RNAase Ill on phage RNA is reduced at low salt concentrations (Dunn, 1976) whereas the specificity of Bs-RNAase Ill cleavage of phage RNA is not affected by changing the salt concentration, In order to examine the specific features required for enzyme recognition and RNA scission, we have determined the primary and the probable secondary structures of regions around three cleavage sites in early SP82 mRNA.

Results DNA Sequence Encoding RNA Containing Bs-RNAase Ill Cleavage Sites The approach that we took to examine the primary and secondary structures around Bs-RNAase Ill sites in SP82 RNA was to sequence a restriction fragment of DNA that encodes RNA with four processing sites. Processed RNA was then directly examined by sequence analysis, and the RNA and DNA sequences were compared. The Hae II-d restriction fragment of SP82 DNA is a 1.4 kb segment derived from the left end of the map of the SP82 genome (Figure 1). In vitro transcription of Hae II-d had previously been shown to yield a single transcript initiating at the promoter for two major in vitro RNAsRNAs A and F (Figure 1; Panganiban and Whiteley, 1981). This promoter is located - 120 bases from the left end of the map shown in Figure 1. The Hae II-d transcript was processed with Bs-RNAase Ill to determine the number and sizes of the cleavage products. Comparison of the

Cell 908

Figure 1. Location of Transcripts ase from SP82 DNA

Synthesized

by B. subtilis RNA Polymer-

The top line represents the 140 kb SP82 genome with the 13 kb direct termrnal repeat (TR). The bottom line shows the location of the Hae II cleavage sites in TR; small letters represent indivrdual Hae II fragments. The wavy lines depict the location and direction of synthesis of the major RNA species (capital letters) synthesized by RNA polymerase (Panganiban and Whiteley, 19ai).

processed RNAs with those generated by cleavage of purified RNA F revealed that RNA derived from Hae II-d contains four of the five species present within RNA F (RN&, RNkIO, RNAm, and RNA&, as shown in lanes 2, 4, and 5 of Figure 2. When higher percent gels were used, an additional 90 base RNA was seen (data not shown). The latter was probably derived from truncation of RNAadO as indicated on the map in Figure 2. When the Hae II-d fragment was digested with restriction enzymes prior to transcription, truncated RNAs were produced, and cleavage of the truncated RNAs with BsRNAase ill allowed us to determine the partial order of the processed RNAs. Transcription of the Hae II-d fragment after digestion with Hha I resulted in truncation of the transcript as described previously (Paganiban and Whiteley, 1981) and processing of this RNA by Bs-RNAase III generated RNABl,,, RNAm, and a new truncated RNA of -175 bases (lane 6 of Figure 2). A similar experiment, in which Hae II-d was digested with Hpa I prior to transcription and the RNA was processed by Bs-RNAase Ill, yielded only RNAm (lane 7 of Figure 2). Based on these results, the order of the cleavage products derived from Hae II-d is 5--RNAm, RNABIO, RNAm or RNAzno, and RNASO(Figure 2). As shown below, this order was confirmed by correlation of the RNA and DNA sequences. The relative order of RNAm and RNAZm remained ambiguous since it could not be determined whether RNA1r5, which results from truncation with Hha I, was derived from RNAm or RNAZm. To determine the DNA sequence coding for RNA containing these cleavage sites, a restriction map of the Hae II-d fragment was generated, and the fragment was subjected to sequence analysis. The primary structure of the entire fragment was determined, except for about 260 bp of DNA, which was inaccessible due to lack of suitable restriction sites. The overall sequencing strategy is summarized in Figure 3, and the primary structure is shown in Figure 4. RNA Sequence Sites RNA transcribed with Bs-RNAase 5’ ends of the

at Three

Bs-RNAase

III Processing

from the Hae II-d fragment was cleaved Ill and attempts were made to label the resulting molecules with polynucleotide

HP~

Hha

, 175

RNA

F

300

Figure 2. Bs-RNAase

I I

310

Ill Cleavage

I I

360

220

I 1

340

’

