- Email: [email protected]
BAG3 gene silencing sensitizes leukemic cells to Bortezomib-induced apoptosis
FEBS Letters 583 (2009) 401–406
journal homepage: www.FEBSLetters.org
BAG3 gene silencing sensitizes leukemic cells to Bortezomib-induced apoptosis Peng Liu a,*, Bei Xu b, Jianyong Li a, Hua Lu a a b
Department of Hematology, The First Affiliated Hospital of Nanjing Medical University, 300 Guangzhou Road, Nanjing, People’s Republic of China Department of Internal Medicine, The First Affiliated Hospital of Nanjing Medical University, Nanjing, People’s Republic of China
a r t i c l e
i n f o
Article history: Received 8 October 2008 Revised 29 November 2008 Accepted 11 December 2008 Available online 25 December 2008 Edited by Veli-Pekka Lehto Keywords: BAG3 Bortezomib Leukemia Apoptosis Proteasome inhibitor
a b s t r a c t Proteasome inhibition has emerged as a powerful option for the treatment of a number of malignancies including leukemias. However, Bortezomib showed limited single-agent activity for patients with leukemia. Here, we report for the first time that Bortezomib up-regulated a novel antiapoptotic protein, BAG3, in human leukemic cells. BAG3 gene knockdown with shRNA greatly potentiated the generation of apoptosis by Bortezomib in leukemia cells. Furthermore, BAG3 silencing enhanced the antitumor activity of Bortezomib dramatically in a nude mouse model. Our results indicate that knocking down BAG3 gene is a promising new approach to enhance the therapeutic potency of Bortezomib in leukemia. Ó 2008 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
1. Introduction The proteasome is a multisubunit proteolytic complex that is responsible for the degradation of 80% of all cellular proteins. It also plays a central role in normal cell cycling, function, and survival by mediating the degradation of ubiquitylated target proteins, making proteasome inhibition a novel therapeutic target in cancer [1–4]. Bortezomib was the first proteasome inhibitor used in clinical trials and has been approved for the treatment of patients with refractory multiple myeloma. Studies indicated that Bortezomib exerts its antitumor activity through stabilizing p21, p27 and p53, as well as the pro-apoptotic Bid and Bax proteins, caveolin-1 and NF-jB inhibitor IjB-a [5,6]. Based on the solid preclinical rationale, Bortezomib was introduced into a number of clinical trials for a broader spectrum of diseases including leukemias [6,7]. However, the pleiotropic effects of proteasome inhibitors also result in activation of antiapoptotic pathways that may compromise their antitumor activity. This phenomenon may partially explain the limited single-agent activity of Bortezomib in patients with leukemia. These ‘‘unwanted” pathway mediators mentioned above include heat shock response proteins (HSPs), mitogen-activated protein kinase phosphatase-1 and protein kinase B/Akt [6,8]. BAG3 is a member of the cochaperone family which contains the BAG (Bcl-2-Associated Athanogene) domain and is characterized by its property of biochemically and functionally interacting with a variety of partners, including HSPs, steroid hormone recep* Corresponding author. Fax: +86 25 86550156. E-mail address: [email protected] (P. Liu).
tors, Bcl-2, Raf-1, involved in modulating cell proliferation and apoptosis [9–14]. Several studies showed that, in human primary lymphoid and myeloblastic leukemias and other neoplastic cell types, BAG3 expression sustains cell survival and underlies resistance to therapy, through downmodulation of apoptosis [15–17]. Here, we report for the first time that Bortezomib upregulated BAG3 expression in leukemic cells and that BAG3 gene silencing greatly potentiates the apoptotic action of this drug. 2. Materials and methods 2.1. Cell culture and reagents HL-60, U937, Jurkat, and MO7-e human leukemia cell lines were purchased from American Type Culture Collection (Rockville, MD). All cells were routinely grown in suspension in RPMI 1640 medium (Gibco, Grand Island, NY) containing glutamine (0.200 g/L), antibiotics (penicillin 100 IU/mL; streptomycin 100 lg/mL) and supplemented with 10% heat-inactivated fetal bovine serum (FBS), in a 5% CO2 humidified atmosphere at 37 °C. Cell viability was determined by using a trypan blue dye exclusion assay. Bortezomib is commercially available from Millennium Pharmaceuticals (Cambridge, MA). 2.2. Western blot Whole-cell pellets were lysed in 50 mM Tris–HCl (pH 7.6) buffer containing 0.15 M NaCl, 1 mM EDTA, 10 lg/mL leupeptin and
0014-5793/$34.00 Ó 2008 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2008.12.032
402
P. Liu et al. / FEBS Letters 583 (2009) 401–406
benzamidine, 1 mM PMSF, and Triton X-100 1%. Proteins in cell lysates were resolved by SDS–PAGE and transferred to nitrocellulose membranes (Bio-Rad). Membranes were blocked in bovine serum albumin (3%) in Tris-buffered saline (TBS)–Tween 20 (0.05%) and incubated with antibodies against human BAG3 (Alexis Biochemicals, San Diego, CA), p21 (Calbiochem, La Jolla, CA), bcl-2, IjB-a and Phospho-IjB-a (Cell Signaling, Beverly, MA) at 1:1000 dilutions followed by horseradish peroxidase–conjugated secondary antibodies at 1:5000 dilutions. Detection was performed by using enhanced chemiluminescence (ECL). 2.3. 20S proteasome activity assay Cytosolic extracts (without protease inhibitors) were used to measure proteasome activity using 20S proteasome assay kit (Chemicon International, Temecula, CA) following the manufacturer’s instructions. The assay is based on detection of the fluorophore 7-amino-4-methylcoumarin (AMC) after cleavage from the labeled substrate LLVY-AMC. The free AMC fluorescence was quantified using a 380/460-nm filter set in a fluorometer. 2.4. Assessment of apoptosis After drug exposure, cells were washed with 1 PBS and stained with annexin V/PI (BD Pharmingen) for 30 min at room temperature. Cells were then processed and analyzed using a Becton Dickinson FACScan cytofluorometer (Mansfield, MA) with the use of
