- Email: [email protected]
Bacterial endotoxin lipopolysaccharide induces up-regulation of glyceraldehyde-3-phosphate dehydrogenase in rat liver and lungs
Life Sciences 79 (2006) 1820 – 1827 www.elsevier.com/locate/lifescie
Bacterial endotoxin lipopolysaccharide induces up-regulation of glyceraldehyde-3-phosphate dehydrogenase in rat liver and lungs Wenguang Xie a,⁎, Ningsheng Shao b,⁎, Xiaochang Ma c , Baodong Ling a , Yushu Wei a , Qinxue Ding b , Guang Yang b , Nongle Liu b , Huixin Wang b , Keji Chen c a
c
Affiliated Hospital, North Sichuan Medical College, Nanchong 637000, China b Beijing Institute of Basic Medical Sciences, Beijing 100850, China Xiyuan Hospital, China Academy of Chinese Medical Sciences, Beijing 100091, China Received 20 December 2005; accepted 10 June 2006
Abstract Bacterial endotoxin or lipopolysaccharide (LPS) can trigger inflammatory responses and cause damage in organs such as liver and lungs when it is introduced into mammals, but the exact molecular events that mediate these responses have remained obscure. In this study, by using 2D gel electrophoresis and cDNA microarray analysis, we found that both protein and mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were significantly increased in rat liver and lungs after treatment with LPS. The results were further confirmed by Western blot and Northern blot. Given the known role of GAPDH in inducing apoptosis, our results suggest that LPS-induced GAPDH up-regulation may be an important mechanism responsible for the damage induced by Gram negative bacteria in mammalian tissue and GAPDH may be involved in the signaling pathway of LPS induced apoptosis. Our results also demonstrate that GAPDH is not a suitable internal control in gene expression studies, especially when bacterial infection is involved. © 2006 Elsevier Inc. All rights reserved. Keywords: Expression; GAPDH; Liver; LPS; Lungs; Rat
Introduction Sepsis caused by Gram negative bacteria and subsequent multiple organ failure are common complications among hospitalized patients and immunosuppressed individuals. Lipopolysaccharide (LPS), a constituent of the outer membrane of the bacterial cell wall, is one of the major causative agents of endotoxic shock and organ failure. Upon first binding to lipopolysaccharide binding protein (LBP) in the plasma and then to CD14, a 55-kDa glycosylphosphatidylinositol (GPI)anchored protein which is expressed in monocytes, macrophages and endothelial cells, LPS induces the transcription of a variety of inflammatory cytokine genes such as tumor necrosis factor-α (TNF-α), interleukin-1 (IL-1), interferon (IFN), as well as anti-inflammatory cytokine genes such as interleukin-4 ⁎ Corresponding authors. Fax: +86 10 68163140. E-mail addresses: [email protected] (W. Xie), [email protected] (N. Shao). 0024-3205/$ - see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.lfs.2006.06.018
(IL-4), interleukin-6 (IL-6), interleukin-10 (IL-10), and interleukin-11 (IL-11). Recent studies showed that the toll-like receptor-4/myeloid differentiation-2/cluster of differentiation14 (TLR4/MD-2/CD14) complex was the core molecule involved in LPS recognition (Roberts, 2005; Triantafilou and Triantafilou, 2005). In septic shock, other mediators such as nitric oxide and eicosanoids are also responsible for most manifestations caused by LPS (Bone, 1996). Although it is known that LPS recognition involves a complex biological cascade, the details of the signal transduction pathways underlying LPSinduced inflammatory responses have remained obscure. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a glycolytic enzyme with a molecular weight of 37 kDa. Active GAPDH is usually isolated as a homotetramer of approximately 150kDa which binds four NAD+ molecules at individual active sites on each subunit. Besides its well known roles in energy production, GAPDH has been shown to be involved in various other physiological and pathophysiological functions such as membrane fusion (Hessler et al., 1998), microtubule bundling
W. Xie et al. / Life Sciences 79 (2006) 1820–1827
1821
SD-IGS rats (200 ± 10 g) were obtained from Beijing Weitonglihua experimental animal company. All animals were starved for 12 h but allowed free access to water before experiments. The animals were divided into two groups, five animals in each group (n = 5). One group was treated with LPS (Sigma) (5 mg/kg body weight) in saline by intravenous injection, and the other group was treated with saline alone as control. Twenty-four hours after treatment, all rats were killed and livers and lungs were rapidly removed and frozen at − 80°C.
centrifuged again for 45 min at 150,000×g at 4 °C. Then the upper layer of the supernatant, which contained the lipid, was removed and the middle layer, which contained the proteins, was carefully collected and centrifuged for 50min at 40,000×g at 4°C. An aliquot of the supernatant was used for determination of protein concentration using Bradford's assay. 2D electrophoresis was performed as described previously (Jin et al., 2003). Briefly, 500μg of protein sample in 350 μl buffer (8 M urea, 2% CHAPS, 1% DTT) was subjected to isoelectric focusing with the IPGphor system (Amersham Pharmacia Biotech, Uppsala, Sweden). Immobiline™ DryStrips (pH 3–10, L 18cm) (Amersham Pharmacia Biotech, Uppsala, Sweden) were rehydrated for 10 h using reswelling buffer (8M urea, 2% CHAPS, 1% DTT) and IPG buffer (0.5%). After completion of the focusing, the IEF strips were stored immediately at − 80 °C. Second dimension SDS-PAGE was carried out on the Ettan DALT System using 12.5% gels (Amersham Pharmacia). The strips were first equilibrated for 15min in an aqueous solution containing 50 mM Tris, 6 M urea, 30% (w/w) glycerol, 2% (w/w) SDS, 65 mM DTT, pH 8.8, and then for an additional 15 min in a solution containing 50mM Tris, 6M urea, 30% (w/w) glycerol, 2% SDS, 135 mM iodoacetamide, pH 8.8. Low molecular weight standards (Amersham Pharmacia Biotech) were run along the IEF strips. The second dimension SDS-PAGE was run at 1000 V and 20mA for 30 min. After removal of the IEF strip, the electrophoretic conditions were changed to 1000 V and 40 mA for 165 min. During the process, the water circulation was maintained at + 13 °C. After completion of the second dimension electrophoresis the gels were stained with 0.1% (w/v) Coomassie Blue G-250 in 50% methanol and 10% acetic acid according to wellestablished protocols and gel images were processed using ImageScanner and ImageMaster®2D Elite software (Amersham Pharmacia Biotech). Data were analyzed with t-test.
Measurement of endotoxin levels in tissues
In-gel digestion
Tissue samples were immediately homogenized in cold saline and then treated with perchloric acid (PCA) to remove nonspecific activators or inhibitors in the lysate. The endotoxin levels were measured by the chromogenic Limulus Amebocyte Lysate (LAL) assay as described previously (Fang et al., 2002). Statistical evaluation was done with t-test when the data were confirmed as homoscedastic with F-test first, or Wilcoxon test when they were not.
Coomassie Blue-stained gel spots of interest were excised from the gels and extensively washed with 50 mM NH4HCO3 in 50% (v/v) acetonitrile (MeCN) for 30min. Gel pieces were then dried in a SpeedVac Vacuum and rehydrated at 4 °C for 30 min in 2 μl digestion solution (20 mM NH4HCO3, pH 7.8, containing 0.01 μg/μl of modified trypsin). Exhaustive digestion was carried out overnight at 37 °C. The digestion was extracted with 5% trifluoroacetic acid (TFA) for 1h at 37 °C and then with 2.5% TFA/50% v/v acetonitrile for 1h at 30 °C. The combined supernatants were evaporated in the SpeedVac Vacuum and the pellet dissolved in 2μl 0.5% aqueous TFA for mass spectrometric analysis.
(Volker and Knull, 1997), RNA binding and cleaving (Singh and Green, 1993; Nagy and Rigby, 1995; Nagy et al., 2000; Evguenieva-Hackenberg et al., 2002), as well as age-related neurodegenerative diseases (Mazzola and Sirover, 2003). It has intrinsic phosphotransferase activity (Engel et al., 1998) and can improve the efficacy of ribozymes in the cells (Sioud and Jespersen, 1996). Antisense oligonucleotides to GAPDH prevent nuclear translocation of GAPDH and reduce cytotoxicity (Sawa et al., 1997; Saunders et al., 1997). GAPDH has also been found to be involved in apoptosis (Sirover, 2005). Additionally, induction of apoptosis in cultured cells of a fibroblast and a neuroblastoma line not only increased translocation of GAPDH into the nucleus, but also resulted in increased total levels of GAPDH (Dastoor and Dreyer, 2001). In this study, by using 2D gel electrophoresis and cDNA microarray analysis, we found for the first time that both the protein and mRNA levels of GAPDH in rat liver and lungs were increased when animals were treated with LPS. Our results suggest that GAPDH may be an important component in the signaling pathway of LPS induced apoptosis. Materials and methods Treatment of animals
2D electrophoresis Small aliquots of liver and lung tissues (same parts for five animals) were ground and exposed to pre-chilled lysis buffer (5M urea, 2 M thiourea, 2% 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate (CHAPS), 2% n-decyl-n,ndimethyl-3-ammonio-1-propane sulfonate (SB) 3–10, 1% DTT, 35mg/l PMSF, 0.3 g/l EDTA, 0.7mg/l aprotinin and 0.5 mg/l leupeptin), then homogenized with a Diax900 homogenizer (Heidolph, Germany). The samples were centrifuged for 10 min at 10,000×g at 4°C. The supernatant was collected and
Table 1 Endotoxin levels in tissues (x¯ ± s, EU/g) Tissue
Control group
LPS group
Liver Lung
1.86 ± 3.47 6.01 ± 4.19
1.06 ± 1.34 34.36 ± 20.05 ⁎
⁎ Compared with control group, P < 0.001.