Products

The purified RNA F. RNA from transcription of Hae II-d, or RNA from transcription of the restriction enzyme cleaved-Hae II-d fragment were cleaved by Bs-RNAase Ill. The locations of RNA F and the Hae II-d fragment are shown in Figure 1. Following cleavage, the RNAs were electrophoresed on 6% (lanes I-5) or 8% (lanes 6 and 7) RNA gels, and autoradiographs were made from the gels. Lane 1, cleavage products from total SP82 in vitro RNA; lane 2, cleavage products from RNA F; lane 3, punfied RNA F; lane 4, cleavage products from total 982 in vitro RNA; lane 5. cleavage products of RNA from the Hae II-d fragment; lane 6, cleavage products from RNA truncated by Hha I digestion of Hae II-d; lane 7, cleavage products from RNA truncated by Hpa I drgestion of Hae II-d. Lengths of the RNAs are given in bases. At bottom, the bold line depicts the Hae II-d fragment and shows the location of the Hpa I and Hha I cleavage sites. Wavy lines represent the RNAs, and the locations of the Bs-RNAase Ill cleavage sites are indicated by vertical lines.

kinase and 32P-ATP. Two of the cleavage products, RNhIO and RNAw, were successfully labeled using this procedure. However, RNhM, RN&, and RNA2m were refractory to labeling, possibly because secondary or tertiary structure of the processed RNAs made the 5’ ends inaccessible. This problem was partially circumvented by labeling RNAlr5. This RNA results from truncation of either RNA3600r RNA2m by cleavage with Hha I (Figure 2). Thus it was possible to determine the sequence at the 5- end of three of the four cleavage sites in the Hae II-d transcript (Figure 5). The remaining cleavage product, RN&, could not be labeled, but the 5’ end of this RNA is located at the site of transcription initiation and not at a cleavage site. The RNA sequences shown in Figure 5 correspond to the DNA sequences downstream of the cleavage points (Figure 4) from all three processing sites. It is highly unlikely that processing results in cleavage at more than one nucleotide residue per site. When the Hae II-d transcript was uniformally labeled by use of four (U--P nucleotides, processed, and analyzed by electrophoresis on a high-percentage sequencing gel, no radioactivity was detected in the range of l-l 00 nucleotides (not shown).

6sRNAase 909

III Cleavage

Sites

Bs-RNAase III Cleavage Sites Are Used In vivo and In vitro

Figure 3. DNA Sequencing

To ascertain whether the in vitro cleavage sites in the SP82 early mRNA were also cleaved in vivo, nuclease Sl protection experiments were performed, using RNAs synthesized in vitro and RNAs extracted from B. subtilis 5 min after infection in the presence of chloramphenicol. The 5’ ends of two Hinf I fragments and one Mbo I fragment (derived from the Hae II-d fragment) were labeled, the DNA was hybridized with RNA (synthesized either in vitro or in vivo) under conditions favoring RNA-DNA duplex formation, and the resulting hybrids were subjected to treatment with nuclease Sl (Figure 6). Each of the three different labeled 5’ ends is located at a distal point in the DNA relative to each of the three sites of RNA processing (Figure 6). Hence, the length of the protected region should represent the distance from the restriction site to the upstream Bs-RNAase Ill cleavage site in the RNA. In each

Strategy

The regions coding for RNA containing three Bs-RNAase III cleavage sites were determined primarily by the method of Maxam and Gilbert (1980). The locations of the Bs-RNAase III cleavage products as determined in Figure 2 are shown at the bottom. DNAs labeled at the 3- end with the E. coli polymerase large fragment and a-labeled deoxynucleotides are indicated as lines labeled 3; DNAs labeled at the 5’ end with T4 polynucleotide kinase and y-labeled ATP are shown as lines labeled 5; E indicates a DNA segment that was cloned into the single-stranded phage vector M13mp8 (Messing et al., 1981) and sequenced by the chain termination method (Sanger et al., 1977).

-35 CCn;TCTAn;GGTCTn;AAACTTTTAGGGGGGGAGGGGGT

-10

AAAAAA~ATCTACAGAiAATATGAAAiAGTTGT~

.

.-

r bs

i

ATTTCTTCCCATCCATGCTATAATAAAGTCATAGAGMC~CACTATC~~M~AGAGCM~A~CTATC-TGMTCG~~GTCGGG~TCA

. 200

taq CGn;GAGn;TATGTn;MG;;TTAn;AGTTCAAATGTGGA~ACGCMCCT~GCMCG~AC~AGTMT~~TATTCACAGA~ATMT~~~MGAGGG~

act

100

.

. 300

t

.

