Bacteriophage WO in Wolbachia infecting terrestrial isopods

BBRC Biochemical and Biophysical Research Communications 337 (2005) 580–585 www.elsevier.com/locate/ybbrc

Bacteriophage WO in Wolbachia infecting terrestrial isopods Christine Braquart-Varnier *, Pierre Gre`ve, Christine Fe´lix, Gilbert Martin Laboratoire de Ge´ne´tique et Biologie des Populations de Crustace´s, Unite´ mixte de Recherche 6556, CNRS, Universite´ de Poitiers, 40 avenue du Recteur Pineau, 86022 Poitiers, France Received 13 September 2005 Available online 22 September 2005

Abstract Wolbachia are maternally inherited intracellular a-proteobacteria that infect a wide range of arthropods. They are associated with a number of different reproductive phenotypes in arthropods and nematodes. In isopod crustacean, Wolbachia are responsible for feminization of genetic males in many species, and for cytoplasmic incompatibility in two species. In this paper, we report the first detection of phage WO from Wolbachia infecting terrestrial isopods. All Wolbachia strains tested in this study were infected with phage WO. Based on the orf7 phage sequence, we identified three different phage sequences in four Wolbachia strains. The phage of Wolbachia infecting Armadillidium vulgare seems to be not active, unlike other phages WO previously described in arthropods.
2005 Elsevier Inc. All rights reserved. Keywords: Terrestrial isopods; Armadillidium vulgare; Feminization; Wolbachia; Endosymbiont; a-Proteobacteria; Bacteriophage WO

Wolbachia are maternally inherited endosymbiotic a-proteobacteria [1] responsible for many effects on their host reproduction such as cytoplasmic incompatibility (CI), thelytokous parthenogenesis, feminization of genetic males, and male killing (reviewed in [2,3]). Their ability to interact with host biology has allowed Wolbachia to invade a wide spectrum of nematodes and arthropods (reviewed in [2]). In isopod crustaceans, Wolbachia are responsible for feminization in many species including Armadillidium vulgare [4,5], and for cytoplasmic incompatibility in two species, Porcellio dilatatus petiti [6] and Cylisticus convexus [7]. In the case of feminization, genetic males are converted into functional females, which typically produce, in turn, a large excess of daughters in the progeny [4,8]. Thereby, in terrestrial isopods, Wolbachia were mostly found in females even if infected males were found in some species such as Oniscus asellus, Porcellionides pruinosus [5] or P. d. petiti [6]. Wolbachia symbionts form a monophyletic group divided into six groups [9] and all

*

Corresponding author. Fax: +33549454015. E-mail address: [email protected] (C. Braquart-Varnier).

0006-291X/$ - see front matter
2005 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2005.09.091

the Wolbachia associated with isopods belonged to the Wolbachiae B group [5]. To explain the diversity of reproductive abnormalities induced by Wolbachia, it has been postulated that genes responsible for the effect on a host do not locate on the bacterial chromosome but on extra-chromosomal factors such as plasmids or bacteriophages [2]. Indeed, many bacterial pathogens have acquired a series of genes from bacteriophages that confers positive fitness effects, such as escape from host immune system and improved expression of pathogenicity [10]. The presence of phages in Wolbachia was first suspected when Wright et al. [11] observed phage-like particles in Wolbachia from mosquito Culex pipiens. However, the bacteriophage WO was only recently characterized in Wolbachia [12] and has further been found in the majority of Wolbachia strains examined [12–14]. Also, it has been shown that the bacteriophage WO can be either lysogenic and integrated into the Wolbachia chromosome, or lytic and free in the cytoplasm [14–16]. All these results seem to indicate that WO is probably a realistic candidate to explain the variety of effects that Wolbachia induce in their hosts. As the most frequent Wolbachia-induced effect observed in arthropods is CI [17], phage WO infection was mostly

C. Braquart-Varnier et al. / Biochemical and Biophysical Research Communications 337 (2005) 580–585

described in Wolbachia strains from insect species inducing CI [12–14,18]. In this study, we first checked the presence of the phage WO in three feminizing Wolbachia, wVul, wAse, and wPru harbored, respectively, by A. vulgare, O. asellus, P. pruinosus, and in a CI Wolbachia, wPet harbored by P. d. petiti [4,6,19,20]. We then identified three different types of orf7 sequences (encoding putative phage capsid protein) in these four isopod Wolbachia strains. As we failed to detect orf7 gene expression in wVul, it might suggest that the phage WO is not active in this strain.