1822 W. Xie et al. / Life Sciences 79 (2006) 1820–1827 Fig. 1. Pictures of the 2D electrophoresis display the protein pattern of the homogenates of liver and lungs. (I) Complete picture of the 2D electrophoresis displays the protein pattern of liver homogenate from rats challenged with LPS. (II) Complete picture of the 2D electrophoresis displays the protein pattern of lung homogenate from rats challenged with LPS. (III) Close-up pictures of the protein pattern increased both in the homogenate of liver and lungs. (A) Protein spots from a control liver sample; (B) protein spots from an LPS-treated liver sample; (C) protein spots from a control lung sample; (D) protein spots from an LPS-treated lung sample. The protein spot that showed increased signal both in liver and lungs is indicated by arrow.
W. Xie et al. / Life Sciences 79 (2006) 1820–1827
Peptide mass fingerprinting by MALDI-TOF-MS All mass spectra of MALDI-TOF-MS were obtained on a Bruker REFLEX III MALDI-TOF-MS (Bruker-Franzen, Bremen, Germany) in positive ion mode at an accelerating voltage of 20kV with the matrix of α-cyano-4-hydroxycinnamic acid. The spectra were internally calibrated using trypsin autolysis products. PMF obtained was used to search through the SWISS_PROT and NCBInr database by the Mascot search engine (http://www.matrixscience.co.uk) with a tolerance of ± 0.1 D and one missed cleavage site.
1823
membrane was blocked with T-TBS solution (20 mM Tris, 150mM NaCl, 0.05% Tween-20, pH 7.5) containing 5% dry milk and then incubated overnight at 4 °C with anti-GAPDH monoclonal antibody (1:5000 dilution in T-TBS/5% dry milk, Kangcheng Biological Inc, Shanghai, China). After being washed with T-TBS, the membrane was incubated with peroxide conjugated anti-mouse IgG secondary antibody (Pierce) (1:7500 dilution in T-TBS) for 1.5 h at room temperature. The spots were visualized by using SuperSignal West Pico Chemiluminescent Substrate Kit (Pierce) according to the manufacturer's procedure. The statistical significance of the data was evaluated with t-test.
Production of cDNA microarrays The cDNA microarrays were prepared at the CapitalBio Corporation, National Engineering Research Center for Beijing Biochip Technology. Each array contained all the cDNA clones corresponding to proteins altered in 2D electrophoresis and genes involved in the LPS signaling pathway such as LBP, TLR2, CD14, MD-2, MyD88, TNF receptor associated factor-2 (TNFRAF-2), TNF receptor associated factor-4 (TNFRAF-4), NF-κB1 and iNOS. Each cDNA clone was printed in triplicates onto chemical modified glass slides. Rat genomic DNA was used as positive hybridization control and normalization standard. Oligo127, oligo125 and oligo104 from Arabidopsis thaliana were used as external control, 50% DMSO was used as negative control. Preparation of total RNA and microarray hybridization Total RNA was extracted by using the Trizol reagent according to the manufacturer's instructions. After Trizol purification, RNA was further purified with RNeasy mini spin column Kit (Qiagen). RNA was then reverse-transcribed into cDNA with Oligo(dT)15 (Promega) as primer and Superscript II choice for cDNA synthesis (Invitrogen) and subsequently labeled in red (Cy5) or in green (Cy3) (Amersham Pharmacia). Microarray hybridization was performed by CapitalBio Corporation, National Engineering Research Center for Beijing Biochip Technology. The chips were scanned with a ScanArray Express dual laser Scanner (Packard Bioscience). Data acquisition was performed with GenePix Pro 4.0 software (Axon Instruments). Each gene had six ratio values and statistic analysis was done with ttest. Normalized and averaged fluorescence ratios of genes were used to calculate the increase and decrease of expression in samples derived from LPS challenged animals compared with samples derived from control animals. A given gene was considered changed when the difference between means was significant (P < 0.01).
Preparation of radiolabeled cDNA probes for GAPDH and rat 18S rRNA One microgram of total RNA was converted to DNA probes by RT-PCR. The forward and reverse primers (5′–3′) for GAPDH gene are TGCTGAGTATGTCGTGGAG and GTCTTCTGAGTGGCAGTGAT respectively. The forward and reverse primers (5′–3′) for 18S rRNA are CTTAGAGGGACAAGTGGCG and GGACATCTAAGGGCATCACA respectively. All the cDNA probes were radiolabeled with [32P]-dCTP by Rediprime™ DNA Labeling System (Amersham Pharmacia). Northern blot hybridization Twenty micrograms of RNA was separated on formaldehyde-agarose gels, transferred onto Hybond N membranes (Amersham Pharmacia) and then cross-linked in UV Stratlinker 2400. Blots were hybridized with radiolabeled cDNA probes for GAPDH and rat 18S rRNA. After washing with SSC/SDS washing solution, the membrane was exposed to X-ray films (Kodak) at − 70 °C. Autoradiographic signals were quantified by densitometric analysis with ImageMaster® 2D Elite3.10 image analysis software (Amersham Pharmacia). Statistical evaluation was done with t-test. Results Tissue distribution of LPS Different endotoxin levels in tissues may induce different gene expression profiles and cause different degrees of damage Table 2 Identification of the protein spot increased both in liver and lungs in 2D electrophoresis (x¯ ± s) Tissue
Test a
Control group
LPS group
Liver
Vol. Mr pI Vol. Mr pI
18,348 ± 7637 34,563 ± 545 7.68 ± 0.05 3908 ± 2017 33,110 ± 1934 8.15 ± 0.10
38,369 ± 16,087 ⁎⁎ 34,494 ± 533 7.65 ± 0.05 17,711 ± 4779 ⁎⁎ 31,863 ± 26 8.06 ± 0.05
Western blot analysis The protein samples (50 μg) obtained from liver and lungs were subjected to electrophoresis in 10% SDS-PAGE at 100 V. Electrophoretic transfer was then carried out using a 0.2 μm ECL membrane (Pierce) at 100 V for 1 h. The
Lung
a Vol.: observed volume, Mr: molecular mass and pI: isoelectric point. ⁎⁎ Compared with control group, P < 0.001.
1824
W. Xie et al. / Life Sciences 79 (2006) 1820–1827
Table 3 MALDI-TOF identification of the changed spots in liver and lungs Tissue Protein identification Liver Lung a
Mr a
pI a
difference in LPS levels in livers of LPS-treated and non-treated animals (Table 1).
Peptide Sequence Expect matched/ coverage submitted
Ca3 (gi|2118293) 29,383 6.49 5/18 GAPDH (gi|8393418) 35,805 8.14 5/13 GAPDH (gi|8393418) 35,805 8.14 6/26
33% 30% 28%
0.0013 0.00077 0.013
Theoretical Mr: molecular mass and pI: isoelectric point.
to tissues. We first measured the LPS levels in liver and lungs 24 h after the rats had been treated with LPS. The levels of LPS in lungs of LPS-treated rats were significantly higher than in those of control animals (P < 0.001). There was no significant Table 4 Genes up-regulated in both liver and lungs of rats treated with LPS GB_accession/Unigene ID
Gene description
NM_017208 Rn.46387 AY197554 Rn.37341
Lipopolysaccharide binding protein (Lbp) Toll-like receptor 2 variant 1 (Tlr2) Myeloid differentiation protein 2 (MD-2) Myeloid differentiation primary response gene 88 (Myd88) Nitric oxide synthase 2 (inducible nitric oxide synthase, iNOS) Glyceraldehyde-3-phosphate dehydrogenase (gapdh, gapd) Tumor necrosis factor superfamily member 2 (TNFα, Tnf) Interleukin 1 beta (Il1β, Il1b) Interleukin 2 (IL-2, Il2) Interleukin 12b (IL-12, Il12b) Interferon gamma (IFNγ, IFNg) Integrin beta-2 precursor (CD18, Itgb2) C-reactive protein (CRP, Crp) Lactate dehydrogenase A (LDHA, Ldha) Mannose binding protein A (Mbpa, Mbl1) Granule bound starch synthase (waxy) Interleukin 4 (IL-4, Il4) Colony stimulating factor 1 (macrophage, Csf1) Serine protease inhibitor (Spin2c) Annexin 1 (p35) (Lipocortin 1) (Anxa1) Alpha-1-acid glycoprotein (Orm1) Superoxide dismutase 2 (SOD2, Sod2) Plasminogen activator inhibitor-1 (PAI-1, Serpine1) Scavenger receptor class B (Scarb1) Decay-accelerating factor (Daf1) Haptoglobin-like Ba1-647 (Hp) Nucleoside diphosphate kinase (Nme2) Guanine deaminase (Gda) Similar to Aldh8a1 protein (LOC308927, Aldh8a1) Similar to RIKEN cDNA 1810060J02 (LOC312863) Similar to RIKEN cDNA 2300002G02 (LOC293481, Tufm) Similar to hypothetical protein KIAA0934 (LOC307067) Similar to terminal deoxynucleotidyl transferase long isoform (Dntt) Calcium channel alpha-1-H subunit (Cacna1g)
NM_012611 NM_017008 NM_012675 NM_031512 M22899 NM_022611 AF010466 Rn.42962 NM_017096 NM_017025 NM_012599 AB089141 X16058 AF515736 NM_031531 NM_012904 Rn.10295 Rn.10488 Rn.29367 D89655 AF039584 AF476963 AY325231 NM_031833 NM_031776 Rn.44523 XM_232540 Rn.48850 Rn.45453 Rn.109111 AF290213
Identification of GAPDH protein expression in rat liver and lungs by 2D gel electrophoresis To identify changes in protein expression after the treatment with LPS, we carried out 2D gel electrophoresis with liver and lung tissue protein extracts. We reproducibly detected more than 600 protein spots on 2D gel after silver staining. The number of protein spots with significant change in signal intensity was 43 in the liver and 11 in the lungs (data not shown), among which only one protein spot showed increased signal in both liver and lung (Fig. 1). Gel image analysis using ImageMaster® 2D Elite software showed that levels of the changed protein in LPStreated rat liver and lungs were significantly higher than that of the control tissues (P < 0.001) (Table 2). After in-gel digestion and MALDI-TOF-MS analysis, the protein spot in 2D gel electrophoresis of rat lungs was exactly matched to GAPDH. However, the protein spot in 2D gel electrophoresis of rat liver was matched to two different proteins, GAPDH and carbonic anhydrase 3 (Ca3) (Table 3).