ATCATCCCn;AGTATGTTACCGCCMCGATGATACATTn;

400

rbs

t

CAGTCCCGC;TCAGCAGTT&TAGTACTCkCC

GCGGChGGGCACCATGGAGCCGCTGA

hqa

500

. . . GCCGTTATACMGCMCMCATTATTTMGMTMTACATCACMTATTCAGAGTAGGGAATTTTTCTTCCCCTAC-TGCATAG~TACCGCTA~AG

. 600 t

. . . AAATCTCACACCn;GAGGCATn;CACGGGTACAGCATTACMCGTAGMG~TTTC~TMTCCT~ACTTTCCCTACGA~~~CATMTA~

.

260

GMTGTG----

.

.

.

. mbo . GCTACTACATGAGTMGTCCTGXxkACAGGCAGMGC

r-‘----- ------ 2-- -----_-_ i

rbs Ill Cleavage

800

907

.

of DNA Coding for RNA with 3 Bs-RNAase

rbs

bp 5

GTAGn;MCTACGTCn;GATCCGGMCTGCCACAACCGCTAGTATCCATCC

Figure 4. Sequence

hinf 700

III ~TAGGGTGGATA~TA~;GAG~~A~T

i

CTACCACiGATTGT~MGTTMCA~iAAAi

m 1267

mbo

Sites

The DNA strand shown IS in the same sense as the RNA. Potential regulatory sequences in either the DNA or corresponding RNA are indicated above the sequences, as are the sites of Bs-RNAase Ill cleavage in the corresponding RNA as determined in Figure 5. The horizontal lines adjacent to each Bs-RNAase Ill cleavage site represent the nucleottdes in the corresponding RNA that comprise the stem structure (see Discussion). -35 and -10 are the putative conserved sequences of the promoter in the DNA; rbs, i, and t indicate putative ribosome binding sites, initiation codons, and termination codons, respectively, in the RNA: Ill shows Bs-RNAase Ill cleavage sites in the RNA.

Cell 910

Frgure 5. RNA Sequences

at the Es-RNAase

III Cleavage

Sites

RNAs were labeled at the 5’ end wrth T4 polynucleotrde kinase and T-~P-ATP and purified by gel electrophoresis. The primary then determined by enzymatic cleavage (Donis-Keller et al., 1977). A: the 310 base RNA; B: the 175 base RNA; C: the 90 base text for the location of these RNAs). -lanes: no RNAase added; T, lanes: IO-* and 10m3 dilution of a 1 U/ml solution of RNAase IO-’ dilution of a 1 U/ml solution of RNAase Uz; F lanes: formamide-treated RNA. Digested RNAs were analyzed on 25% bromphenol blue marker had migrated one-fourth of the length of the gel.

instance, the measured length of the nuclease Sl-treated sample matched the predicted length, based on the DNA and RNA sequence analysis. The in vivo and the in vitro synthesized RNAs protected the DNA to the same extent, indicating that cleavage occurs at the same point in the RNA in vivo and in vitro.

Discussion Secondary Structure at the Cleavage Sites Examination of the RNA sequences surrounding each BsRNAase Ill cleavage site revealed that the RNA can potentially form stable stem-loop structures (Figure 7). This is consistent with the previous observation that this enzyme is competitively inhibited by double-stranded RNA, and that substrate recognition involves some aspect of base pairing in the RNA (Panganiban and Whiteley, submitted). A striking result of this construction is that the RNA at each of the three cleavage sites would form configurations of similar stem length and overall structure. In each case, strand scission occurs at similar positions in the hairpin loop, generating a 5’ adenosine residue. The latter observation confirms our earlier finding (Panganiban and Whiteley, submitted) that processing of a mixture of SP82 early mRNAs yields only adenosine residues at the site of cleavage. Moreover, the three sites shown in Figure 7

structure of the FiNAs was RNA (see Frgure 2 and the T,; U2 lanes: IO-’ and 5 sequencrng gels when the

possess some sequence conservation (i.e., approximately 55% of the nucleotides in each stem-loop structure are the same). These secondary structures are probable, since the formation of each stem would result in a free energy change of about -17 Kcal (Tinoco et al., 1973).