and analyzed using a phosphorImager (storm system, Molecular Dynamics). Wolbachia purification from ovaries. Ovaries from infected females were dissected in PBS (137 mM NaCl, 7.8 mM Na2HPO4, 2.7 mM KCl, and 1.47 mM KH2PO4, pH 7.4) containing 5 mM L-glutamine and 0.25 mM sucrose. Ovaries were then homogenized in the same buffer and cells were disrupted at 4 C in a Potter homogenizer (Teflon/glass, tight piston). Homogenate was centrifuged at 200g (four times) for 10 min at 4 C in order to pellet host nuclei. The supernatant containing the bacteria was collected and centrifuged at 4100g for 15 min at 4 C. The bacteriaenriched pellet was then treated for RNA extraction. RNA isolation and RT-PCR analysis. Total RNA was extracted from the Wolbachia-enriched pellet. After a lysozyme treatment (400 lg/ml) in TE Buffer (10 mM Tris–HCl, 1 mM EDTA, pH 8) for 5 min at room temperature, RNA extraction was performed with the RNAeasy Mini kit according to the manufacturerÕs instruction (Qiagen, Valencia, CA) using 40 U of ribonuclease inhibitor (Sigma). After a 10 min DNAse treatment (RQ1 RNAse-free DNAse), single-stranded cDNA was synthesized by annealing random primers (80 ng) to 10 lg of total RNA (previously heated for 5 min at 65 C and chilled on ice) and carrying out a reverse transcription reaction in 20 ll containing 50 mM Tris–HCl, pH 8.3, 75 mM KCl, 3 mM MgCl2, 10 mM dithiothreitol, a 0.5 mM concentration of each dNTP, and 200 U of Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLVT-RT, Gibco BRL), for 1 h at 42 C. PCR amplifications were performed using the following primer sets: phgWOF and phgWOR for orf7; 81F (5 0 -TGGTCCAATAAGTGATGAA GAAAC-3 0 ) and 691R (5 0 -AAAAATTAAACGCTACTCCA-3 0 ) for wsp [23].

Materials and methods Animals. All populations (infected or uninfected by Wolbachia) of A. vulgare, O. asellus, P. d. petiti, and P. pruinosus were reared in the laboratory at 20 C under ambient illumination with food ad libitum. DNA extraction and PCR. Total DNA was extracted from gonads of infected and uninfected animals as described by Kocher et al. [21]. The putative phage capsid protein gene (orf7) encoded on the prophage WO was PCR amplified with the primers phgWOF (5 0 -CCCACATGAG CCAATGACGTCTG-3 0 ) and phgWOR (5 0 -CGTTCGCTCTGCAAGTA ACTCCATTAAAAC-3 0 ) designed by Masui et al. [12]. The PCR conditions were 94 C for 3 min followed by 35 amplification cycles of 94 C for 30 s, 57 C for 30 s, and 72 C for 1 min, and finally 72 C for 5 min. Cloning and sequencing of orf7. All PCR products were cloned into the pGEM-T-easy vector (Promega) and sequenced using vector-specific primers. At least three positive clones were sequenced in both directions by an automated DNA sequencer (ABI Prism model 377, Perkin-Elmer). Sequence analysis. Sequence homology analysis was performed using the BLAST2 program (available from the Infobiogen Web site, www.infobiogen.fr) and GenBank (www.ncbi.nlm.nih.gov). orf7 DNA sequences were made available on the GenBank Web site at Accession Nos. DQ176640 (WO wVul type); DQ176641 (WO wPru type); DQ176642 (WO wPet type). These orf7 DNA sequences were aligned using CLUSTALW software [22]. Southern blotting. Total DNA (20 lg) of different isopod species was digested to completion with EcoRI, electrophoresed on 1% agarose gels, and transferred to nylon membrane (Positive membrane; Q-Biogene). The PCR product, obtained from the amplification of infected A. vulgare DNA with phgWOF and phgWOR primers, was used as an orf7 probe. This probe was labelled with [a-32P]dCTP (300 Ci/mmol), using the random primer method, and hybridized at 42 C in a buffer containing 40% formamide, 10% dextran sulfate, 4· SSC, 1· DenhardtÕs solution, and 0.3 mg/ml denatured salmon sperm DNA. The final wash was performed at 52 C in 0.1· SSC containing 0.1% SDS. Hybridized blots were imaged