Cell Quest software (Becton Dickinson, Palo Alto, CA). Cells were considered to be apoptotic if they were either annexin V+/PI (early apoptotic) or annexin V+/PI+ (late apoptotic). 2.5. Caspase-3. activity Caspase-3 activity was measured on cell extract by a colorimetric procedure using the specific peptide substrate DEVD-pNa as described previously [18]. Briefly, Cells (2 106) were pelleted, washed with PBS, and lysed in 50 mM Tris–HC1, pH 7.5, 0.03% NP-40, 1.0 mM DTT. Lysates were centrifuged at 14 000 rpm for 15 min at 4 °C. Total protein determination was done using the Bradford assay. Assays were set up in 96 well plates containing 0.2 mM DEVD-pNa in a caspase reaction buffer (100 mM HEPES, pH 7.5, 10% sucrose, 0.1% CHAPS, 10 mM DTT) and 0.01 ml of protein extract (20–50 lg) in a total volume of 0.1 ml. Assays were incubated at 37 °C. Release of pNa was detected by periodic readings of absorbance at 405 nm taken against a blank containing buffer and peptide alone (i.e., no extract) from 0 to 5 h to mark the linearity of the enzymatic reaction in time. Enzyme activities were measured as initial velocities and expressed as relative intensity/ min/mg total protein within the linear range of the response. 2.6. shRNAs Short-hairpin RNAs (shRNAs) cloned into the vector pLKO.1puro were chosen from the human library (MISSION TRC-Hs 1.0)
Fig. 1. Bortezomib up-regulates BAG3 expression in human leukemia cell lines. (A and B) Human leukemic HL-60 and U937 cell lines were incubated in 10 nM Bortezomib for the indicated time, after which proteasome activity was analyzed as described in Section 2. Results are shown as means ± S.D. of triplicates samples. (C and D) HL-60 and U937 cell lines were incubated in 10 nM Bortezomib for the indicated time. Total protein extracts from both cell lines were analyzed by Western blotting. Membranes were probed for p21 and pIjB to confirm proteasome activity inhibition. IjB protein was also detected. a-Tubulin was probed as an equal loading control. (E) HL-60, U937, Jurkat, and MO7-e cells were treated with 10 nM Bortezomib for 16 h. Western blot was then performed to detect BAG3 protein levels. The blot was stripped and re-probed with anti-a-tubulin antibody to show equal loading of total protein.
P. Liu et al. / FEBS Letters 583 (2009) 401–406
and purchased from Sigma. The sequences of shRNAs targeting human BAG3 gene used in this study were shBAG3-1 plasmid, CCGGGCATGCATTTCAGAGACTTTACTCGAGTAAAGTCTCTGAAATGCATGCTTTTT and shBAG3-2, CCGGCTTGAACAGAAAGCCATTGATCTCGAGATCAATGGCTTTCTGTTCAAGTTTTT, respectively. The control shRNA (non-target shRNA vector, Sigma) contains a hairpin insert that will generate siRNAs but contains five base pair mismatches to any known human gene. Pooled stable transfectants were established using puromycin selection (2 lg/mL). 2.7. Mice Female immune deficient BALB/c nude mice at 4 weeks of age were maintained in pathogen-free conditions with irradiated chow. Animals were bilaterally, s.c. injected with 2 106 HL-60 transfects stably expressing control shRNA or shBAG3-2 in 0.1 ml Matrigel (Collaborative Biomedical Products, Bedford, MA, USA), forming two tumors/mouse. When HL-60 tumors were palpable, mice were randomized into six groups (n = 5) and were treated intraperitoneally with Bortezomib at 1 mg/kg twice a week or with vehicle only. The subcutaneous tumors were measured twice a week and tumor sizes were calculated by the formula: a b c, where ‘a’ is the length and ‘b’ is the width and ‘c’ is the height in millimeters. At the end of the experiment, animals were killed by CO2 asphyxiation and tumor weights were measured after careful resection. 2.8. Statistical analysis Data are presented as means ± S.D. of at least three independent experiments. Differences between groups were analyzed using
403
two-tailed Student’s t-test. P < 0.05 was considered statistically significant.
3. Results and discussion It has been showed that Bortezomib inhibits the 26S proteasome by binding the chymotrypsin-like active site in the 20S core complex. We first confirmed the proteasome inhibitory activity of this drug at concentration used in this study. Human leukemic HL60 and U937 cell lines were incubated in 10 nM Bortezomib for up to 16 h, after which proteasome activity was analyzed as described in Section 2. As shown in Fig. 1A and B, exposure to 10 nM Bortezomib for 4 or more hours resulted in approximately 80% and 70% reduction in proteasome activity in HL-60 and U937 cells, respectively. To further validate the assay, the levels of several proteins known to be regulated by proteasome were detected after Bortezomib incubation. Fig. 1C and D shows the accumulation of p21, and the phosphorylated form of IjB after 10 nM Bortezomib incubation for the indicated time in both cell lines tested. However, there was a slight decrease in the amount of IjB following Bortezomib treatment, which is consistent with previous report [19]. We then checked the effect of Bortezomib treatment on BAG3 expression in leukemic cell lines. HL-60, U937, Jurkat, and MO7-e cell lines were incubated in 10 nM Bortezomib for 16 h and BAG3 level was measured by Western blot. As shown in Fig. 1E, Bortezomib markedly up-regulated BAG3 expression at protein level in all these four cell lines. To evaluate the potential role of BAG3 in Bortezomib-induced apoptosis, we used two shRNA-expressing plasmids with different target sequences to induce BAG3 gene silencing and established
Fig. 2. BAG3 gene knockdown sensitizes leukemic cells to Bortezomib-induced apoptosis. (A) HL-60 and U937 stable transfectant cells expressing control shRNA or shBAG31/-2 were exposed to 10 nM Bortezomib for 16 h, after which BAG3 protein level was analyzed by Western blot analysis. (B) HL-60 and U937 stable transfectant cells expressing control shRNA or shBAG3-1/-2 were exposed to 10 nM Bortezomib for 16 h, after which apoptotic cells were monitored by annexin V/PI staining and flow cytometry. Results are shown as means ± S.D. of triplicates samples. *P < 0.05, **P < 0.01.