Table 5 Genes up-regulated in liver and unaffected in lungs of rats treated with LPS GB_accession/ Unigene ID
Gene description
AF057025 L26267 AJ011116 NM_012589 Rn.20418 NM_017277 NM_021578 Z75029 NM_031971 NM_031580 NM_030863 NM_012548 Rn.10972 NM_017350 Rn.1780 NM_031000 Rn.13492 D16478 NM_013054
Toll-like receptor 4 (TLR4, Tlr4) Nuclear factor kappa B p105 subunit (NFκB, Nfκb1) Nitric oxide synthase 3 (eNOS, Nos3) Interleukin 6 (interferon beta 2, IL-6, Il6) Heat shock transcription factor 1 (Hsf1) Adaptor protein complex AP-1, beta 1 subunit (Ap1b1) Transforming growth factor, beta 1 (Tgfb1) Hsp70.2 mRNA for heat shock protein 70 (Hspa5) Heat shock protein 70-1 (HSPa1a, Hspa1a) Glucose regulated protein, 58kDa (Grp58) Moesin (Msn) Endothelin 1 (Edn1) Proteasomal ATPase (SUG1, Sug1) Urokinase receptor (CD87, Plaur) Sulfated glycoprotein 2 (Clu) Aldo-keto reductase family 1, member A1 (Akr1a1) Malate dehydrogenase 1 (Mdh1) Hydroxyacyl-Coenzyme A dehydrogenase (Hadha) Tryptophan 5-monooxygenase activation protein zeta polypeptide (Ywhaz) Scavenger receptor class B type 2 (Scarb2) Similar to DnaJ homolog subfamily B member 1 (LOC298138, Dnajb1) Similar to KIAA1912 protein (LOC289855, RGD1311700) Similar to TNF receptor associated factor 4 (LOC303285) Similar to Trad (LOC303375, Rad51l3) Hemopexin (Hpx) Fibrinogen, A alpha polypeptide (Fga) Fibrinogen B beta polypeptide (Fgb) Class I beta-tubulin (Tubb5) Keratin 5 (Krt5, Krt2-5) Beta actin (Actb)
AY682847 Rn.92270 Rn.104838 XM_220640 XM_220773 M62642 X86561 M35602 Rn.2458 NM_183333 NM_031144
W. Xie et al. / Life Sciences 79 (2006) 1820–1827
1825
Table 6 Genes unaffected in liver and up-regulated in lungs of rats treated with LPS
Table 8 Genes down-regulated in liver and unaffected in lungs of rats treated with LPS
GB_accession/Unigene ID
Gene description
GB_accession/Unigene ID
Gene description
NM_021744 Rn.1437 Rn.105232 Rn.54465 D17310
CD14 antigen (Cd14) Group specific component (Gc) Similar to TNF receptor associated factor 2 (Traf2) Integrin beta 2 alpha subunit (Itgam) 3-Alpha-hydroxysteroid dehydrogenase (LOC191574) Transferrin receptor (Tfrc) Tissue plasminogen activator (tPA, Plat)
AF049878 NM_012854 NM_019292 NM_013078 NM_031031 NM_012793 AF106945 Rn.100922 XM_346852
Amyloid beta-peptide binding protein (Hadh2) Interleukin 10 (IL-10, Il10) Carbonic anhydrase 3 (Ca3) Ornithine carbamoyltransferase (Otc) Glycine amidinotransferase (Gatm) Guanidinoacetate methyltransferase (Gamt) Peroxiredoxin 4 (Prdx4) Similar to BIMP1 (LOC315120, Card10) Hypothetical protein XP_346852 (Myo1b)
M58040 NM_013151
Confirmation of GAPDH gene expression in rat liver and lungs by cDNA microarrays To confirm the expression changes found in the results of 2D gel electrophoresis, we further prepared cDNA microarrays containing the above-mentioned 54 cDNA clones altered in the 2D gel electrophoresis and some genes involved in LPS signaling pathways reported previously to observe the gene expression in mRNA level in rat liver and lungs. Microarray hybridization results showed that the expression of 45 genes was significantly altered both in the liver and lungs (P < 0.01), including the up-regulation of many LPS signaling pathwayrelated genes, such as LBP, TLR2, MD-2, MyD88, iNOS, IL1β, IL-2, IL-4, IL-12b and IFN (Table 4). Importantly, GAPDH was reproducibly up-regulated both in the liver and lungs. Compared with control groups, about a two-fold increase of GAPDH mRNA levels was observed in both the liver and lungs of LPS challenged animals (1.98 ± 0.58 in liver; 2.43 ± 0.62 in lungs). Some LPS-signaling-related genes were significantly up-regulated (P < 0.01) only in the liver or only in the lungs, such as CD14, TNFRAF-2, TNFRAF-4, IL-6 and NF-κB1 (Tables 5 and 6). Down-regulation of the metabolism-related genes induced by LPS was also found (Tables 7–9), and the Ca3 gene was one of those genes significantly down-regulated only in liver after LPS treatment (Table 8).
Table 9 Genes down-regulated in lungs and unaffected in liver of rats treated with LPS GB_accession/ Unigene ID
Gene description
Rn.32263 U00620
Mercaptopyruvate sulfur transferase (Mpst) Colony stimulating factor 2 (granulocyte-macrophage) (Csf2) Highly similar to MCT2_RAT Mast cell protease II precursor (Mcpt2) Urinary plasminogen activator (Plau) Myosin heavy chain 11 (Myh11)
J02712 NM_013085 NM_031520
Western blot analysis of GAPDH expression in the rat liver and lungs To further confirm the up-regulation of GAPDH protein in the rat liver and lung, we carried out Western blot analysis with protein preparations from LPS-treated and saline-treated rat tissues by using an anti-GAPDH monoclonal antibody. The GAPDH protein level was significantly increased in both the liver and lungs after treating the animals with LPS compared with the control group (P < 0.0001). Compared with the levels of GAPDH protein in control tissues, a 2-fold increase was found in the liver and a 4-fold increase in the lungs (Fig. 2). Northern blot analysis of GAPDH mRNA expression in rat liver and lungs
Table 7 Genes down-regulated in both liver and lungs of rats treated with LPS GB_accession/Unigene ID
Gene description
NM_138884 J02582 NM_031127 NM_030850 NM_031509 Rn.6302
Aldo-keto reductase family 1 member D1 (Akr1d1) Apolipoprotein E (Apoe) Sulfite oxidase (Suox) Betaine-homocysteine methyltransferase (Bhmt) Glutathione-S-transferase, alpha type (Ya) (Gsta1) Acyl coenzyme A dehydrogenase medium chain (Acadm) Arginosuccinate synthetase 1 (Ass) Catalase (Cat) Aldehyde dehydrogenase 2 (Aldh2) Glutathione-S-transferase, mu 1 (Gstm1) NADH dehydrogenase 1 alpha subcomplex 10-like protein (Ndufa10) Insulin-like growth factor 1 (Igf1)
M36708 NM_012520 Rn.101781 Rn.93760 Rn.102304 M15481
Northern blot analysis of GAPDH mRNA expression in rat liver and lungs after LPS stimulation is shown in Fig. 3. Consistent with the up-regulation of GAPDH protein, the GAPDH mRNA level was significantly increased in both the liver and lungs in the animals treated with LPS compared with
Fig. 2. Western blot analysis of GAPDH protein expression in rat liver and lungs. Equal amounts (50 μg) of protein samples obtained from liver and lungs were subjected to Western blot analysis.