Results Identification and cloning of phage WO in Wolbachia from different isopod species

P. p (+)

P. p (+)

P. d. p (+)

P. d. p (+)

O. a (+)

O. a (-)

First, we tested by PCR assay the specificity of the phage primers designed by Masui et al. [12] in A.vulgare infected by Wolbachia. A 394 bp fragment of the expected length was amplified (Fig. 1A), cloned, and sequenced. The database searches established that this sequence presents significant similarities with the putative phage capsid protein gene (orf7) encoded on the prophage WO and previously reported by Masui et al. [12]. Second, we used the same primers to check the presence of the orf7 in different Wolbachia strains of various isopod species including males and females of O. asellus, P. pruinosus, and P. d. petiti.

O. a (+)

A. v (+)

A. v (-)

M N

A. v (+)

B

A

581

M N

653 bp 394 bp 298 bp

394 bp

Fig. 1. (A) PCR assay for the specificity of the phage primers and (B) PCR of orf7 in different isopod species infected or uninfected by Wolbachia. A. v, Armadillidium vulgare; O. a, Oniscus asellus; P. d. p, Porcellio dilatatus petit; P. p, Porcellionides pruinosus; +, infected strains;
, uninfected strains; M, DNA molecular weight markers; N, negative control using no DNA template.

582

C. Braquart-Varnier et al. / Biochemical and Biophysical Research Communications 337 (2005) 580–585

Distribution and expression of phage WO

The 394 bp PCR product was present in all species infected by Wolbachia, whereas no signal was detected in uninfected animals (Fig. 1B). The PCR fragments obtained in females of each species were cloned and sequenced to confirm that they encode the orf7 gene of the prophage WO.

Southern blotting was performed using orf7 of phage WO as probe (Fig. 3). As a result, this gene was observed in all Wolbachia strains tested. The hybridization signals detected were highly variable in size and strength, suggesting that various phage WO types were present in a single Wolbachia strain. The expression of orf7 in Wolbachia of A. vulgare was examined by RT-PCR using the primers phgWOF and phgWOR, and no signal was observed in the RT(+) or RT(
) reactions, whereas positive signal was observed in the control sample using total DNA of A. vulgare infected by Wolbachia as template (Fig. 4A). PCR with the primer set for Wsp successfully amplified the specific fragment only in the RT(+) reaction, indicating that the RT reaction was reliable and suggesting that the orf7 gene was not expressed in this strain (Fig. 4B).

Sequence analysis For the females of each species (A. vulgare, O. asellus, P. pruinosus, and P. d. petiti), three orf7 PCR products (obtained from three independent PCR) were cloned. Two clones obtained from each cloning were sequenced in both directions. Thus, six sequences per species were analyzed. The analysis of the twenty-four sequences confirmed that all these sequences showed close similarity (on average, e = 1e
124) with the orf7 sequence described by Masui et al. [12]. These sequences were aligned and, based on the percentage of base divergence among themselves (more than 1%), three different sequences were identified and were named WO wVul type, WO wPet type, and WO wPru type (Fig. 2A). The distribution of these three types is presented in Fig. 2B. The WO wVul type was present in wVul and in wAse, but absent in other Wolbachia strains tested. The WO wPet type was present in wVul and in wAse but also in wPet where this type was the only phage sequence type detected. The WO wPru type seemed to be specific to the strain wPru. A

Discussion In this paper, we report the first detection of phage WO from Wolbachia inducing feminization and cytoplasmic incompatibility in terrestrial isopods. The distribution and diversity of WO phage sequence was also studied, based on PCR detection and sequencing of the putative minor capsid protein (ORF7).