Comparison between E. coli RNAase III and Bs-RNAase Ill Cleavage Sites E. coli RNAase Ill recognizes and cleaves sites in T7 mRNA that possess secondary structure similar in length, size, and stability to that proposed in’figure 7 for the Bs-RNAase III cleavage sites in SP82 mRNA (Oakley and Coleman, 1977; Robertson and Barany, 1979; Rosenberg and Kramer, 1977). This is probably the reason that both enzymes have an extremely high affinity for double-stranded RNA. However, E. coli RNAase Ill cuts T7 RNA at the 3’ side at an internal loop in the stem, while cleavage of SP82 mRNA occurs within the hairpin loop itself; there is no apparent sequence homology between the processing sites in SP82 and T7 mRNAs. As mentioned previously, the two enzymes are not interchangeable-each cleaves only the homologous phage and ribosomal RNAs. The difference in primary structure and disparate location of cleavage on the stem and loop exhibited by E. coli and B. subtilis RNAase Ill may explain why the two enzymes will not cleave the heterologous RNAs.

Es-RNAase 911

III Cleavage

Sites

I234

9

5676

lo

II 12

Figure 7. Potentral Secondary Sttes

H I

“701 Mm, ,

y1342

260 “?----i m

5’70 H 17o1a77 5/&

Ia

I m Figure 6. Comparison

of rn vitro and rn vrvo Bs-RNAase

Ill Cleavage

RNA Structure

at the Bs-RNAase

Ill Cleavage

A: the cleavage sate at the junctron between the 300 and 310 base RNAs; B: the cleavage sate at the junction between the 310 and 175 base RNA; C: the cleavage sate at the junction between the 360-220 and 90 base RNA; D: secondary structure in the 165-235 spacer region of B. subtilis precursor rRNA (redrawn from Bott and Hollis, 1982. and Loughney et al., 1982) at the region cleaved by Bs-RNAase Ill (Panganiban and Whiteley, submitted). The bottom three lines show the sequence comparison of the RNAs comprising the stem and loop structures of Bs-RNAase Ill cleavage sites in SP82 DNA. Boxed nucleotides indicate bases identical at each of the three sequenced cleavage sites; h = bases located in the hairpin loop; p = sites of processing by Bs-RNAase Ill.

Sites

Three DNA restnction fragments were labeled at the 5’ end, hybridized with RNA from In vrtro transcription of SP82 DNA or RNA from cultures of B. subtilis infected with SP82. treated with Sl nuclease, and analyzed on an 8% sequencing gel. The locations of the three restriction fragments and the size and location of the RNA providing protection from Sl are shown at the bottom. Lane 1: purified 700 bp Hinf fragment; lane 2: the 700 bp fragment hybndrzed with in vitro RNA; lane 3: the 700 bp fragment hybrrdrzed wrth in vivo RNA; lane 4: the 700 bp fragment with no RNA; lane 5: the purified 180 bp Hinf fragment; lane 6: the 180 bp fragment hybrrdized wrth In vitro RNA; lane 7: the 180 bp fragment hybridized with in vivo RNA; lane 8: the 180 bp fragment wrth no RNA; lane 9: the purtfied 560 bp Mbo fragment; lane IO: the 560 bp fragment hybridized with in vitro RNA; lane 11: the 560 bp fragment hybridrzed to in vivo RNA; lane 12: the 560 bp fragment with no RNA. H = Hinf site; M = Mbo site; bold lanes = DNA; wavy lanes = RNA; Ill = Bs-RNAase Ill cleavage sites; subscnpts to Hrnf and Mbo sites give the location of the cleavage sites as shown in Figure 4.

Potential Ribosome Binding Sites and Coding Sequences Examination of the DNA and RNA sequences adjacent to the three cleavage sites revealed that there are potential ribosome binding sites (Shine and Delgarno, 1974; Steitz, 1979) downstream of each cleavage site and that these are followed by appropriately spaced AUG start codons. As indicated in Figure 4, approximately 12 bp downstream of the putative stem-loop structure A (Figure 7) there is an 8 bp sequence homologous to the sequence at the 3end of B. subtilis 16s rRNA, and a start codon follows eight nucleotides downstream. Similar strong potential ri-