1826
W. Xie et al. / Life Sciences 79 (2006) 1820–1827
Fig. 3. Northern blot analysis of GAPDH mRNA expression in rat liver and lungs. Twenty micrograms of RNA was separated in formaldehyde-agarose gels and transferred onto Hybond N membranes. Blots were hybridized with radiolabeled cDNA probes for GAPDH and rat 18S rRNA.
the control group (P < 0.0001), but the 18S rRNA level was unchanged. The Northern blot results were also consistent with results of the microarrays. Discussion LPS can trigger inflammatory responses and cause damage in organs such as liver and lungs when it is introduced into mammals, but the exact molecular events that mediate these responses have remained unknown. In this study, by using 2D gel electrophoresis and MALDI-TOF-MS analysis, we found that GAPDH expression was significantly increased both in the liver and lungs of rats that had been treated with LPS. Microarray analysis revealed that expression of GAPDH was reproducibly increased in the liver and lungs, while expression of Ca3 was decreased in the liver of LPS-challenged animals. Results of Western and Northern blot analyses confirmed that GAPDH was up-regulated in both the liver and lungs after LPS treatment. In addition to GAPDH, LPS could up-regulate many other genes involved in the LPS signal transduction, such as LBP, TLR2, CD14, MD-2, MyD88, TNFRAF-2, NF-κB1 and iNOS, suggesting that LPS-induced GAPDH expression may be an important mechanism responsible for the LPS-triggered apoptosis by following two signaling pathways. First, LPS may bind LBP and then form a complex with TLR2 or TLR4/MD-2/ CD14 to activate the jun N-terminal kinase (JNK) signal pathway via an adaptor protein MyD88. Second, the LPS-TLR2 or TLR4/MD-2/CD14 complex may activate NF-κB1 and iNOS via the adaptor protein MyD88 (Roberts, 2005; Triantafilou and Triantafilou, 2005; Aderem and Ulevitch, 2000). The activated JNK may induce gene expression of GAPDH (Tatton et al., 2003), and iNOS can induce post-translational protein modifications of GAPDH including an S-nitrosylation and a covalent, non-enzymatic NAD+ modification (Sirover, 2005; Tatton et al., 2003). Recently, it was reported that LPS induces iNOS, leading to S-nitrosylation of GAPDH, which enables GAPDH to bind to Siah1 and translocate to the nucleus in RAW264.7 cells, resulting in cell apoptosis but not necrosis (Hara et al., 2005). Thus, the observed up-regulation of GAPDH in livers and lungs of LPS-challenged animals in our study appears to be associated with an increased degree of apoptosis in these tissues. Whether these mechanisms are also involved in LPS mediated organ damage remains to be elucidated.
GAPDH is considered as a housekeeping gene like albumin, actin, tubulin, cyclophilin, 28S rRNA and 18S rRNA, which are widely used as internal controls for measuring gene expression (Goidin et al., 2001; Thellin et al., 1999; Zhong and Simons, 1999). It is assumed that GAPDH is constitutively expressed at similar levels in all cell and tissue types. However, accumulating evidence showed that the expression of these genes varies across different tissues and cell types, and at different stages during cell proliferation and development. In addition, the GAPDH mRNA level has been observed to be changed in response to various stimuli such as hypoxia, insulin, mitogens, epidermal growth factors and during cellular maturation (Tatton et al., 2003; de Kok et al., 2005). In present study, we found that the expression of GAPDH in rat liver and lungs was upregulated after LPS treatment, again demonstrating that GAPDH is not a suitable internal control in expression studies, especially in the case of bacterial infection. The fact that lung tissues of rats showed increased endotoxin levels 24 h after LPS challenge is interesting, since it is known that LPS is cleared very quickly from the blood. This raises the question where this endotoxin comes from, and whether this might additionally contribute to LPS mediated lung damage. Acknowledgements We thank Professor Yongming Yao in PLA 304 hospital, Professor Shaojun Liu and Professor Ning Guo in Beijing Institute of Basic Medical Sciences and Dr. Liang Zhang in the CapitalBio Corporation, National Engineering Research Center for Beijing Biochip Technology for their great help in this study. We thank Dr. Sheng Zhou in St. Jude Children's Research Hospital, Tennessee, USA for his kind suggestions about this manuscript. This work is supported by the Natural Science Foundation of China (Project Nos. 30271658, 30472286). References Aderem, A., Ulevitch, R.J., 2000. Toll-like receptors in the induction of the innate immune response. Nature 406, 782–787. Bone, R.C., 1996. Why sepsis trials fail. Journal of American Medical Association 276, 565–566. Dastoor, Z., Dreyer, J.L., 2001. Potential role of nuclear translocation of glyceraldehyde-3-phosphate dehydrogenase in apoptosis and oxidative stress. Journal of Cell Science 114, 1643–1653. de Kok, J.B., Roelofs, R.W., Giesendorf, B.A., Pennings, J.L., Waas, E.T., Feuth, T., Swinkels, D.W., Span, P.N., 2005. Normalization of gene expression measurements in tumor tissues: comparison of 13 endogenous control genes. Laboratory Investigation 85, 154–159. Engel, M., Seifert, M., Theisinger, B., Seyfert, U., Welter, C., 1998. Glyceraldehyde-3-phosphate dehydrogenase and Nm23-H1/nucleoside diphosphate kinase A: two old enzymes combine for the novel Nm23 protein phosphotransferase function. Journal of Biological Chemistry 273, 20058–20065. Evguenieva-Hackenberg, E., Schiltz, E., Klug, G., 2002. Dehydrogenases from all three domains of life cleave RNA. Journal of Biological Chemistry 277, 46145–46150. Fang, C.W., Yao, Y.M., Shi, Z.G., Yu, Y., Wu, Y., Lu, L.R., Sheng, Z.Y., 2002. Lipopolysaccharide-binding protein and lipopolysaccharide receptor CD14 gene expression after thermal injury and its potential mechanism(s). Journal of Trauma-Injury Infection and Critical Care 53, 957–967.
W. Xie et al. / Life Sciences 79 (2006) 1820–1827 Goidin, D., Mamessier, A., Staquet, M.J., Schmitt, D., Berthier-Vergnes, O., 2001. Ribosomal 18S RNA prevails over glyceraldehyde-3-phosphate dehydrogenase and beta-actin genes as internal standard for quantitative comparison of mRNA levels in invasive and noninvasive human melanoma cell subpopulations. Analytical Biochemistry 295, 17–21. Hara, M.R., Agrawal, N., Kim, S.F., Cascio, M., Fujimuro, B., Ozeki, M., Takahashi, Y., Cheah, M., Tankou, J.H., Hester, S.K., Ferris, L.D., Hayward, C.D., Snyder, S.D., Sawa, S.H., 2005. S-nitrosylated GAPDH initiates apoptotic cell death by nuclear translocation following Siah1 binding. Nature Cell Biology 7, 665–674. Hessler, R.J., Blackwood, R.A., Brock, T.G., Francis, J.W., Harsh, D.M., Smolen, J.E., 1998. Identification of glyceraldehyde-3-phosphate dehydrogenase as a Ca2+-dependent fusogen in human neutrophil cytosol. Journal of Leukocyte Biology 63, 331–336. Jin, B.F., He, J., Wang, H.X., Wang, J., Zhou, T., Lan, Y., Hu, M.R., We, K.H., Yang, S.C., Shen, B.F., Zhang, X.M., 2003. Proteomic analysis of ubiquitinproteasome effects: insight into the function of eukaryotic initiation factor 5A. Oncogene 22, 4819–4830. Mazzola, J.L., Sirover, M.A., 2003. Subcellular alteration of glyceraldehyde-3phosphate dehydrogenase in Alzheimer's disease fibroblasts. Journal of Neuroscience Research 71, 279–285. Nagy, E., Rigby, W.F., 1995. Glyceraldehyde-3-phosphate dehydrogenase selectively binds AU-rich RNA in the NAD(+)-binding region (Rossmann fold). Journal of Biological Chemistry 270, 2755–2763. Nagy, E., Henics, T., Eckert, M., Miseta, A., Lightowlers, R.N., Kellermayer, M., 2000. Identification of the NAD(+)-binding fold of glyceraldehyde-3-phosphate dehydrogenase as a novel RNA-binding domain. Biochemical and Biophysical Research Communication 275, 253–260. Roberts, M., 2005. Detoxifying endotoxin: time, place and person. Journal of Endotoxin Research 11, 69–84.
1827
Saunders, P.A., Chalecka-Franaszek, E., Chuang, D.M., 1997. Subcellular distribution of glyceraldehyde-3-phosphate dehydrogenase in cerebellar granule cells undergoing cytosine arabinoside-induced apoptosis. Journal of Neurochemistry 69, 1820–1828. Sawa, A., Khan, A.A., Hester, L.D., Snyder, S.H., 1997. Glyceraldehyde-3phosphate dehydrogenase: nuclear translocation participates in neuronal and nonneuronal cell death. Proceedings of the National Academy of Sciences of the United States of America 94, 11669–11674. Singh, R., Green, M.R., 1993. Sequence-specific binding of transfer RNA by glyceraldehyde-3-phosphate dehydrogenase. Science 259, 365–368. Sioud, M., Jespersen, L., 1996. Enhancement of hammerhead ribozyme catalysis by glyceraldehyde-3-phosphate dehydrogenase. Journal of Molecular Biology 257, 775–789. Sirover, M.A., 2005. New nuclear functions of the glycolytic protein, glyceraldehyde-3-phosphate dehydrogenase, in mammalian cells. Journal of Cellular Biochemistry 95, 45–52. Tatton, W.G., Chalmers-Redman, R., Brown, D., Tatton, N., 2003. Apoptosis in Parkinson's disease: signals for neuronal degradation. Annals of Neurology 53 (Suppl 3), S61–S70 (discussion S70-72). Thellin, O., Zorzi, W., Lakaye, B., De Borman, B., Coumans, B., Hennen, G., Grisar, T., Igout, A., Heinen, E., 1999. Housekeeping genes as internal standards: use and limits. Journal of Biotechnology 75, 291–295. Triantafilou, M., Triantafilou, K., 2005. The dynamics of LPS recognition: complex orchestration of multiple receptors. Journal of Endotoxin Research 11, 5–11. Volker, K.W., Knull, H.R., 1997. A glycolytic enzyme binding domain on tubulin. Archives of Biochemistry and Biophysics 338, 237–243. Zhong, H., Simons, J.W., 1999. Direct comparison of GAPDH, beta-actin, cyclophilin, and 28S rRNA as internal standards for quantifying RNA levels under hypoxia. Biochemical and Biophysical Research Communication 259, 523–526.