WO wVul type WO wPet type WO wPru type

GAAAGTCTGGAAAGCTTACAAAAAGAAGTAGACCGACTATATGAAATGTTTGTGCAGCTA GAAAGTCTGGGAAGCTTACAAAAAGAAGTAGACCGACTATATGAAATGTTTTTGCAGCTA GAAAGTCTGGGAAGCTTACAAAAAGAAGTAGACCGACTATATGAAATGTTTTTGCAGCTA

WO wVul type WO wPet type WO wPru type

ATAGCAAGGAACAGAGGTCTTTCAATTGAAAAGATTAAATCAACAGAGGCAGGGCTTTAC ATAGCAAGGAACAGAGGTCTTTCAATTGAAAAGATTCGATCAACAGAGGCAGGGCTATAT ATAGCAAGGAACAGAGGTCTTTCAATTGAAAAGATTCGATCAACAGAGGCAGGGCTATAT

WO wVul type WO wPet type WO wPru type

TTTGGCAAGAACGCTGTGGATATTGGCCTTGCGGATGGAATGACAATTCTTTCATCTATT TTTGGGGAGAAAGCAGTAGAAATAGGCCTTGCAGACGGAATGACAATTCTTTCATCTATT TTTGGGGAGAAAGCAGTAGAAATAGGCCTTGCAGACGGAATGACAATTCTTTCATCTATT

WO wVul type WO wPet type WO wPru type

AATAAAAACAGGAGTATTACTATGAATGAACAAACTACAAATGACCTAGAAACTGATAAT AATAAAAACAGGAGTATTACTATGAATGAACAAACTACAAATGACCTAGAAACTGATAAT AATAAAAACAGGAGTATTACTATGAATGAACAAACTACAAACGACCTAGAAACTGATAAT

WO wVul type WO wPet type WO wPru type

TTAACTAAGTATCGTACTGAAGTTCTTGAATTAATACGTTTATGTAACTTATCACGAATG TTAACCAAGTATCGTACTGAAGTTCTTGAATTAATACGTTTATGTAATTTATCGAAGATG TTAACCAAGTATCGTACTGAAGTTCTTGAATTAATACGTTTATGTAATTTATCGAAGGTG

WO wVul type WO wPet type WO P.p type

CCAGAGAAAATAGGAGAATTTATAGAGCAAGGCGTAAGTATTGAG CCAGAAAAGATAGGAGAATTTATTGAGCAAAGTGTAAGTGTTGAG CCAGAAAAGATAGAAGAATTTATTGAGCAAGGCGTAAGTGTTGAG

B

wVul

wAse

wPru

wPet

WO wVul type

4/6

3/6

0/6

0/6

WO wPet type

2/6

3/6

0/6

6/6

WO wPru type

0/6

0/6

6/6

0/6

Fig. 2. (A) Alignment of the orf7 sequences isolated from different Wolbachia strains and (B) distribution of the different sequence phage types in four Wolbachia strains. wVul, Wolbachia infecting A. v; wAse, Wolbachia infecting O. a; wPru, Wolbachia infecting P. p; wPet, Wolbachia infecting P. d. p. WO wVul type, orf7 sequence types isolated from Wolbachia infecting A. v (Accession No. DQ176640); WO wPet type, orf7 sequence type isolated from Wolbachia infecting P. d. p (Accession No. DQ176642); WO wPru type, orf7 sequence type isolated from Wolbachia infecting P. p (Accession No. DQ176641). The nucleotides that are different between the three sequence types were indicated in grey.

9.4 kb 6.6 kb

2 kb

Fig. 3. Southern hybridization of different Wolbachia DNA with the orf7 sequence from wVul. A. v, Armadillidium vulgare; O. a, Oniscus asellus; P. d. p, Porcellio dilatatus petit; P. p, Porcellionides pruinosus; +, infected strains;
, uninfected strains.