404
P. Liu et al. / FEBS Letters 583 (2009) 401–406
stable transfectants (shBAG3-1 and shBAG3-2) in HL-60 and U937 cell lines. BAG3 gene knockdown with shRNA was confirmed by immunoblot as shown in Fig. 2A. As shown in Fig. 2B, BAG3 gene down-regulation greatly potentiated the generation of apoptosis by Bortezomib, with higher efficacy in the case of HL-60 cells, reflected by annexin V/PI staining. Moreover, BAG3 gene silencing markedly enhanced caspase-3 activation caused by Bortezomib treatment (Fig. 3A). However, little change was noted in the expression of Bcl-2 protein in cells treated with Bortezomib or shRNA targeting BAG3 (Fig. 3B). We further determine the effect of modulating BAG3 expression on the anticancer activity of Bortezomib in vivo. A nude mouse model was generated using HL-60 stable transfectants expressing shBAG3-2, which had higher efficacy of BAG3 knockdown than the other transfectant shBAG3-1 in HL-60 cells, as determined in Fig. 2A. When HL-60 tumors were palpable, mice were randomized into six groups (n = 5) and were treated intraperitoneally with Bortezomib at 1 mg/kg twice a week, a safe and moderate dose suggested by previous studies [20–23]. As shown in Fig. 4A and B, although BAG3 silencing alone had no influence on leukemic cell growth in vivo, it enhanced the antitumor activity of Bortezomib dramatically, resulting in decreased tumor growth and weight at autopsy. The 26S ubiquitin–proteasome, formed by the 20S core complex and the 19S regulatory particle, is present in both the cytoplasm and the nucleus of all eukaryotic cells and modulates both the levels and functions of many proteins involved in cell cycle progression, differentiation, apoptosis, and adhesion to the microenvironment [24–29]. With the approval of the proteasome inhibitor Bortezomib for clinical use, proteasome inhibition has emerged as a powerful option for the pharmacological treatment of multiple
myeloma and possibly other malignancies including leukemias. However, despite encouraging preclinical data, Bortezomib showed limited single-agent activity for patients with leukemia, which is as yet unexplained. It is interesting to note that Bortezomib may also inhibit the degradation of antiapoptotic pathway mediators and thereby suppress the antitumor activity of its own. Thus, these antiapoptotic molecules could be targets for chemosensitization to proteasome inhibitors [6]. BAG-family proteins represent an evolutionarily conserved group of HSP70/HSC70-binding co-chaperones, with six members identified in the human and mouse genomes. HSP70/HSC70 family proteins regulate a variety of cellular processes, including signal transduction, transcription, and protein degradation [13,14,30]. BAG3 binds to the ATPase domain of HSC70 with high affinity and thereby inhibits its chaperone activity [14,31]. In a mouse model, BAG3 gene deficiency resulted in fulminant myopathy and an early lethality [32]. Moreover, BAG3 prevents cell death through synergizing with Bcl-2 [11]. It has been found to downmodulate the apoptotic response to tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) in thyroid carcinomas [33]. In addition, an antiapoptotic role of this gene was reported in chronic lymphocytic leukemia and acute lymphoblastic leukemia primary cultures [15–17]. BAG3 has been demonstrated to be induced by proteasome inhibitor MG132 in various cancer cells at the transcriptional level [34]. A more recent report showed that Bortezomib-induced BAG3 mRNA and protein expression in proximal tubular epithelial cells [35]. However, little is known about the role of BAG3 in Bortezomib-induced apoptosis. Evidence is emerging which suggests a beneficial role of Bortezomib in leukemia protocols. Our results from both in vitro
Fig. 3. Effect of BAG3 gene silencing on caspase-3 activity and bcl-2 expression. (A) HL-60 and U937 stable transfectant cells expressing control shRNA or shBAG3-1/-2 were exposed to 10 nM Bortezomib for 16 h, after which caspase-3 activity was determined in cell extracts by means of a colorimetric assay of the DEVD-pNa substrate hydrolysis as described in Section 2. OD indicates optical density. (B) HL-60 and U937 stable transfectant cells expressing control shRNA or shBAG3-1/-2 were exposed to 10 nM Bortezomib for 16 h, after which Bcl-2 protein level was analyzed by Western blot analysis.
P. Liu et al. / FEBS Letters 583 (2009) 401–406
405
Fig. 4. Effect of modulating BAG3 expression on the antiproliferative activity of Bortezomib in vivo. (A) Female immune deficient BALB/c nude mice at 4 weeks of age were bilaterally, s.c. injected with 2 106 HL-60 transfects stably expressing control shRNA or shBAG3-2, forming two tumors/mouse. When HL-60 tumors were palpable, mice were randomized into six groups (n = 5) and were treated intraperitoneally with Bortezomib (Bort) at 1 mg/kg twice a week or with vehicle only. The subcutaneous tumors were measured twice a week and tumor sizes were calculated by the formula: a b c, where ‘a’ is the length and ‘b’ is the width and ‘c’ is the height in millimeters. Each point represents the means ± S.D. of 10 tumors. (B) Relative Tumor weights at autopsy. After 2 weeks of treatment, tumors were removed and weighed. The weight of parental HL-60 tumors treated with vehicle only is set as 100%. Results represent means ± S.D. of tumor weights. Asterisks are given for significances of shBAG3 versus control shRNA in Bortezomib-treated groups. *P < 0.05, **P < 0.01.