Bacterial endotoxin lipopolysaccharide induces up-regulation of glyceraldehyde-3-phosphate dehydrogenase in rat liver and lungs Wenguang Xie a,⁎, Ningsheng Shao b,⁎, Xiaochang Ma c , Baodong Ling a , Yushu Wei a , Qinxue Ding b , Guang Yang b , Nongle Liu b , Huixin Wang b , Keji Chen c a
c
Affiliated Hospital, North Sichuan Medical College, Nanchong 637000, China b Beijing Institute of Basic Medical Sciences, Beijing 100850, China Xiyuan Hospital, China Academy of Chinese Medical Sciences, Beijing 100091, China Received 20 December 2005; accepted 10 June 2006
Abstract Bacterial endotoxin or lipopolysaccharide (LPS) can trigger inflammatory responses and cause damage in organs such as liver and lungs when it is introduced into mammals, but the exact molecular events that mediate these responses have remained obscure. In this study, by using 2D gel electrophoresis and cDNA microarray analysis, we found that both protein and mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were significantly increased in rat liver and lungs after treatment with LPS. The results were further confirmed by Western blot and Northern blot. Given the known role of GAPDH in inducing apoptosis, our results suggest that LPS-induced GAPDH up-regulation may be an important mechanism responsible for the damage induced by Gram negative bacteria in mammalian tissue and GAPDH may be involved in the signaling pathway of LPS induced apoptosis. Our results also demonstrate that GAPDH is not a suitable internal control in gene expression studies, especially when bacterial infection is involved. © 2006 Elsevier Inc. All rights reserved. Keywords: Expression; GAPDH; Liver; LPS; Lungs; Rat
Introduction Sepsis caused by Gram negative bacteria and subsequent multiple organ failure are common complications among hospitalized patients and immunosuppressed individuals. Lipopolysaccharide (LPS), a constituent of the outer membrane of the bacterial cell wall, is one of the major causative agents of endotoxic shock and organ failure. Upon first binding to lipopolysaccharide binding protein (LBP) in the plasma and then to CD14, a 55-kDa glycosylphosphatidylinositol (GPI)anchored protein which is expressed in monocytes, macrophages and endothelial cells, LPS induces the transcription of a variety of inflammatory cytokine genes such as tumor necrosis factor-α (TNF-α), interleukin-1 (IL-1), interferon (IFN), as well as anti-inflammatory cytokine genes such as interleukin-4 ⁎ Corresponding authors. Fax: +86 10 68163140. E-mail addresses: [email protected] (W. Xie), [email protected] (N. Shao). 0024-3205/$ - see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.lfs.2006.06.018
(IL-4), interleukin-6 (IL-6), interleukin-10 (IL-10), and interleukin-11 (IL-11). Recent studies showed that the toll-like receptor-4/myeloid differentiation-2/cluster of differentiation14 (TLR4/MD-2/CD14) complex was the core molecule involved in LPS recognition (Roberts, 2005; Triantafilou and Triantafilou, 2005). In septic shock, other mediators such as nitric oxide and eicosanoids are also responsible for most manifestations caused by LPS (Bone, 1996). Although it is known that LPS recognition involves a complex biological cascade, the details of the signal transduction pathways underlying LPSinduced inflammatory responses have remained obscure. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a glycolytic enzyme with a molecular weight of 37 kDa. Active GAPDH is usually isolated as a homotetramer of approximately 150kDa which binds four NAD+ molecules at individual active sites on each subunit. Besides its well known roles in energy production, GAPDH has been shown to be involved in various other physiological and pathophysiological functions such as membrane fusion (Hessler et al., 1998), microtubule bundling
W. Xie et al. / Life Sciences 79 (2006) 1820–1827
1821
SD-IGS rats (200 ± 10 g) were obtained from Beijing Weitonglihua experimental animal company. All animals were starved for 12 h but allowed free access to water before experiments. The animals were divided into two groups, five animals in each group (n = 5). One group was treated with LPS (Sigma) (5 mg/kg body weight) in saline by intravenous injection, and the other group was treated with saline alone as control. Twenty-four hours after treatment, all rats were killed and livers and lungs were rapidly removed and frozen at − 80°C.
centrifuged again for 45 min at 150,000×g at 4 °C. Then the upper layer of the supernatant, which contained the lipid, was removed and the middle layer, which contained the proteins, was carefully collected and centrifuged for 50min at 40,000×g at 4°C. An aliquot of the supernatant was used for determination of protein concentration using Bradford's assay. 2D electrophoresis was performed as described previously (Jin et al., 2003). Briefly, 500μg of protein sample in 350 μl buffer (8 M urea, 2% CHAPS, 1% DTT) was subjected to isoelectric focusing with the IPGphor system (Amersham Pharmacia Biotech, Uppsala, Sweden). Immobiline™ DryStrips (pH 3–10, L 18cm) (Amersham Pharmacia Biotech, Uppsala, Sweden) were rehydrated for 10 h using reswelling buffer (8M urea, 2% CHAPS, 1% DTT) and IPG buffer (0.5%). After completion of the focusing, the IEF strips were stored immediately at − 80 °C. Second dimension SDS-PAGE was carried out on the Ettan DALT System using 12.5% gels (Amersham Pharmacia). The strips were first equilibrated for 15min in an aqueous solution containing 50 mM Tris, 6 M urea, 30% (w/w) glycerol, 2% (w/w) SDS, 65 mM DTT, pH 8.8, and then for an additional 15 min in a solution containing 50mM Tris, 6M urea, 30% (w/w) glycerol, 2% SDS, 135 mM iodoacetamide, pH 8.8. Low molecular weight standards (Amersham Pharmacia Biotech) were run along the IEF strips. The second dimension SDS-PAGE was run at 1000 V and 20mA for 30 min. After removal of the IEF strip, the electrophoretic conditions were changed to 1000 V and 40 mA for 165 min. During the process, the water circulation was maintained at + 13 °C. After completion of the second dimension electrophoresis the gels were stained with 0.1% (w/v) Coomassie Blue G-250 in 50% methanol and 10% acetic acid according to wellestablished protocols and gel images were processed using ImageScanner and ImageMaster®2D Elite software (Amersham Pharmacia Biotech). Data were analyzed with t-test.
Measurement of endotoxin levels in tissues
In-gel digestion
Tissue samples were immediately homogenized in cold saline and then treated with perchloric acid (PCA) to remove nonspecific activators or inhibitors in the lysate. The endotoxin levels were measured by the chromogenic Limulus Amebocyte Lysate (LAL) assay as described previously (Fang et al., 2002). Statistical evaluation was done with t-test when the data were confirmed as homoscedastic with F-test first, or Wilcoxon test when they were not.
Coomassie Blue-stained gel spots of interest were excised from the gels and extensively washed with 50 mM NH4HCO3 in 50% (v/v) acetonitrile (MeCN) for 30min. Gel pieces were then dried in a SpeedVac Vacuum and rehydrated at 4 °C for 30 min in 2 μl digestion solution (20 mM NH4HCO3, pH 7.8, containing 0.01 μg/μl of modified trypsin). Exhaustive digestion was carried out overnight at 37 °C. The digestion was extracted with 5% trifluoroacetic acid (TFA) for 1h at 37 °C and then with 2.5% TFA/50% v/v acetonitrile for 1h at 30 °C. The combined supernatants were evaporated in the SpeedVac Vacuum and the pellet dissolved in 2μl 0.5% aqueous TFA for mass spectrometric analysis.
(Volker and Knull, 1997), RNA binding and cleaving (Singh and Green, 1993; Nagy and Rigby, 1995; Nagy et al., 2000; Evguenieva-Hackenberg et al., 2002), as well as age-related neurodegenerative diseases (Mazzola and Sirover, 2003). It has intrinsic phosphotransferase activity (Engel et al., 1998) and can improve the efficacy of ribozymes in the cells (Sioud and Jespersen, 1996). Antisense oligonucleotides to GAPDH prevent nuclear translocation of GAPDH and reduce cytotoxicity (Sawa et al., 1997; Saunders et al., 1997). GAPDH has also been found to be involved in apoptosis (Sirover, 2005). Additionally, induction of apoptosis in cultured cells of a fibroblast and a neuroblastoma line not only increased translocation of GAPDH into the nucleus, but also resulted in increased total levels of GAPDH (Dastoor and Dreyer, 2001). In this study, by using 2D gel electrophoresis and cDNA microarray analysis, we found for the first time that both the protein and mRNA levels of GAPDH in rat liver and lungs were increased when animals were treated with LPS. Our results suggest that GAPDH may be an important component in the signaling pathway of LPS induced apoptosis. Materials and methods Treatment of animals
2D electrophoresis Small aliquots of liver and lung tissues (same parts for five animals) were ground and exposed to pre-chilled lysis buffer (5M urea, 2 M thiourea, 2% 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate (CHAPS), 2% n-decyl-n,ndimethyl-3-ammonio-1-propane sulfonate (SB) 3–10, 1% DTT, 35mg/l PMSF, 0.3 g/l EDTA, 0.7mg/l aprotinin and 0.5 mg/l leupeptin), then homogenized with a Diax900 homogenizer (Heidolph, Germany). The samples were centrifuged for 10 min at 10,000×g at 4°C. The supernatant was collected and
Table 1 Endotoxin levels in tissues (x¯ ± s, EU/g) Tissue
Control group
LPS group
Liver Lung
1.86 ± 3.47 6.01 ± 4.19
1.06 ± 1.34 34.36 ± 20.05 ⁎
⁎ Compared with control group, P < 0.001.