bosome binding sites, followed by start codons, are found downstream of the second and third processing sites shown in Figure 4. Within the limits of DNA and RNA sequenced, these potential translation initiation signals are followed by open reading frames (the other two reading frames both contain termination codons). While the utilization of these ribosome binding sites remains to be demonstrated, their location relative to the secondary structure around the cleavage sites is consistent with in vitro translation experiments using cleaved and uncleaved SP82 early mRNA (Panganiban and Whiteley, submitted). We found that cleavage and heat treatment of RNA did not affect the translation products, either qualitatively or quantitatively, indicating that the accessibility of the binding sites was not changed by processing. As shown in Figure 4, each putative ribosome binding site and start codon lies several nucleotides outside the secondary structure around the processing site. A possible, but untested, physiological role for polycistronic transcription and processing of SP82 early mRNA is that processing produces substrates that are susceptible to functional inactivation by cellular or phage-coded nucleases. Early RNA synthesis is, for the most part, turned off as phage infection progresses-in part by the sequential replacement of the sigma subunit of RNA polymerase by phage-coded specificity determining peptides (Lawrie et al., 1976). Processing and inactivation of the RNA would

Cell 912

provide a complementary mechanism for turning off expression of the early genes at the translational level.

Role of RNAase Ill in mRNA Processing To date, E. coli RNAase Ill and Bs-RNAase III are the only enzymes demonstrated to process procaryotic mRNA, as discussed previously, these two enzymes probably function analogously in rRNA processing. Since there are so few examples of mRNA processing, it is not known whether these are the only enzymes capable of cleaving mRNA. However, there is no obvious reason for mRNA processing to be delegated solely to these enzymes. Other nucleases involved in tRNA and rRNA processing, such as RNAase P, M5, and Ml6 (Altman, 1971; Sogin et al., 1977; Dahlberg et al., 1978; reviewed by Gegenheimer and Apirion, 1981) also recognize specific structural features and have stringent requirements for cleavage of specific mRNA molecules.

Cleavage of Precursor rRNA Aside from extensive base-pairing, the T7 mRNA processing sites bear little resemblance to the E. coli rRNA precursor structures cleaved by E. coli RNAase Ill. The latter precursors are cleaved within long double-stranded regions formed by base-pairing between each 5’- and 3’flanking region of the 16s and 23s genes in the precursor rRNA molecule (Young and Steitz, 1978; Bram et al., 1980). To our knowledge, the structure of the B. subtilis precursor rRNA cleaved by Bs-RNAase III has not been determined. However, we note from recent sequence analysis of a 164 base spacer region at a 16S-23s rRNA gene junction (Bott and Hollis, 1982) present in eight of ten of the rRNA gene sets in B. subtilis (Loughney et al., 1982) that a stem-loop structure can be formed (Figure 7D). We have shown (Panganiban and Whiteley, submitted) that Bs-RNAase Ill cleaves the precursor rRNA in this spacer region. However, comparisons of the structures shown in Figure 7 indicate that, as expected, the RNA sequence shown in Figure 7D bears little or no similarity to those in Figure 7A-C. If the configuration shown in Figure 7D is actually involved in recognition of the precursor rRNA, processing of this molecule in B. subtilis may be quite different from processing of precursor rRNA in E. coli. It will be interesting to see whether the interaction between RNA and Bs-RNAase Ill during maturation of rRNA differs from the analogous process in E. coli. Experimental

Procedures

Purification of DNA SP82 DNA was extracted from CsCl gradient-purified phages as described by Lawrie and Whiteley. 1977. The Hae II-d restriction fragment of SP82 DNA was recovered from 4% polyacrylamrde gels by electrophwetic elution and purified by absorption on a 0.1 ml Whatman DEAE-52 (DE-52) cellulose column. The column was washed wrth 50 mM Tris (pH 7.9) 2 mM EDTA, 0.15 M NaCI, and DNA was eluted with the same buffer containing 1 M NaCI. The DNA was precipitated with 3 vol ethanol, rinsed with ethanol, dned by aspiratron, and resuspended in a small volume of IO mM Tris (pH 7.9) 1 mM EDTA.