apoptosis assay and in vivo animal model indicate that knocking down BAG3 gene is a promising new approach to enhance the therapeutic potency of Bortezomib in patients with leukemia. Acknowledgements This work was supported in part by National Natural Science Foundation of China (30500603), ‘‘863” Project (2003AA205060) from the Ministry of Science and Technology of China, and Chuangxin Foundation of Nanjing Medical University (CX2003004). References [1] Ciechanover, A. (1994) The ubiquitin–proteasome proteolytic pathway. Cell 79, 13–21. [2] Adams, J. (2001) Proteasome inhibition in cancer: development of PS-341. Semin. Oncol. 28, 613–619. [3] Adams, J. (2002) Development of the proteasome inhibitor PS-341. Oncologist 7, 9–16. [4] Adams, J. (2004) The development of proteasome inhibitors as anticancer drugs. Cancer Cell 5, 417–421. [5] Rajkumar, S.V., Richardson, P.G., Hideshima, T. and Anderson, K.C. (2005) Proteasome inhibition as a novel therapeutic target in human cancer. J Clin Oncol 23, 630–639. [6] Orlowski, R.Z. and Kuhn, D.J. (2008) Proteasome inhibitors in cancer therapy: lessons from the first decade. Clin. Cancer Res. 14, 1649–1657. [7] Orlowski, R.Z., Voorhees, P.M., Garcia, R.A., Hall, M.D., Kudrik, F.J., Allred, T., Johri, A.R., Jones, P.E., Ivanova, A., Van Deventer, H.W., Gabriel, D.A., Shea, T.C., Mitchell, B.S., Adams, J., Esseltine, D.L., Trehu, E.G., Green, M., Lehman, M.J., Natoli, S., Collins, J.M., Lindley, C.M. and Dees, E.C. (2005) Phase 1 trial of the proteasome inhibitor bortezomib and pegylated liposomal doxorubicin in patients with advanced hematologic malignancies. Blood 105, 3058–3065. [8] Cortes, J., Thomas, D., Koller, C., Giles, F., Estey, E., Faderl, S., Garcia-Manero, G., McConkey, D., Ruiz, S.L., Guerciolini, R., Wright, J. and Kantarjian, H. (2004) Phase I study of bortezomib in refractory or relapsed acute leukemias. Clin. Cancer Res. 10, 3371–3376. [9] Doong, H., Vrailas, A. and Kohn, E.C. (2002) What’s in the ‘BAG’?–A functional domain analysis of the BAG-family proteins. Cancer Lett. 188, 25–32. [10] Doong, H., Price, J., Kim, Y.S., Gasbarre, C., Probst, J., Liotta, L.A., Blanchette, J., Rizzo, K. and Kohn, E. (2000) CAIR-1/BAG-3 forms an EGF-regulated ternary complex with phospholipase C-gamma and Hsp70/Hsc70. Oncogene 19, 4385–4395. [11] Lee, J.H., Takahashi, T., Yasuhara, N., Inazawa, J., Kamada, S. and Tsujimoto, Y. (1999) Bis, a Bcl-2-binding protein that synergizes with Bcl-2 in preventing cell death. Oncogene 18, 6183–6190. [12] Antoku, K., Maser, R.S., Scully Jr., W.J., Delach, S.M. and Johnson, D.E. (2001) Isolation of Bcl-2 binding proteins that exhibit homology with BAG-1 and suppressor of death domains protein. Biochem. Biophys. Res. Commun. 286, 1003–1010.
[13] Takayama, S. and Reed, J.C. (2001) Molecular chaperone targeting and regulation by BAG family proteins. Nat. Cell Biol. 3, E237–241. [14] Takayama, S., Xie, Z. and Reed, J.C. (1999) An evolutionarily conserved family of Hsp70/Hsc70 molecular chaperone regulators. J. Biol. Chem. 274, 781–786. [15] Romano, M.F., Festa, M., Pagliuca, G., Lerose, R., Bisogni, R., Chiurazzi, F., Storti, G., Volpe, S., Venuta, S., Turco, M.C. and Leone, A. (2003) BAG3 protein controls B-chronic lymphocytic leukaemia cell apoptosis. Cell Death Differ. 10, 383– 385. [16] Romano, M.F., Festa, M., Petrella, A., Rosati, A., Pascale, M., Bisogni, R., Poggi, V., Kohn, E.C., Venuta, S., Turco, M.C. and Leone, A. (2003) BAG3 protein regulates cell survival in childhood acute lymphoblastic leukemia cells. Cancer Biol. Ther. 2, 508–510. [17] Bonelli, P., Petrella, A., Rosati, A., Romano, M.F., Lerose, R., Pagliuca, M.G., Amelio, T., Festa, M., Martire, G., Venuta, S., Turco, M.C. and Leone, A. (2004) BAG3 protein regulates stress-induced apoptosis in normal and neoplastic leukocytes. Leukemia 18, 358–360. [18] Belmokhtar, C.A., Hillion, J. and Ségal-Bendirdjian, E. (2001) Staurosporine induces apoptosis through both caspase-dependent and caspase-independent mechanisms. Oncogene 20, 3354–3362. [19] Colado, E., Alvarez-Fernández, S., Maiso, P., Martín-Sánchez, J., Vidriales, M.B., Garayoa, M., Ocio, E.M., Montero, J.C., Pandiella, A. and San Miguel, J.F. (2008) The effect of the proteasome inhibitor bortezomib on acute myeloid leukemia cells and drug resistance associated with the CD34+ immature phenotype. Haematologica 93, 57–66. [20] Shen, L., Au, W.Y., Guo, T., Wong, K.Y., Wong, M.L., Tsuchiyama, J., Yuen, P.W., Kwong, Y.L., Liang, R.H. and Srivastava, G. (2007) Proteasome inhibitor bortezomib-induced apoptosis in natural killer (NK)-cell leukemia and lymphoma: an in vitro and in vivo preclinical evaluation. Blood 110, 469–470. [21] Satou, Y., Nosaka, K., Koya, Y., Yasunaga, J.I., Toyokuni, S. and Matsuoka, M. (2004) Proteasome inhibitor, bortezomib, potently inhibits the growth of adult T-cell leukemia cells both in vivo and in vitro. Leukemia 18, 1357–1363. [22] LeBlanc, R., Catley, L.P., Hideshima, T., Lentzsch, S., Mitsiades, C.S., Mitsiades, N., Neuberg, D., Goloubeva, O., Pien, C.S., Adams, J., Gupta, D., Richardson, P.G., Munshi, N.C. and Anderson, K.C. (2002) Proteasome inhibitor PS-341 inhibits human myeloma cell growth in vivo and prolongs survival in a murine model. Cancer Res. 62, 4996–5000. [23] Adams, J., Palombella, V.J., Sausville, E.A., Johnson, J., Destree, A., Lazarus, D.D., Maas, J., Pien, C.S., Prakash, S. and Elliott, P.J. (1999) Proteasome inhibitors: a novel class of potent and effective antitumor agents. Cancer Res. 59, 2615– 2622. [24] Koepp, D.M., Harper, J.W. and Elledge, S.J. (1999) How the cyclin became a cyclin: regulated proteolysis in the cell cycle. Cell 97, 431–434. [25] Karin, M., Yamamoto, Y. and Wang, Q.M. (2004) The IKK NF-kappa B system: a treasure trove for drug development. Nat. Rev. Drug Discov. 3, 17–26. [26] Ciechanover, A. (1998) The ubiquitin–proteasome pathway: on protein death and cell life. EMBO J. 17, 7151–7160. [27] Pagano, M., Tam, S.W., Theodoras, A.M., Beer-Romero, P., Del Sal, G., Chau, V., Yew, P.R., Draetta, G.F. and Rolfe, M. (1995) Role of the ubiquitin–proteasome pathway in regulating abundance of the cyclin-dependent kinase inhibitor p27. Science 269, 682–685. [28] Sulahian, R., Sikder, D., Johnston, S.A. and Kodadek, T. (2006) The proteasomal ATPase complex is required for stress-induced transcription in yeast. Nucleic Acids Res. 34, 1351–1357.