1822 W. Xie et al. / Life Sciences 79 (2006) 1820–1827 Fig. 1. Pictures of the 2D electrophoresis display the protein pattern of the homogenates of liver and lungs. (I) Complete picture of the 2D electrophoresis displays the protein pattern of liver homogenate from rats challenged with LPS. (II) Complete picture of the 2D electrophoresis displays the protein pattern of lung homogenate from rats challenged with LPS. (III) Close-up pictures of the protein pattern increased both in the homogenate of liver and lungs. (A) Protein spots from a control liver sample; (B) protein spots from an LPS-treated liver sample; (C) protein spots from a control lung sample; (D) protein spots from an LPS-treated lung sample. The protein spot that showed increased signal both in liver and lungs is indicated by arrow.
W. Xie et al. / Life Sciences 79 (2006) 1820–1827
Peptide mass fingerprinting by MALDI-TOF-MS All mass spectra of MALDI-TOF-MS were obtained on a Bruker REFLEX III MALDI-TOF-MS (Bruker-Franzen, Bremen, Germany) in positive ion mode at an accelerating voltage of 20kV with the matrix of α-cyano-4-hydroxycinnamic acid. The spectra were internally calibrated using trypsin autolysis products. PMF obtained was used to search through the SWISS_PROT and NCBInr database by the Mascot search engine (http://www.matrixscience.co.uk) with a tolerance of ± 0.1 D and one missed cleavage site.
1823
membrane was blocked with T-TBS solution (20 mM Tris, 150mM NaCl, 0.05% Tween-20, pH 7.5) containing 5% dry milk and then incubated overnight at 4 °C with anti-GAPDH monoclonal antibody (1:5000 dilution in T-TBS/5% dry milk, Kangcheng Biological Inc, Shanghai, China). After being washed with T-TBS, the membrane was incubated with peroxide conjugated anti-mouse IgG secondary antibody (Pierce) (1:7500 dilution in T-TBS) for 1.5 h at room temperature. The spots were visualized by using SuperSignal West Pico Chemiluminescent Substrate Kit (Pierce) according to the manufacturer's procedure. The statistical significance of the data was evaluated with t-test.
Production of cDNA microarrays The cDNA microarrays were prepared at the CapitalBio Corporation, National Engineering Research Center for Beijing Biochip Technology. Each array contained all the cDNA clones corresponding to proteins altered in 2D electrophoresis and genes involved in the LPS signaling pathway such as LBP, TLR2, CD14, MD-2, MyD88, TNF receptor associated factor-2 (TNFRAF-2), TNF receptor associated factor-4 (TNFRAF-4), NF-κB1 and iNOS. Each cDNA clone was printed in triplicates onto chemical modified glass slides. Rat genomic DNA was used as positive hybridization control and normalization standard. Oligo127, oligo125 and oligo104 from Arabidopsis thaliana were used as external control, 50% DMSO was used as negative control. Preparation of total RNA and microarray hybridization Total RNA was extracted by using the Trizol reagent according to the manufacturer's instructions. After Trizol purification, RNA was further purified with RNeasy mini spin column Kit (Qiagen). RNA was then reverse-transcribed into cDNA with Oligo(dT)15 (Promega) as primer and Superscript II choice for cDNA synthesis (Invitrogen) and subsequently labeled in red (Cy5) or in green (Cy3) (Amersham Pharmacia). Microarray hybridization was performed by CapitalBio Corporation, National Engineering Research Center for Beijing Biochip Technology. The chips were scanned with a ScanArray Express dual laser Scanner (Packard Bioscience). Data acquisition was performed with GenePix Pro 4.0 software (Axon Instruments). Each gene had six ratio values and statistic analysis was done with ttest. Normalized and averaged fluorescence ratios of genes were used to calculate the increase and decrease of expression in samples derived from LPS challenged animals compared with samples derived from control animals. A given gene was considered changed when the difference between means was significant (P < 0.01).
Preparation of radiolabeled cDNA probes for GAPDH and rat 18S rRNA One microgram of total RNA was converted to DNA probes by RT-PCR. The forward and reverse primers (5′–3′) for GAPDH gene are TGCTGAGTATGTCGTGGAG and GTCTTCTGAGTGGCAGTGAT respectively. The forward and reverse primers (5′–3′) for 18S rRNA are CTTAGAGGGACAAGTGGCG and GGACATCTAAGGGCATCACA respectively. All the cDNA probes were radiolabeled with [32P]-dCTP by Rediprime™ DNA Labeling System (Amersham Pharmacia). Northern blot hybridization Twenty micrograms of RNA was separated on formaldehyde-agarose gels, transferred onto Hybond N membranes (Amersham Pharmacia) and then cross-linked in UV Stratlinker 2400. Blots were hybridized with radiolabeled cDNA probes for GAPDH and rat 18S rRNA. After washing with SSC/SDS washing solution, the membrane was exposed to X-ray films (Kodak) at − 70 °C. Autoradiographic signals were quantified by densitometric analysis with ImageMaster® 2D Elite3.10 image analysis software (Amersham Pharmacia). Statistical evaluation was done with t-test. Results Tissue distribution of LPS Different endotoxin levels in tissues may induce different gene expression profiles and cause different degrees of damage Table 2 Identification of the protein spot increased both in liver and lungs in 2D electrophoresis (x¯ ± s) Tissue
Test a
Control group
LPS group
Liver
Vol. Mr pI Vol. Mr pI
18,348 ± 7637 34,563 ± 545 7.68 ± 0.05 3908 ± 2017 33,110 ± 1934 8.15 ± 0.10
38,369 ± 16,087 ⁎⁎ 34,494 ± 533 7.65 ± 0.05 17,711 ± 4779 ⁎⁎ 31,863 ± 26 8.06 ± 0.05
Western blot analysis The protein samples (50 μg) obtained from liver and lungs were subjected to electrophoresis in 10% SDS-PAGE at 100 V. Electrophoretic transfer was then carried out using a 0.2 μm ECL membrane (Pierce) at 100 V for 1 h. The
Lung
a Vol.: observed volume, Mr: molecular mass and pI: isoelectric point. ⁎⁎ Compared with control group, P < 0.001.
1824
W. Xie et al. / Life Sciences 79 (2006) 1820–1827
Table 3 MALDI-TOF identification of the changed spots in liver and lungs Tissue Protein identification Liver Lung a
Mr a
pI a
difference in LPS levels in livers of LPS-treated and non-treated animals (Table 1).
Peptide Sequence Expect matched/ coverage submitted
Ca3 (gi|2118293) 29,383 6.49 5/18 GAPDH (gi|8393418) 35,805 8.14 5/13 GAPDH (gi|8393418) 35,805 8.14 6/26
33% 30% 28%
0.0013 0.00077 0.013
Theoretical Mr: molecular mass and pI: isoelectric point.
to tissues. We first measured the LPS levels in liver and lungs 24 h after the rats had been treated with LPS. The levels of LPS in lungs of LPS-treated rats were significantly higher than in those of control animals (P < 0.001). There was no significant Table 4 Genes up-regulated in both liver and lungs of rats treated with LPS GB_accession/Unigene ID
Gene description
NM_017208 Rn.46387 AY197554 Rn.37341
Lipopolysaccharide binding protein (Lbp) Toll-like receptor 2 variant 1 (Tlr2) Myeloid differentiation protein 2 (MD-2) Myeloid differentiation primary response gene 88 (Myd88) Nitric oxide synthase 2 (inducible nitric oxide synthase, iNOS) Glyceraldehyde-3-phosphate dehydrogenase (gapdh, gapd) Tumor necrosis factor superfamily member 2 (TNFα, Tnf) Interleukin 1 beta (Il1β, Il1b) Interleukin 2 (IL-2, Il2) Interleukin 12b (IL-12, Il12b) Interferon gamma (IFNγ, IFNg) Integrin beta-2 precursor (CD18, Itgb2) C-reactive protein (CRP, Crp) Lactate dehydrogenase A (LDHA, Ldha) Mannose binding protein A (Mbpa, Mbl1) Granule bound starch synthase (waxy) Interleukin 4 (IL-4, Il4) Colony stimulating factor 1 (macrophage, Csf1) Serine protease inhibitor (Spin2c) Annexin 1 (p35) (Lipocortin 1) (Anxa1) Alpha-1-acid glycoprotein (Orm1) Superoxide dismutase 2 (SOD2, Sod2) Plasminogen activator inhibitor-1 (PAI-1, Serpine1) Scavenger receptor class B (Scarb1) Decay-accelerating factor (Daf1) Haptoglobin-like Ba1-647 (Hp) Nucleoside diphosphate kinase (Nme2) Guanine deaminase (Gda) Similar to Aldh8a1 protein (LOC308927, Aldh8a1) Similar to RIKEN cDNA 1810060J02 (LOC312863) Similar to RIKEN cDNA 2300002G02 (LOC293481, Tufm) Similar to hypothetical protein KIAA0934 (LOC307067) Similar to terminal deoxynucleotidyl transferase long isoform (Dntt) Calcium channel alpha-1-H subunit (Cacna1g)
NM_012611 NM_017008 NM_012675 NM_031512 M22899 NM_022611 AF010466 Rn.42962 NM_017096 NM_017025 NM_012599 AB089141 X16058 AF515736 NM_031531 NM_012904 Rn.10295 Rn.10488 Rn.29367 D89655 AF039584 AF476963 AY325231 NM_031833 NM_031776 Rn.44523 XM_232540 Rn.48850 Rn.45453 Rn.109111 AF290213
Identification of GAPDH protein expression in rat liver and lungs by 2D gel electrophoresis To identify changes in protein expression after the treatment with LPS, we carried out 2D gel electrophoresis with liver and lung tissue protein extracts. We reproducibly detected more than 600 protein spots on 2D gel after silver staining. The number of protein spots with significant change in signal intensity was 43 in the liver and 11 in the lungs (data not shown), among which only one protein spot showed increased signal in both liver and lung (Fig. 1). Gel image analysis using ImageMaster® 2D Elite software showed that levels of the changed protein in LPStreated rat liver and lungs were significantly higher than that of the control tissues (P < 0.001) (Table 2). After in-gel digestion and MALDI-TOF-MS analysis, the protein spot in 2D gel electrophoresis of rat lungs was exactly matched to GAPDH. However, the protein spot in 2D gel electrophoresis of rat liver was matched to two different proteins, GAPDH and carbonic anhydrase 3 (Ca3) (Table 3).