B

RT (-)

A

RT (+)

The bacteriophage WO was present in all the strains tested, confirming its high prevalence in Wolbachia already described in previous studies on insect species [12–14,18]. Indeed, Bordenstein and Wernegreen [13] showed that bacteriophage WO infects 35 of 39 insect species tested, representing nearly 90% of prevalence. Increasing the number of isopod species tested will allow to clarify the phage infection status of the Wolbachiae B group. Southern blotting using the capsid phage gene gave mostly numerous bands, suggesting the presence of several copies of the phage WO in a single Wolbachia strain, since all isopod species are monoinfected. One copy of the phage WO seemed to be present in wPet whereas at least four copies seemed to be inserted in wVul, wPru, and wAse. The single or multiple

P

N

M

M

RT (-)

23 kb

583

phage infection status observed in Wolbachia harbored by isopods has been also described in Wolbachia infecting Teleogryllus taı¨ wanema, Drosophila simulans, several Ephestia sp. [12], Asobara tabida [14] or C. pipiens [18]. Furthermore, the difference in signal intensity for each band suggested also a high variability of the phage orf7 gene sequence. This was confirmed by the identification of three different types of orf7 sequences in four isopod Wolbachia strains. The distribution of these three sequence types showed that: (i) the P. d. petiti Wolbachia strain seems to be specifically associated with the single sequence phage WO wPet type, suggesting a single phage infection that it is in agreement with the single band observed in Southern blotting, (ii) a single phage infection can also be observed in Wolbachia harbored by P. pruinosus since the WO wPru sequence phage type was the only one detected, and (iii) the WO wVul type and WO wPet type phage sequences were both present in distinct Wolbachia strains, suggesting a putative double phage infection in wVul and wAse strains. These results should be confirmed by increasing the number of infected animals tested for each isopod species and will allow us to elucidate more precisely the phage infection status in these species. Anyway, Gavotte et al. [14] demonstrated that several phage types do exist within a same strain or in different strains of multiply infected insect hosts. They also showed the specificity of a Wolbachia phage infection even in a multiply infected host species. The combination of these data with those obtained by Bordenstein and Wernegreen [13] and Masui et al. [12] strongly argues for (i) phage exchanges between different Wolbachia lineages (ii) gene transfers by bacteriophages which could drive significant evolutionary changes in the genomes of intracellular bacteria. The expression of orf7 in wVul was examined by RTPCR and no signal was observed, suggesting that the orf7 gene is not expressed in wVul and that the bacteriophage WO may be an inactived prophage in this strain. In addition, in spite of the presence of the prophage-like genetic element in the wVul genome, we failed to detect the presence of bacteriophage-like particles by ultrastructural

RT (+)

O. a (+)

P. d. p (+)

P. p (+)

A. v (+)

A. v (-)

C. Braquart-Varnier et al. / Biochemical and Biophysical Research Communications 337 (2005) 580–585

P

610 bp 394 bp

Fig. 4. RT-PCR of orf7 (A) and of wsp (B) RT (+) and (
) indicate the presence and absence of reverse transcriptase in the reaction, respectively. P, postive control for the PCR using the total DNA of A. vulgare infected by Wolbachia as template; N, negative control using no DNA template; M, DNA molecular weight markers.

584

C. Braquart-Varnier et al. / Biochemical and Biophysical Research Communications 337 (2005) 580–585

studies or in phage particle isolation attempts (data not shown). Even if the existence of prophage on the genomes of symbiotic bacteria is rare, prophage-like genetic element was common among various Wolbachia strains [12–16,18]. However, some Wolbachia phages might remain in a lysogenic state and seldom form particles [15,16]. Alternatively, those phages might have lost some or most of the genes required for producing particles. Directions for future experiments include examining whether the phage WO represents an inactivated prophage that is not able to produce numerous viral particles or an exogenic bacteriophage. For these analyses and to identify the genes essential for the construction of the phage transforming vector, it will be necessary to isolate and to characterize the orf7 locus in wVul and in other isopod Wolbachia strains. The recent publication of the Wolbachia genome sequence (wMel: Wolbachia harbored by Drosophila melanogaster) revealed two divergent families of prophage WO, labelled WO-A and WO-B [24]. Only the analysis of the genome sequence of wMel has highlighted the presence of the second phage-like sequence WO-B which has undergone a major rearrangement and translocation, suggesting it is inactive [25]. The comparison between the wBm (Wolbachia harbored by Brugia malayi) and the wMel genomes has reflected a stronger selection in wBm for repetitive DNA loss and no prophages were identified in the wBm genome [25]. Genomic analysis of the wVul complete genome (sequenced by the European Wolbachia project—EUWOL) will allow us to evaluate the bacteriophage WO genome copy number including integrated and encapsided genomes. The obtained results could allow us to specify the whole diversity of wVul bacteriophage and to clarify the effect exerted by the WO phage on its bacterial hosts. In addition, the characterization of the whole phage sequence will permit us to check whether some bacteriophage genes are related to virulence proteins as described in WOCauB1 [16] or are coding for ankyrin repeat proteins which could play a role in the reproductive alteration events [12,16,26]. A comparison of different phage sequences could also highlight the presence of specific genes responsible of each phenotypic effect induced by Wolbachia. Acknowledgments This work was partly supported by EuWol project (EU) QLK3-2000-01079 and by grants from CNRS and the University of Poitiers. We are grateful to C. Debenest, C. Delaunay, and M. Frelon-Raimond for valuable technical aid and collection of gonads. References [1] S.L. OÕNeill, R. Giordano, A.M. Colbert, T.L. Karr, H.M. Robertson, 16S rRNA phylogenetic analysis of the bacterial endosymbionts associated with cytoplasmic incompatibility in insects, Proc. Natl. Acad. Sci. 89 (1992) 2699–2702.