406
P. Liu et al. / FEBS Letters 583 (2009) 401–406
[29] Adams, J. (2004) The proteasome: a suitable antineoplastic target. Nat. Rev. Cancer 4, 349–360. [30] Takayama, S., Bimston, D.N., Matsuzawa, S., Freeman, B.C., Aime-Sempe, C., Xie, Z., Morimoto, R.I. and Reed, J.C. (1997) BAG-1 modulates the chaperone activity of Hsp70/Hsc70. EMBO J. 16, 4887–4896. [31] Rosati, A., Ammirante, M., Gentilella, A., Basile, A., Festa, M., Pascale, M., Marzullo, L., Belisario, M.A., Tosco, A., Franceschelli, S., Moltedo, O., Pagliuca, G., Lerose, R. and Turco, M.C. (2007) Apoptosis inhibition in cancer cells: a novel molecular pathway that involves BAG3 protein. Int. J. Biochem. Cell Biol. 39, 1337–1342. [32] Homma, S., Iwasaki, M., Shelton, G.D., Engvall, E., Reed, J.C. and Takayama, S. (2006) BAG3 deficiency results in fulminant myopathy and early lethality. Am. J. Pathol. 169, 761–773.
[33] Chiappetta, G., Ammirante, M., Basile, A., Rosati, A., Festa, M., Monaco, M., Vuttariello, E., Pasquinelli, R., Arra, C., Zerilli, M., Todaro, M., Stassi, G., Pezzullo, L., Gentilella, A., Tosco, A., Pascale, M., Marzullo, L., Belisario, M.A., Turco, M.C. and Leone, A. (2007) The antiapoptotic protein BAG3 is expressed in thyroid carcinomas and modulates apoptosis mediated by tumor necrosis factorrelated apoptosis-inducing ligand. J. Clin. Endocrinol. Metab. 92, 1159–1163. [34] Wang, H.Q., Liu, H.M., Zhang, H.Y., Guan, Y. and Du, Z.X. (2008) Transcriptional upregulation of BAG3 upon proteasome inhibition. Biochem. Biophys. Res. Commun. 365, 381–385. [35] Sarközi, R., Perco, P., Hochegger, K., Enrich, J., Wiesinger, M., Pirklbauer, M., Eder, S., Rudnicki, M., Rosenkranz, A.R., Mayer, B., Mayer, G. and Schramek, H. (2008) Bortezomib-induced survival signals and genes in human proximal tubular cells. J. Pharmacol. Exp. Ther. 327, 645–656.
journal homepage: www.FEBSLetters.org
BAG3 gene silencing sensitizes leukemic cells to Bortezomib-induced apoptosis Peng Liu a,*, Bei Xu b, Jianyong Li a, Hua Lu a a b
Department of Hematology, The First Affiliated Hospital of Nanjing Medical University, 300 Guangzhou Road, Nanjing, People’s Republic of China Department of Internal Medicine, The First Affiliated Hospital of Nanjing Medical University, Nanjing, People’s Republic of China
a r t i c l e
i n f o
Article history: Received 8 October 2008 Revised 29 November 2008 Accepted 11 December 2008 Available online 25 December 2008 Edited by Veli-Pekka Lehto Keywords: BAG3 Bortezomib Leukemia Apoptosis Proteasome inhibitor
a b s t r a c t Proteasome inhibition has emerged as a powerful option for the treatment of a number of malignancies including leukemias. However, Bortezomib showed limited single-agent activity for patients with leukemia. Here, we report for the first time that Bortezomib up-regulated a novel antiapoptotic protein, BAG3, in human leukemic cells. BAG3 gene knockdown with shRNA greatly potentiated the generation of apoptosis by Bortezomib in leukemia cells. Furthermore, BAG3 silencing enhanced the antitumor activity of Bortezomib dramatically in a nude mouse model. Our results indicate that knocking down BAG3 gene is a promising new approach to enhance the therapeutic potency of Bortezomib in leukemia. Ó 2008 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
1. Introduction The proteasome is a multisubunit proteolytic complex that is responsible for the degradation of 80% of all cellular proteins. It also plays a central role in normal cell cycling, function, and survival by mediating the degradation of ubiquitylated target proteins, making proteasome inhibition a novel therapeutic target in cancer [1–4]. Bortezomib was the first proteasome inhibitor used in clinical trials and has been approved for the treatment of patients with refractory multiple myeloma. Studies indicated that Bortezomib exerts its antitumor activity through stabilizing p21, p27 and p53, as well as the pro-apoptotic Bid and Bax proteins, caveolin-1 and NF-jB inhibitor IjB-a [5,6]. Based on the solid preclinical rationale, Bortezomib was introduced into a number of clinical trials for a broader spectrum of diseases including leukemias [6,7]. However, the pleiotropic effects of proteasome inhibitors also result in activation of antiapoptotic pathways that may compromise their antitumor activity. This phenomenon may partially explain the limited single-agent activity of Bortezomib in patients with leukemia. These ‘‘unwanted” pathway mediators mentioned above include heat shock response proteins (HSPs), mitogen-activated protein kinase phosphatase-1 and protein kinase B/Akt [6,8]. BAG3 is a member of the cochaperone family which contains the BAG (Bcl-2-Associated Athanogene) domain and is characterized by its property of biochemically and functionally interacting with a variety of partners, including HSPs, steroid hormone recep* Corresponding author. Fax: +86 25 86550156. E-mail address: [email protected] (P. Liu).