Table 5 Genes up-regulated in liver and unaffected in lungs of rats treated with LPS GB_accession/ Unigene ID
Gene description
AF057025 L26267 AJ011116 NM_012589 Rn.20418 NM_017277 NM_021578 Z75029 NM_031971 NM_031580 NM_030863 NM_012548 Rn.10972 NM_017350 Rn.1780 NM_031000 Rn.13492 D16478 NM_013054
Toll-like receptor 4 (TLR4, Tlr4) Nuclear factor kappa B p105 subunit (NFκB, Nfκb1) Nitric oxide synthase 3 (eNOS, Nos3) Interleukin 6 (interferon beta 2, IL-6, Il6) Heat shock transcription factor 1 (Hsf1) Adaptor protein complex AP-1, beta 1 subunit (Ap1b1) Transforming growth factor, beta 1 (Tgfb1) Hsp70.2 mRNA for heat shock protein 70 (Hspa5) Heat shock protein 70-1 (HSPa1a, Hspa1a) Glucose regulated protein, 58kDa (Grp58) Moesin (Msn) Endothelin 1 (Edn1) Proteasomal ATPase (SUG1, Sug1) Urokinase receptor (CD87, Plaur) Sulfated glycoprotein 2 (Clu) Aldo-keto reductase family 1, member A1 (Akr1a1) Malate dehydrogenase 1 (Mdh1) Hydroxyacyl-Coenzyme A dehydrogenase (Hadha) Tryptophan 5-monooxygenase activation protein zeta polypeptide (Ywhaz) Scavenger receptor class B type 2 (Scarb2) Similar to DnaJ homolog subfamily B member 1 (LOC298138, Dnajb1) Similar to KIAA1912 protein (LOC289855, RGD1311700) Similar to TNF receptor associated factor 4 (LOC303285) Similar to Trad (LOC303375, Rad51l3) Hemopexin (Hpx) Fibrinogen, A alpha polypeptide (Fga) Fibrinogen B beta polypeptide (Fgb) Class I beta-tubulin (Tubb5) Keratin 5 (Krt5, Krt2-5) Beta actin (Actb)
AY682847 Rn.92270 Rn.104838 XM_220640 XM_220773 M62642 X86561 M35602 Rn.2458 NM_183333 NM_031144
W. Xie et al. / Life Sciences 79 (2006) 1820–1827
1825
Table 6 Genes unaffected in liver and up-regulated in lungs of rats treated with LPS
Table 8 Genes down-regulated in liver and unaffected in lungs of rats treated with LPS
GB_accession/Unigene ID
Gene description
GB_accession/Unigene ID
Gene description
NM_021744 Rn.1437 Rn.105232 Rn.54465 D17310
CD14 antigen (Cd14) Group specific component (Gc) Similar to TNF receptor associated factor 2 (Traf2) Integrin beta 2 alpha subunit (Itgam) 3-Alpha-hydroxysteroid dehydrogenase (LOC191574) Transferrin receptor (Tfrc) Tissue plasminogen activator (tPA, Plat)
AF049878 NM_012854 NM_019292 NM_013078 NM_031031 NM_012793 AF106945 Rn.100922 XM_346852
Amyloid beta-peptide binding protein (Hadh2) Interleukin 10 (IL-10, Il10) Carbonic anhydrase 3 (Ca3) Ornithine carbamoyltransferase (Otc) Glycine amidinotransferase (Gatm) Guanidinoacetate methyltransferase (Gamt) Peroxiredoxin 4 (Prdx4) Similar to BIMP1 (LOC315120, Card10) Hypothetical protein XP_346852 (Myo1b)
M58040 NM_013151
Confirmation of GAPDH gene expression in rat liver and lungs by cDNA microarrays To confirm the expression changes found in the results of 2D gel electrophoresis, we further prepared cDNA microarrays containing the above-mentioned 54 cDNA clones altered in the 2D gel electrophoresis and some genes involved in LPS signaling pathways reported previously to observe the gene expression in mRNA level in rat liver and lungs. Microarray hybridization results showed that the expression of 45 genes was significantly altered both in the liver and lungs (P < 0.01), including the up-regulation of many LPS signaling pathwayrelated genes, such as LBP, TLR2, MD-2, MyD88, iNOS, IL1β, IL-2, IL-4, IL-12b and IFN (Table 4). Importantly, GAPDH was reproducibly up-regulated both in the liver and lungs. Compared with control groups, about a two-fold increase of GAPDH mRNA levels was observed in both the liver and lungs of LPS challenged animals (1.98 ± 0.58 in liver; 2.43 ± 0.62 in lungs). Some LPS-signaling-related genes were significantly up-regulated (P < 0.01) only in the liver or only in the lungs, such as CD14, TNFRAF-2, TNFRAF-4, IL-6 and NF-κB1 (Tables 5 and 6). Down-regulation of the metabolism-related genes induced by LPS was also found (Tables 7–9), and the Ca3 gene was one of those genes significantly down-regulated only in liver after LPS treatment (Table 8).
Table 9 Genes down-regulated in lungs and unaffected in liver of rats treated with LPS GB_accession/ Unigene ID
Gene description
Rn.32263 U00620
Mercaptopyruvate sulfur transferase (Mpst) Colony stimulating factor 2 (granulocyte-macrophage) (Csf2) Highly similar to MCT2_RAT Mast cell protease II precursor (Mcpt2) Urinary plasminogen activator (Plau) Myosin heavy chain 11 (Myh11)
J02712 NM_013085 NM_031520
Western blot analysis of GAPDH expression in the rat liver and lungs To further confirm the up-regulation of GAPDH protein in the rat liver and lung, we carried out Western blot analysis with protein preparations from LPS-treated and saline-treated rat tissues by using an anti-GAPDH monoclonal antibody. The GAPDH protein level was significantly increased in both the liver and lungs after treating the animals with LPS compared with the control group (P < 0.0001). Compared with the levels of GAPDH protein in control tissues, a 2-fold increase was found in the liver and a 4-fold increase in the lungs (Fig. 2). Northern blot analysis of GAPDH mRNA expression in rat liver and lungs
Table 7 Genes down-regulated in both liver and lungs of rats treated with LPS GB_accession/Unigene ID
Gene description
NM_138884 J02582 NM_031127 NM_030850 NM_031509 Rn.6302
Aldo-keto reductase family 1 member D1 (Akr1d1) Apolipoprotein E (Apoe) Sulfite oxidase (Suox) Betaine-homocysteine methyltransferase (Bhmt) Glutathione-S-transferase, alpha type (Ya) (Gsta1) Acyl coenzyme A dehydrogenase medium chain (Acadm) Arginosuccinate synthetase 1 (Ass) Catalase (Cat) Aldehyde dehydrogenase 2 (Aldh2) Glutathione-S-transferase, mu 1 (Gstm1) NADH dehydrogenase 1 alpha subcomplex 10-like protein (Ndufa10) Insulin-like growth factor 1 (Igf1)
M36708 NM_012520 Rn.101781 Rn.93760 Rn.102304 M15481
Northern blot analysis of GAPDH mRNA expression in rat liver and lungs after LPS stimulation is shown in Fig. 3. Consistent with the up-regulation of GAPDH protein, the GAPDH mRNA level was significantly increased in both the liver and lungs in the animals treated with LPS compared with
Fig. 2. Western blot analysis of GAPDH protein expression in rat liver and lungs. Equal amounts (50 μg) of protein samples obtained from liver and lungs were subjected to Western blot analysis.