Transcription and Purification of RNA Conditions for the transcription of the Hae II-d restriction fragment with B. subtilis RNA polymerase are the same as described earlier (Panganiban and Whiteley, lQ81), except that all nucleotide concentrations were reduced to 50 PM. The transcription reactions were terminated by the addition of 20 pg/ml RNAase-free DNAase I, and incubation was continued at 37°C for 5 min. Protein was removed by two sequential phenol:CHt& (1 :I) extractions, and the RNA was collected on and eluted from a DE-52 column as described for the purification of DNA restriction fragments. Following ethanol precipttation. the RNA was resuspended in a small amount of water. RNA was isolated from B. subtilis after 5 min of infection with SP82 in the presence of chloramphenicd as described by Downard and Whiteley, 1981. RNA was purified by chromatography on DE-52 ceflulose as described above for the purification of DNA fragments, dissolved in water, and stored at -2VC. Purification of Es-RNAase III, Cleavage of SP82 RNA, and RNA Gel Analysis Bs-RNAase Ill was purified from extracts of uninfected B. subtilis using polyethylene glycol-dextran partition, phenyl sepharose chromatography, and chromatography on a column of polyl-polyC agarose (Panganiban and Whiteley, submitted). RNA was cleaved as follows: 1 pmole of RNA obtained by transcription of Hae II-d by B. subtilis RNA poiymerase in the presence of a-T-ATP and GTP. UTP and CTP was incubated for 30 min at 37°C in a reaction mixture containing 10 mM Tris, (pH 7.9). 3 mM MgCI,, 80 mM NaCI, and 1.5 U Bs-RNAase III. One unit of enzyme activity is the amount of protein that catalyzes the production of 1 pmole of RN&, a product of processing the Hae II-d primary transcript (Panganiban and Whiteley, submitted). The total volume of the reaction was 50 gl. The cleavage products used for end-labeling and RNA sequence analysis were generated in the same manner, except that the reaction volume and constituents were increased by 56fold and ol-=P-ATP was replaced by 3HATP. The RNA was ethanol-precipitated and resuspended in 10 pl of a solution containing 1% SDS, 10 mM Tris (pH 7.4) 10 mM EDTA. 40% glycerol, and 0.1% bromphenol blue. RNAs were analyzed on 6% or 8% polyacrylamrde gels as described earlier (Panganiban and Whiteley. 1981) employing the Tris-acetate buffer system of Gegenheimer et al. (1977). The sizes of transcripts and processed RNAs were determrned from a curve obtained by plotting the electrophoretic mobilities of denatured Hinf I fragments of pBR322. In some experiments, the following were used as markers: q-labeled T7 mRNA extracted from E. coli-infected with wildtype T7 and the HI mutant (24) and “P-labeled rRNA from E. colt These preparations were contributed by Susan Strome (Department of Biochemistry, University of Washrngton). DNA and RNA sequencing The restriction map of the Hae II-d fragment was generated by the partial digestion method of Smith and Birnstiel (1976). DNA sequence detenination was by the method of Maxam and Gilbert (1980). In one instance, a segment of Hae II-d was cloned by blunt-end ligation into the srngle-stranded phage vector M13mp9 of Messing et at. (1981). This fragment was sequenced by the method of Sanger et al. (1977). To end-label the Bs-RNAase Ill cleavage products, about 40 pmole RNAs generated by cleavage was dephosphorylated in a 50 ~1 reaction mixture containing 5 mM Tris (pH 7.9) and 150 U bacterial alkaline phosphatase (BAP) obtained from Bethesda Research Laboratories. The reaction mixtures were incubated at 60°C for 60 min, the BAP was removed by three successive treatments with phenol:chloroform (l:l), and the RNA was ethanol-precipitated. The RNA was 5’.end-labeled in a reaction mixture containing 30 mM Tris (pH 7.4) 7 mM MgCb, 5 mM dithiothreiotol, 10&r of a-=P-ATP, and 20 U T4 polynucleotide kinase (New England Nuclear Corp.). The reaction was heated at 90°C for 2 min and then cooled in an Ice-water bath prior to the addition of ATP and krnase. After addltron of these, the mixture was kept on ice for 30 mm, an additional 10 U kinase was added, and the preparations were transferred to a 37°C water bath for an additional 30 min of incubation. The RNA was precipitated with ethanol and the labeled products were separated on 6% and 12% polyacrylamide RNA gels. The RNA was eluted from the gel and sequenced by the method of Donis-Keller et al. (1977).