[2] R. Stouthamer, J.A. Breeuwer, G.D. Hurst, Wolbachia pipientis: microbial manipulator of arthropod reproduction, Annu. Rev. Microbiol. 53 (1999) 71–102. [3] C. Bandi, A.M. Dunn, G.D. Hurst, T. Rigaud, Inherited microorganisms, sex-specific virulence and reproductive parasitism, Trends Parasitol. 17 (2001) 88–94. [4] G. Martin, P. Juchault, J.J. Legrand, Mise en e´vidence dÕun microorganisme intracytoplasmique symbiote de lÕoniscoı¨de Armadillidium vulgare Latr. dont la pre´sence accompagne lÕintersexualite´ ou la fe´minisation totale des maˆles ge´ne´tiques de la ligne´e the´lyge`ne, C. R. Acad. Sci. Paris. 276 (1973) 2313–2316. [5] D. Bouchon, T. Rigaud, P. Juchault, Evidence for widespread Wolbachia infection in isopod crustaceans: molecular identification and host feminization, Proc. R. Soc. Lond. B. Biol. Sci. 265 (1998) 1081–1090. [6] J.J. Legrand, G. Martin, J.C. Artaud, Corre´lation entre la pre´sence dÕun symbiote bacte´rien dans les ovocytes de Porcellio dilatatus petiti et la ste´rilite´ du croisement P. d. petiti maˆle · P. d. dilatatus femelle, Arch. Inst. Pasteur 55 (1978) 507–514. [7] Y. Moret, P. Juchault, T. Rigaud, Wolbachia endosymbiont responsible for cytoplasmic incompatibility in a terrestrial crustacean: effects in natural and foreign hosts, Heredity 86 (2001) 325– 332. [8] P. Juchault, T. Rigaud, J.P. Mocquard, Evolution of sex determination and sex ratio variability in wild population of Armadillidium vulgare (Latr) (Crustacea, Isopoda): a case study in conflict resolution, Acta Oecol. 14 (1993) 547–562. [9] N. Lo, M. Casiraghi, E. Salati, C. Bazzochi, C. Bandi, How many Wolbachia supergroups exist? Mol. Biol. Evol. 19 (2002) 341–346. [10] E.F. Boyd, H. Brussow, Common themes among bacteriophageencoded virulence factors and diversity among the bacteriophages involved, Trends Microbiol. 11 (2002) 521–529. [11] J.D. Wright, F.S. Sjostrand, J.K. Portaro, A.R. Barr, The ultrastructure of the rickettsia-like microorganism Wolbachia pipientis and associated virus-like bodies in the mosquito Culex pipiens, J. Ultrastruct. Res. 63 (1978) 79–85. [12] S. Masui, S. Kamoda, T. Sasaki, H. Ishikawa, Distribution and evolution of bacteriophage WO in Wolbachia, the endosymbiont causing sexual alterations in arthropods, J. Mol. Evol. 51 (2000) 491– 497. [13] S.R. Bordenstein, J.J. Wernegreen, Bacteriophage flux in endosymbionts (Wolbachia): infection frequency, lateral transfer, and recombination rates, Mol. Biol. Evol. 21 (2004) 1981–1991. [14] L. Gavotte, F. Vavre, H. Henri, M. Ravallec, R. Stouthamer, M. Bouletreau, Diversity, distribution and specificity of WO phage infection in Wolbachia of four insect species, Insect Mol. Biol. 13 (2004) 147–153. [15] S. Masui, H. Kuroiwa, T. Sasaki, M. Inui, T. Kuroiwa, H. Ishikawa, Bacteriophage WO and virus-like particles in Wolbachia, an endosymbiont of arthropods, Biochem. Biophys. Res. Commun. 283 (2001) 1099–1104. [16] Y. Fujii, T. Kubo, H. Ishikawa, T. Sasaki, Isolation and characterization of the bacteriophage WO from Wolbachia, an arthropod endosymbiont, Biochem. Biophys. Res. Commun. 317 (2004) 1183– 1188. [17] S.L. OÕNeill, T.L. Karr, Bidirectional incompatibility between conspecific populations of Drosophila simulans, Nature 6297 (1990) 178– 180. [18] Y.O. Sanogo, S.L. Dobson, Molecular discrimation of Wolbachia in the Culex pipens complex; evidence for variable hyperparasitism, Insect Mol. Biol. 13 (2004) 365–369. [19] P. Juchault, M. Frelon, D. Bouchon, T. Rigaud, New evidence for feminizing bacteria in terrestrial isopods: evolutionary implications, C. R. Acad. Sci. Paris 317 (1994) 225–230. [20] T. Rigaud, J. Moreau, P. Juchault, Wolbachia infection in the terrestrial isopod Oniscus asellus: sex ratio distortion and effect on fecundity, Heredity 83 (1999) 469–475.