tors, Bcl-2, Raf-1, involved in modulating cell proliferation and apoptosis [9–14]. Several studies showed that, in human primary lymphoid and myeloblastic leukemias and other neoplastic cell types, BAG3 expression sustains cell survival and underlies resistance to therapy, through downmodulation of apoptosis [15–17]. Here, we report for the first time that Bortezomib upregulated BAG3 expression in leukemic cells and that BAG3 gene silencing greatly potentiates the apoptotic action of this drug. 2. Materials and methods 2.1. Cell culture and reagents HL-60, U937, Jurkat, and MO7-e human leukemia cell lines were purchased from American Type Culture Collection (Rockville, MD). All cells were routinely grown in suspension in RPMI 1640 medium (Gibco, Grand Island, NY) containing glutamine (0.200 g/L), antibiotics (penicillin 100 IU/mL; streptomycin 100 lg/mL) and supplemented with 10% heat-inactivated fetal bovine serum (FBS), in a 5% CO2 humidified atmosphere at 37 °C. Cell viability was determined by using a trypan blue dye exclusion assay. Bortezomib is commercially available from Millennium Pharmaceuticals (Cambridge, MA). 2.2. Western blot Whole-cell pellets were lysed in 50 mM Tris–HCl (pH 7.6) buffer containing 0.15 M NaCl, 1 mM EDTA, 10 lg/mL leupeptin and
0014-5793/$34.00 Ó 2008 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2008.12.032
402
P. Liu et al. / FEBS Letters 583 (2009) 401–406
benzamidine, 1 mM PMSF, and Triton X-100 1%. Proteins in cell lysates were resolved by SDS–PAGE and transferred to nitrocellulose membranes (Bio-Rad). Membranes were blocked in bovine serum albumin (3%) in Tris-buffered saline (TBS)–Tween 20 (0.05%) and incubated with antibodies against human BAG3 (Alexis Biochemicals, San Diego, CA), p21 (Calbiochem, La Jolla, CA), bcl-2, IjB-a and Phospho-IjB-a (Cell Signaling, Beverly, MA) at 1:1000 dilutions followed by horseradish peroxidase–conjugated secondary antibodies at 1:5000 dilutions. Detection was performed by using enhanced chemiluminescence (ECL). 2.3. 20S proteasome activity assay Cytosolic extracts (without protease inhibitors) were used to measure proteasome activity using 20S proteasome assay kit (Chemicon International, Temecula, CA) following the manufacturer’s instructions. The assay is based on detection of the fluorophore 7-amino-4-methylcoumarin (AMC) after cleavage from the labeled substrate LLVY-AMC. The free AMC fluorescence was quantified using a 380/460-nm filter set in a fluorometer. 2.4. Assessment of apoptosis After drug exposure, cells were washed with 1 PBS and stained with annexin V/PI (BD Pharmingen) for 30 min at room temperature. Cells were then processed and analyzed using a Becton Dickinson FACScan cytofluorometer (Mansfield, MA) with the use of
Cell Quest software (Becton Dickinson, Palo Alto, CA). Cells were considered to be apoptotic if they were either annexin V+/PI (early apoptotic) or annexin V+/PI+ (late apoptotic). 2.5. Caspase-3. activity Caspase-3 activity was measured on cell extract by a colorimetric procedure using the specific peptide substrate DEVD-pNa as described previously [18]. Briefly, Cells (2 106) were pelleted, washed with PBS, and lysed in 50 mM Tris–HC1, pH 7.5, 0.03% NP-40, 1.0 mM DTT. Lysates were centrifuged at 14 000 rpm for 15 min at 4 °C. Total protein determination was done using the Bradford assay. Assays were set up in 96 well plates containing 0.2 mM DEVD-pNa in a caspase reaction buffer (100 mM HEPES, pH 7.5, 10% sucrose, 0.1% CHAPS, 10 mM DTT) and 0.01 ml of protein extract (20–50 lg) in a total volume of 0.1 ml. Assays were incubated at 37 °C. Release of pNa was detected by periodic readings of absorbance at 405 nm taken against a blank containing buffer and peptide alone (i.e., no extract) from 0 to 5 h to mark the linearity of the enzymatic reaction in time. Enzyme activities were measured as initial velocities and expressed as relative intensity/ min/mg total protein within the linear range of the response. 2.6. shRNAs Short-hairpin RNAs (shRNAs) cloned into the vector pLKO.1puro were chosen from the human library (MISSION TRC-Hs 1.0)
Fig. 1. Bortezomib up-regulates BAG3 expression in human leukemia cell lines. (A and B) Human leukemic HL-60 and U937 cell lines were incubated in 10 nM Bortezomib for the indicated time, after which proteasome activity was analyzed as described in Section 2. Results are shown as means ± S.D. of triplicates samples. (C and D) HL-60 and U937 cell lines were incubated in 10 nM Bortezomib for the indicated time. Total protein extracts from both cell lines were analyzed by Western blotting. Membranes were probed for p21 and pIjB to confirm proteasome activity inhibition. IjB protein was also detected. a-Tubulin was probed as an equal loading control. (E) HL-60, U937, Jurkat, and MO7-e cells were treated with 10 nM Bortezomib for 16 h. Western blot was then performed to detect BAG3 protein levels. The blot was stripped and re-probed with anti-a-tubulin antibody to show equal loading of total protein.
P. Liu et al. / FEBS Letters 583 (2009) 401–406
and purchased from Sigma. The sequences of shRNAs targeting human BAG3 gene used in this study were shBAG3-1 plasmid, CCGGGCATGCATTTCAGAGACTTTACTCGAGTAAAGTCTCTGAAATGCATGCTTTTT and shBAG3-2, CCGGCTTGAACAGAAAGCCATTGATCTCGAGATCAATGGCTTTCTGTTCAAGTTTTT, respectively. The control shRNA (non-target shRNA vector, Sigma) contains a hairpin insert that will generate siRNAs but contains five base pair mismatches to any known human gene. Pooled stable transfectants were established using puromycin selection (2 lg/mL). 2.7. Mice Female immune deficient BALB/c nude mice at 4 weeks of age were maintained in pathogen-free conditions with irradiated chow. Animals were bilaterally, s.c. injected with 2 106 HL-60 transfects stably expressing control shRNA or shBAG3-2 in 0.1 ml Matrigel (Collaborative Biomedical Products, Bedford, MA, USA), forming two tumors/mouse. When HL-60 tumors were palpable, mice were randomized into six groups (n = 5) and were treated intraperitoneally with Bortezomib at 1 mg/kg twice a week or with vehicle only. The subcutaneous tumors were measured twice a week and tumor sizes were calculated by the formula: a b c, where ‘a’ is the length and ‘b’ is the width and ‘c’ is the height in millimeters. At the end of the experiment, animals were killed by CO2 asphyxiation and tumor weights were measured after careful resection. 2.8. Statistical analysis Data are presented as means ± S.D. of at least three independent experiments. Differences between groups were analyzed using
403
two-tailed Student’s t-test. P < 0.05 was considered statistically significant.