6sRNAase 913

III Cleavage

Sites

Sl mapping RNA-DNA hybridization was carried out essentially by the method o Dubnau et al. (1981). Restriction fragments used in the RNA-DNA hybrfdi. zation were labeled at the 5’ end as described by Maxam and Gilbert (1980). Hybridization mixtures contained 5 pmole end-labeled DNA; the indicated amounts of in vitro-synthesized RNA were treated with Bs-RNAase Ill or RNA synthesized by SP82-infected B. subtilis in the presence of chloramphenicol, 80% formamide. 40 mM Pipes buffer (pH 6.4) 400 mM NaCI, and 1 mM EDTA in a total volume of 10 ~1. Reactions were heated at 85‘C for 10 min, incubated at 48°C for 3 hr, diluted with 0.2 ml of a solution containing 280 mM NaCI, 30 mM sodium acetate (pH 5.0) 4.5 mM zinc acetate, 20 pg/ml denatured calf thymus DNA, and 300 U/ml Sl nuclease (Bethesda Research Laboratories), and incubated at 30°C for 15 min. The samples were then precipitated with ethanol. After addition of 5 ag of carrier E. coli tRNA, the samples were precipitated with 3 vol ethanol as described for the purification of DNA fragments, and analyzed by electrophoresis on 8% sequencing gels. Acknowledgments Thus research was supported by Public Health Service grants GM-20784 and GM-26100 from the National Institute of General Medical Science. Antonito Panganrban was supported by the Molecular and Cellular Biology Training Program, grant GM-07270. H. R. Whiteley is a recipient of Research Career Award K6-GM-442 from the National Institute of General Medical Sciences. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” rn accordance with 18 USC. Section 1734 solely to indicate thus fact. Received

March

References tRNA precursor

processing

Gottesman,

of ribosomal

M., Oppenheim,

COntrOl of gene expression

RNA in E. co/i. J. Biol. Chem. 252, 3064

A.. and Court, D. (1982). Retroregulation: from sites distal to the gene. Cell 29, 727-728.

Guameros. G., and Galindo, J. M. (1979). The regulation of integrative recombination of the b2 region and cll gene of bacteriophage lambda. Virol. 95, 119-126. Lawrie, J. M., and Whiteley, H. R. (1977). Localization of transcripts produced in viva and in vitro on phage SP82 genome. Gene 2. 251-262. Lawrie, J. M., Spiegelman. G. B., and Whiieley, H. R. (1976). DNA strand specificity of temporal RNA classes produced during infection of Bacillus subtilis by SP82. J. Virol. 19, 359-373. Loughney, K., Lund, E., and Dahlberg, J. E. (1982). tRNA genes are found between the 16s and 23s rRNA genes in Bacillus subfilis. Nucl. Acids Res. 70, 1607-1624. Lozoron, H. A., Dahlberg. J. E., and Szybalski, W. (1976). Processing the major leftward mRNA of coliphage lambda. Virol. 71, 262-277.

of

Lozoron, H. A., Anevski, P. J., and Apirion, D. (1977). Antitermination and absence of processing of the leftward transcript of coliphage lambda in the RNase Ill-deficient host. J. Mol. Biol. 109, 359-365. Maxam. A. M., and Gilbert, W. (1980). Sequencing end-labeled base-specific chemical cleavages. Meth. Enzymol. 64, 499-559. Messing, J., Crea, R., and Seeberg, R. (1981). A system sequencing. Nucl. Acids Res. 9, 309-321.

DNA with

of shotgun

Oakley, J. L., and Coleman, J. E. (1977). Structure of a promoter RNA polymerase. Proc. Nat. Acad. Sci. USA 74, 4266-4270.

DNA for T7

Panganiban, A. T., and Whiteley, H. R. (1981). Analysis of bacteriophage SP82 major “early” in vitro transcripts. J. Virol. 37, 373-382. Robertson, H. D., and Barany. F. (1979). Enzymes and mechanisms In RNA processing. In Proceedtngs of the 12th FEBS Congress. (Oxford: Pergamon Press), pp. 285-295.

1, 1983; revised April 20, 1983

Altman, S. (1971). lsolatron of tyrosine New Biol. 229, 19-21.

primary 3073.

molecules.

Nature

Barry, G.. Squares. C., and Squires, C. L. (1960). Attentuation and processrng of RNA from the rplJL-rpoBC transcription unit of Escherichia co/i. Proc. Nat. Acad. Sci. USA 77, 3X31-3335. Bott. K. F., and Hollis, M. A. (1982). Nucleotide sequence of intergenic spacer DNA of three 165-235 RNA gene sets from 8. sublilis. In Molecular Cloning and Gene Regulation in Bacilli, A. T. Ganesan, S. Chang, and J. A. Hoch, eds. (New York: Academic Press), pp. 3-10.