C. Braquart-Varnier et al. / Biochemical and Biophysical Research Communications 337 (2005) 580–585 [21] T.D. Kocher, W.K. Thomas, A. Meyer, S.V. Edwards, S. Pa¨a¨bo, F.X. Villablanca, A.C. Wilson, Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers, Proc. Natl. Acad. Sci. USA 86 (1989) 6196–6200. [22] J.D. Thompson, D.G. Higgins, T.J. Gibson, CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice, Nucleic Acids Res. 22 (1994) 4673–4680. [23] W. Zhou, F. Rousset, S. OÕNeil, Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences, Proc. Biol. Sci. 265 (1998) 509–515. [24] M. Wu, L.V. Sun, J. Vamathevan, M. Riegler, R. Deboy, J.C. Brownlie, E.A. McGraw, W. Martin, C. Esser, N. Ahmadinejad, C. Wiegand, R. Madupu, M.J. Beanan, L.M. Brinkac, S.C. Daugherty, A.S. Durkin, J.F. Kolonay, W.C. Nelson, Y. Mohamoud, P. Lee, K. Berry, M.B. Young, T. Utterback, J.

585

Weidman, W.C. Nierman, I.T. Paulsen, K.E. Nelson, H. Tettelin, S.L. OÕNeill, J.A. Eisen, Phylogenomics of the reproductive parasite Wolbachia pipientis wMel: a streamlined genome overrun by mobile genetic elements, PLoS Biol. 2 (2004) 327–341. [25] J. Foster, M. Ganatra, I. Kamal, J. Wavre, K. Makarova, N. Ivanonva, A. Bhattacharyya, V. Kapatral, S. Kumar, J. Posfai, T. Vincze, J. Ingram, L. Moran, A. Lapidus, M. Omelchenko, N. Kyrpides, E. Ghedin, S. Wang, E. Goltsman, V. Joukov, O. Ostrovkaya, K. Tsukerman, M. Mazur, D. Comb, E. Koonin, B. Slatko, The Wolbachia genome of Brugia malayi: endosymbiont evolution within a human pathogenic nematode, PLoS Biol. 4 (2005) 599–614. [26] I. Iturbe-Ormaetxe, G.R. Burke, M. Riegler, S.L. OÕNeill, Distribution, expression and motif variability of ankyrin domain genes in Wolbachia pipientis, J. Bacteriol. 187 (2005) 5136–5145.