1826
W. Xie et al. / Life Sciences 79 (2006) 1820–1827
Fig. 3. Northern blot analysis of GAPDH mRNA expression in rat liver and lungs. Twenty micrograms of RNA was separated in formaldehyde-agarose gels and transferred onto Hybond N membranes. Blots were hybridized with radiolabeled cDNA probes for GAPDH and rat 18S rRNA.
the control group (P < 0.0001), but the 18S rRNA level was unchanged. The Northern blot results were also consistent with results of the microarrays. Discussion LPS can trigger inflammatory responses and cause damage in organs such as liver and lungs when it is introduced into mammals, but the exact molecular events that mediate these responses have remained unknown. In this study, by using 2D gel electrophoresis and MALDI-TOF-MS analysis, we found that GAPDH expression was significantly increased both in the liver and lungs of rats that had been treated with LPS. Microarray analysis revealed that expression of GAPDH was reproducibly increased in the liver and lungs, while expression of Ca3 was decreased in the liver of LPS-challenged animals. Results of Western and Northern blot analyses confirmed that GAPDH was up-regulated in both the liver and lungs after LPS treatment. In addition to GAPDH, LPS could up-regulate many other genes involved in the LPS signal transduction, such as LBP, TLR2, CD14, MD-2, MyD88, TNFRAF-2, NF-κB1 and iNOS, suggesting that LPS-induced GAPDH expression may be an important mechanism responsible for the LPS-triggered apoptosis by following two signaling pathways. First, LPS may bind LBP and then form a complex with TLR2 or TLR4/MD-2/ CD14 to activate the jun N-terminal kinase (JNK) signal pathway via an adaptor protein MyD88. Second, the LPS-TLR2 or TLR4/MD-2/CD14 complex may activate NF-κB1 and iNOS via the adaptor protein MyD88 (Roberts, 2005; Triantafilou and Triantafilou, 2005; Aderem and Ulevitch, 2000). The activated JNK may induce gene expression of GAPDH (Tatton et al., 2003), and iNOS can induce post-translational protein modifications of GAPDH including an S-nitrosylation and a covalent, non-enzymatic NAD+ modification (Sirover, 2005; Tatton et al., 2003). Recently, it was reported that LPS induces iNOS, leading to S-nitrosylation of GAPDH, which enables GAPDH to bind to Siah1 and translocate to the nucleus in RAW264.7 cells, resulting in cell apoptosis but not necrosis (Hara et al., 2005). Thus, the observed up-regulation of GAPDH in livers and lungs of LPS-challenged animals in our study appears to be associated with an increased degree of apoptosis in these tissues. Whether these mechanisms are also involved in LPS mediated organ damage remains to be elucidated.
GAPDH is considered as a housekeeping gene like albumin, actin, tubulin, cyclophilin, 28S rRNA and 18S rRNA, which are widely used as internal controls for measuring gene expression (Goidin et al., 2001; Thellin et al., 1999; Zhong and Simons, 1999). It is assumed that GAPDH is constitutively expressed at similar levels in all cell and tissue types. However, accumulating evidence showed that the expression of these genes varies across different tissues and cell types, and at different stages during cell proliferation and development. In addition, the GAPDH mRNA level has been observed to be changed in response to various stimuli such as hypoxia, insulin, mitogens, epidermal growth factors and during cellular maturation (Tatton et al., 2003; de Kok et al., 2005). In present study, we found that the expression of GAPDH in rat liver and lungs was upregulated after LPS treatment, again demonstrating that GAPDH is not a suitable internal control in expression studies, especially in the case of bacterial infection. The fact that lung tissues of rats showed increased endotoxin levels 24 h after LPS challenge is interesting, since it is known that LPS is cleared very quickly from the blood. This raises the question where this endotoxin comes from, and whether this might additionally contribute to LPS mediated lung damage. Acknowledgements We thank Professor Yongming Yao in PLA 304 hospital, Professor Shaojun Liu and Professor Ning Guo in Beijing Institute of Basic Medical Sciences and Dr. Liang Zhang in the CapitalBio Corporation, National Engineering Research Center for Beijing Biochip Technology for their great help in this study. We thank Dr. Sheng Zhou in St. Jude Children's Research Hospital, Tennessee, USA for his kind suggestions about this manuscript. This work is supported by the Natural Science Foundation of China (Project Nos. 30271658, 30472286). References Aderem, A., Ulevitch, R.J., 2000. Toll-like receptors in the induction of the innate immune response. Nature 406, 782–787. Bone, R.C., 1996. Why sepsis trials fail. Journal of American Medical Association 276, 565–566. Dastoor, Z., Dreyer, J.L., 2001. Potential role of nuclear translocation of glyceraldehyde-3-phosphate dehydrogenase in apoptosis and oxidative stress. Journal of Cell Science 114, 1643–1653. de Kok, J.B., Roelofs, R.W., Giesendorf, B.A., Pennings, J.L., Waas, E.T., Feuth, T., Swinkels, D.W., Span, P.N., 2005. Normalization of gene expression measurements in tumor tissues: comparison of 13 endogenous control genes. Laboratory Investigation 85, 154–159. Engel, M., Seifert, M., Theisinger, B., Seyfert, U., Welter, C., 1998. Glyceraldehyde-3-phosphate dehydrogenase and Nm23-H1/nucleoside diphosphate kinase A: two old enzymes combine for the novel Nm23 protein phosphotransferase function. Journal of Biological Chemistry 273, 20058–20065. Evguenieva-Hackenberg, E., Schiltz, E., Klug, G., 2002. Dehydrogenases from all three domains of life cleave RNA. Journal of Biological Chemistry 277, 46145–46150. Fang, C.W., Yao, Y.M., Shi, Z.G., Yu, Y., Wu, Y., Lu, L.R., Sheng, Z.Y., 2002. Lipopolysaccharide-binding protein and lipopolysaccharide receptor CD14 gene expression after thermal injury and its potential mechanism(s). Journal of Trauma-Injury Infection and Critical Care 53, 957–967.
W. Xie et al. / Life Sciences 79 (2006) 1820–1827 Goidin, D., Mamessier, A., Staquet, M.J., Schmitt, D., Berthier-Vergnes, O., 2001. Ribosomal 18S RNA prevails over glyceraldehyde-3-phosphate dehydrogenase and beta-actin genes as internal standard for quantitative comparison of mRNA levels in invasive and noninvasive human melanoma cell subpopulations. Analytical Biochemistry 295, 17–21. Hara, M.R., Agrawal, N., Kim, S.F., Cascio, M., Fujimuro, B., Ozeki, M., Takahashi, Y., Cheah, M., Tankou, J.H., Hester, S.K., Ferris, L.D., Hayward, C.D., Snyder, S.D., Sawa, S.H., 2005. S-nitrosylated GAPDH initiates apoptotic cell death by nuclear translocation following Siah1 binding. Nature Cell Biology 7, 665–674. Hessler, R.J., Blackwood, R.A., Brock, T.G., Francis, J.W., Harsh, D.M., Smolen, J.E., 1998. Identification of glyceraldehyde-3-phosphate dehydrogenase as a Ca2+-dependent fusogen in human neutrophil cytosol. Journal of Leukocyte Biology 63, 331–336. Jin, B.F., He, J., Wang, H.X., Wang, J., Zhou, T., Lan, Y., Hu, M.R., We, K.H., Yang, S.C., Shen, B.F., Zhang, X.M., 2003. Proteomic analysis of ubiquitinproteasome effects: insight into the function of eukaryotic initiation factor 5A. Oncogene 22, 4819–4830. Mazzola, J.L., Sirover, M.A., 2003. Subcellular alteration of glyceraldehyde-3phosphate dehydrogenase in Alzheimer's disease fibroblasts. Journal of Neuroscience Research 71, 279–285. Nagy, E., Rigby, W.F., 1995. Glyceraldehyde-3-phosphate dehydrogenase selectively binds AU-rich RNA in the NAD(+)-binding region (Rossmann fold). Journal of Biological Chemistry 270, 2755–2763. Nagy, E., Henics, T., Eckert, M., Miseta, A., Lightowlers, R.N., Kellermayer, M., 2000. Identification of the NAD(+)-binding fold of glyceraldehyde-3-phosphate dehydrogenase as a novel RNA-binding domain. Biochemical and Biophysical Research Communication 275, 253–260. Roberts, M., 2005. Detoxifying endotoxin: time, place and person. Journal of Endotoxin Research 11, 69–84.
1827
Saunders, P.A., Chalecka-Franaszek, E., Chuang, D.M., 1997. Subcellular distribution of glyceraldehyde-3-phosphate dehydrogenase in cerebellar granule cells undergoing cytosine arabinoside-induced apoptosis. Journal of Neurochemistry 69, 1820–1828. Sawa, A., Khan, A.A., Hester, L.D., Snyder, S.H., 1997. Glyceraldehyde-3phosphate dehydrogenase: nuclear translocation participates in neuronal and nonneuronal cell death. Proceedings of the National Academy of Sciences of the United States of America 94, 11669–11674. Singh, R., Green, M.R., 1993. Sequence-specific binding of transfer RNA by glyceraldehyde-3-phosphate dehydrogenase. Science 259, 365–368. Sioud, M., Jespersen, L., 1996. Enhancement of hammerhead ribozyme catalysis by glyceraldehyde-3-phosphate dehydrogenase. Journal of Molecular Biology 257, 775–789. Sirover, M.A., 2005. New nuclear functions of the glycolytic protein, glyceraldehyde-3-phosphate dehydrogenase, in mammalian cells. Journal of Cellular Biochemistry 95, 45–52. Tatton, W.G., Chalmers-Redman, R., Brown, D., Tatton, N., 2003. Apoptosis in Parkinson's disease: signals for neuronal degradation. Annals of Neurology 53 (Suppl 3), S61–S70 (discussion S70-72). Thellin, O., Zorzi, W., Lakaye, B., De Borman, B., Coumans, B., Hennen, G., Grisar, T., Igout, A., Heinen, E., 1999. Housekeeping genes as internal standards: use and limits. Journal of Biotechnology 75, 291–295. Triantafilou, M., Triantafilou, K., 2005. The dynamics of LPS recognition: complex orchestration of multiple receptors. Journal of Endotoxin Research 11, 5–11. Volker, K.W., Knull, H.R., 1997. A glycolytic enzyme binding domain on tubulin. Archives of Biochemistry and Biophysics 338, 237–243. Zhong, H., Simons, J.W., 1999. Direct comparison of GAPDH, beta-actin, cyclophilin, and 28S rRNA as internal standards for quantifying RNA levels under hypoxia. Biochemical and Biophysical Research Communication 259, 523–526.