3. Results and discussion It has been showed that Bortezomib inhibits the 26S proteasome by binding the chymotrypsin-like active site in the 20S core complex. We first confirmed the proteasome inhibitory activity of this drug at concentration used in this study. Human leukemic HL60 and U937 cell lines were incubated in 10 nM Bortezomib for up to 16 h, after which proteasome activity was analyzed as described in Section 2. As shown in Fig. 1A and B, exposure to 10 nM Bortezomib for 4 or more hours resulted in approximately 80% and 70% reduction in proteasome activity in HL-60 and U937 cells, respectively. To further validate the assay, the levels of several proteins known to be regulated by proteasome were detected after Bortezomib incubation. Fig. 1C and D shows the accumulation of p21, and the phosphorylated form of IjB after 10 nM Bortezomib incubation for the indicated time in both cell lines tested. However, there was a slight decrease in the amount of IjB following Bortezomib treatment, which is consistent with previous report [19]. We then checked the effect of Bortezomib treatment on BAG3 expression in leukemic cell lines. HL-60, U937, Jurkat, and MO7-e cell lines were incubated in 10 nM Bortezomib for 16 h and BAG3 level was measured by Western blot. As shown in Fig. 1E, Bortezomib markedly up-regulated BAG3 expression at protein level in all these four cell lines. To evaluate the potential role of BAG3 in Bortezomib-induced apoptosis, we used two shRNA-expressing plasmids with different target sequences to induce BAG3 gene silencing and established
Fig. 2. BAG3 gene knockdown sensitizes leukemic cells to Bortezomib-induced apoptosis. (A) HL-60 and U937 stable transfectant cells expressing control shRNA or shBAG31/-2 were exposed to 10 nM Bortezomib for 16 h, after which BAG3 protein level was analyzed by Western blot analysis. (B) HL-60 and U937 stable transfectant cells expressing control shRNA or shBAG3-1/-2 were exposed to 10 nM Bortezomib for 16 h, after which apoptotic cells were monitored by annexin V/PI staining and flow cytometry. Results are shown as means ± S.D. of triplicates samples. *P < 0.05, **P < 0.01.
404
P. Liu et al. / FEBS Letters 583 (2009) 401–406
stable transfectants (shBAG3-1 and shBAG3-2) in HL-60 and U937 cell lines. BAG3 gene knockdown with shRNA was confirmed by immunoblot as shown in Fig. 2A. As shown in Fig. 2B, BAG3 gene down-regulation greatly potentiated the generation of apoptosis by Bortezomib, with higher efficacy in the case of HL-60 cells, reflected by annexin V/PI staining. Moreover, BAG3 gene silencing markedly enhanced caspase-3 activation caused by Bortezomib treatment (Fig. 3A). However, little change was noted in the expression of Bcl-2 protein in cells treated with Bortezomib or shRNA targeting BAG3 (Fig. 3B). We further determine the effect of modulating BAG3 expression on the anticancer activity of Bortezomib in vivo. A nude mouse model was generated using HL-60 stable transfectants expressing shBAG3-2, which had higher efficacy of BAG3 knockdown than the other transfectant shBAG3-1 in HL-60 cells, as determined in Fig. 2A. When HL-60 tumors were palpable, mice were randomized into six groups (n = 5) and were treated intraperitoneally with Bortezomib at 1 mg/kg twice a week, a safe and moderate dose suggested by previous studies [20–23]. As shown in Fig. 4A and B, although BAG3 silencing alone had no influence on leukemic cell growth in vivo, it enhanced the antitumor activity of Bortezomib dramatically, resulting in decreased tumor growth and weight at autopsy. The 26S ubiquitin–proteasome, formed by the 20S core complex and the 19S regulatory particle, is present in both the cytoplasm and the nucleus of all eukaryotic cells and modulates both the levels and functions of many proteins involved in cell cycle progression, differentiation, apoptosis, and adhesion to the microenvironment [24–29]. With the approval of the proteasome inhibitor Bortezomib for clinical use, proteasome inhibition has emerged as a powerful option for the pharmacological treatment of multiple
myeloma and possibly other malignancies including leukemias. However, despite encouraging preclinical data, Bortezomib showed limited single-agent activity for patients with leukemia, which is as yet unexplained. It is interesting to note that Bortezomib may also inhibit the degradation of antiapoptotic pathway mediators and thereby suppress the antitumor activity of its own. Thus, these antiapoptotic molecules could be targets for chemosensitization to proteasome inhibitors [6]. BAG-family proteins represent an evolutionarily conserved group of HSP70/HSC70-binding co-chaperones, with six members identified in the human and mouse genomes. HSP70/HSC70 family proteins regulate a variety of cellular processes, including signal transduction, transcription, and protein degradation [13,14,30]. BAG3 binds to the ATPase domain of HSC70 with high affinity and thereby inhibits its chaperone activity [14,31]. In a mouse model, BAG3 gene deficiency resulted in fulminant myopathy and an early lethality [32]. Moreover, BAG3 prevents cell death through synergizing with Bcl-2 [11]. It has been found to downmodulate the apoptotic response to tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) in thyroid carcinomas [33]. In addition, an antiapoptotic role of this gene was reported in chronic lymphocytic leukemia and acute lymphoblastic leukemia primary cultures [15–17]. BAG3 has been demonstrated to be induced by proteasome inhibitor MG132 in various cancer cells at the transcriptional level [34]. A more recent report showed that Bortezomib-induced BAG3 mRNA and protein expression in proximal tubular epithelial cells [35]. However, little is known about the role of BAG3 in Bortezomib-induced apoptosis. Evidence is emerging which suggests a beneficial role of Bortezomib in leukemia protocols. Our results from both in vitro
Fig. 3. Effect of BAG3 gene silencing on caspase-3 activity and bcl-2 expression. (A) HL-60 and U937 stable transfectant cells expressing control shRNA or shBAG3-1/-2 were exposed to 10 nM Bortezomib for 16 h, after which caspase-3 activity was determined in cell extracts by means of a colorimetric assay of the DEVD-pNa substrate hydrolysis as described in Section 2. OD indicates optical density. (B) HL-60 and U937 stable transfectant cells expressing control shRNA or shBAG3-1/-2 were exposed to 10 nM Bortezomib for 16 h, after which Bcl-2 protein level was analyzed by Western blot analysis.