Robertson, H. D.. Webster, R. E., and Zinder, N. D. (1968). Purification and properties of RNAse III from Escherichia co/r. J. Biol. Chem. 243, 82-91. Robertson, H. D., Dickson, E., and Dunn, J. J. (1977). A nucleotide sequence from a ribonuclease Ill processing site in bacteriophage T7 RNA. Proc. Nat. Acad. Sci. USA 74, 822-826. Rosenberg, M., and Kramer, R. A. (1977). Nucleotide a ribonuclease Ill processrng site in bacteriophage Acad. Sci. USA 74, 984988

sequence surrounding T7 RNA. Proc. Nat.

Sanger. F., Nicklen, S., and Coulsen. A. R. (1977). DNA sequencing chain-termrnating inhibrtors. Proc. Nat. Acad. Sci. USA 74, 54636467.

with

Bram, R. J., Young, R. A., and Steitz, J. A. (1980). The ribonculease III site flanking 23s sequences in the 30s ribosomal precursor RNA of E. coli. Cell 79.393401.

Shine, J., and Delgarno. L. (1974). The d-terminal sequenceof Escherichia co/i 16s ribosomal RNA: complementarity to nonsense triplets and ribosome binding sites. Proc. Nat. Acad. Sci. USA 77, 1342-1346.

Crouch, R. J. (1974). Ribonuclease Ill does not degrade deoxyribonucleic acid-ribonucleic acid hybrids. J. Biol. Chem. 249, 1314-1316.

Smith, H. A., and Eirnsteil, M. L. (1976). A simple method for DNA restriction site mapping. Nucl. Acids Res. 3, 2387-2398.

Dahlberg, A. E., Dahlberg, J. E., Lund, E., Tokimatsu, H.. Rabson, A. B., Calvert, P. C., Reynolds, F.. and Zahalak, M. (1978). Processing of the 5end of Escherichia co/i 16s ribosomal RNA. Proc. Nat. Acad. Sci. USA 75, 3598-3602.

Sogin, M. L., Pace, B., and Pace, N. R. (1977). Partial purification and properties of a ribosomal RNA maturation endonuclease from Bacillus subtilis. J. Biol. Chem. 257, 3480-3488.

Donis-Keller, H.. Maxam, A. M., and Gilbert, W. (1977). Mapping adenines, guanines and pyrimidines in RNA. Nucl. Acrds Res. 4, 2527-2538.

Steitz, J. A. (1979). Genetic signals and nucleotide RNA. In Brological Regulation and Development (New York: Academic Press) pp. 349-399.

sequences In messenger 1. R. F. Goldberger. ed.

Downard, J. S.. and Whrteley, H. R. (1981). Early RNAs in SP82- and SPOlInfected cells may be processed. J. Viral. 37, 1075-1078.

Studier, F. W. (1973). Analysis of bacteriophage on slab gels. J. Mol. Biol. 79, 237-248.

early RNAs and proteins

Dubnau. E., Ramakrishna, N., Cabane, K., and Smith, I. (1981). Cloning of an early sporulation gene in Bacillus subtilis. J. Bacterial. 147, 622-632.

Tinoco, I., Borer, P. N.. Dengler, B., Levina, M. D., Uhlenbeck, 0. C., Crothers, D. M.. and Gallo, J. (1973). Improved estimation of secondary structure in ribonucleic acids. Nature New Biol. 246, 40-41.

Dunn, J. J. (1976). RNAse Chem. 251. 3807-3814.

Ill cleavage

of single-stranded

RNA. J. Biol.

Dunn, J. J., and Studier, F. W. (1973). T7 early RNAs are generated specific cleavages. Proc. Nat. Acad. Sci. USA 70. 1559-1563. Gegenheimer, P., and Apirion, D. (1981). nucleic acid. Microbial. Rev. 45, 502-541. Gegenheimer,

P., Watson,

Processing

by site

of procaryotic

N., and Apirion. D. (1977). Multrple pathways

ribofor

Young, R., and Stertz. J. (1978). Complementary sequences trdes apart form a ribonuclease Ill cleavage site in Escherichia precursor RNA. Proc. Nat. Acad. Sci. USA 75, 3593-3597.

1700 nucleoco/i ribosomaf