P. Liu et al. / FEBS Letters 583 (2009) 401–406
405
Fig. 4. Effect of modulating BAG3 expression on the antiproliferative activity of Bortezomib in vivo. (A) Female immune deficient BALB/c nude mice at 4 weeks of age were bilaterally, s.c. injected with 2 106 HL-60 transfects stably expressing control shRNA or shBAG3-2, forming two tumors/mouse. When HL-60 tumors were palpable, mice were randomized into six groups (n = 5) and were treated intraperitoneally with Bortezomib (Bort) at 1 mg/kg twice a week or with vehicle only. The subcutaneous tumors were measured twice a week and tumor sizes were calculated by the formula: a b c, where ‘a’ is the length and ‘b’ is the width and ‘c’ is the height in millimeters. Each point represents the means ± S.D. of 10 tumors. (B) Relative Tumor weights at autopsy. After 2 weeks of treatment, tumors were removed and weighed. The weight of parental HL-60 tumors treated with vehicle only is set as 100%. Results represent means ± S.D. of tumor weights. Asterisks are given for significances of shBAG3 versus control shRNA in Bortezomib-treated groups. *P < 0.05, **P < 0.01.
apoptosis assay and in vivo animal model indicate that knocking down BAG3 gene is a promising new approach to enhance the therapeutic potency of Bortezomib in patients with leukemia. Acknowledgements This work was supported in part by National Natural Science Foundation of China (30500603), ‘‘863” Project (2003AA205060) from the Ministry of Science and Technology of China, and Chuangxin Foundation of Nanjing Medical University (CX2003004). References [1] Ciechanover, A. (1994) The ubiquitin–proteasome proteolytic pathway. Cell 79, 13–21. [2] Adams, J. (2001) Proteasome inhibition in cancer: development of PS-341. Semin. Oncol. 28, 613–619. [3] Adams, J. (2002) Development of the proteasome inhibitor PS-341. Oncologist 7, 9–16. [4] Adams, J. (2004) The development of proteasome inhibitors as anticancer drugs. Cancer Cell 5, 417–421. [5] Rajkumar, S.V., Richardson, P.G., Hideshima, T. and Anderson, K.C. (2005) Proteasome inhibition as a novel therapeutic target in human cancer. J Clin Oncol 23, 630–639. [6] Orlowski, R.Z. and Kuhn, D.J. (2008) Proteasome inhibitors in cancer therapy: lessons from the first decade. Clin. Cancer Res. 14, 1649–1657. [7] Orlowski, R.Z., Voorhees, P.M., Garcia, R.A., Hall, M.D., Kudrik, F.J., Allred, T., Johri, A.R., Jones, P.E., Ivanova, A., Van Deventer, H.W., Gabriel, D.A., Shea, T.C., Mitchell, B.S., Adams, J., Esseltine, D.L., Trehu, E.G., Green, M., Lehman, M.J., Natoli, S., Collins, J.M., Lindley, C.M. and Dees, E.C. (2005) Phase 1 trial of the proteasome inhibitor bortezomib and pegylated liposomal doxorubicin in patients with advanced hematologic malignancies. Blood 105, 3058–3065. [8] Cortes, J., Thomas, D., Koller, C., Giles, F., Estey, E., Faderl, S., Garcia-Manero, G., McConkey, D., Ruiz, S.L., Guerciolini, R., Wright, J. and Kantarjian, H. (2004) Phase I study of bortezomib in refractory or relapsed acute leukemias. Clin. Cancer Res. 10, 3371–3376. [9] Doong, H., Vrailas, A. and Kohn, E.C. (2002) What’s in the ‘BAG’?–A functional domain analysis of the BAG-family proteins. Cancer Lett. 188, 25–32. [10] Doong, H., Price, J., Kim, Y.S., Gasbarre, C., Probst, J., Liotta, L.A., Blanchette, J., Rizzo, K. and Kohn, E. (2000) CAIR-1/BAG-3 forms an EGF-regulated ternary complex with phospholipase C-gamma and Hsp70/Hsc70. Oncogene 19, 4385–4395. [11] Lee, J.H., Takahashi, T., Yasuhara, N., Inazawa, J., Kamada, S. and Tsujimoto, Y. (1999) Bis, a Bcl-2-binding protein that synergizes with Bcl-2 in preventing cell death. Oncogene 18, 6183–6190. [12] Antoku, K., Maser, R.S., Scully Jr., W.J., Delach, S.M. and Johnson, D.E. (2001) Isolation of Bcl-2 binding proteins that exhibit homology with BAG-1 and suppressor of death domains protein. Biochem. Biophys. Res. Commun. 286, 1003–1010.
[13] Takayama, S. and Reed, J.C. (2001) Molecular chaperone targeting and regulation by BAG family proteins. Nat. Cell Biol. 3, E237–241. [14] Takayama, S., Xie, Z. and Reed, J.C. (1999) An evolutionarily conserved family of Hsp70/Hsc70 molecular chaperone regulators. J. Biol. Chem. 274, 781–786. [15] Romano, M.F., Festa, M., Pagliuca, G., Lerose, R., Bisogni, R., Chiurazzi, F., Storti, G., Volpe, S., Venuta, S., Turco, M.C. and Leone, A. (2003) BAG3 protein controls B-chronic lymphocytic leukaemia cell apoptosis. Cell Death Differ. 10, 383– 385. [16] Romano, M.F., Festa, M., Petrella, A., Rosati, A., Pascale, M., Bisogni, R., Poggi, V., Kohn, E.C., Venuta, S., Turco, M.C. and Leone, A. (2003) BAG3 protein regulates cell survival in childhood acute lymphoblastic leukemia cells. Cancer Biol. Ther. 2, 508–510. [17] Bonelli, P., Petrella, A., Rosati, A., Romano, M.F., Lerose, R., Pagliuca, M.G., Amelio, T., Festa, M., Martire, G., Venuta, S., Turco, M.C. and Leone, A. (2004) BAG3 protein regulates stress-induced apoptosis in normal and neoplastic leukocytes. Leukemia 18, 358–360. [18] Belmokhtar, C.A., Hillion, J. and Ségal-Bendirdjian, E. (2001) Staurosporine induces apoptosis through both caspase-dependent and caspase-independent mechanisms. Oncogene 20, 3354–3362. [19] Colado, E., Alvarez-Fernández, S., Maiso, P., Martín-Sánchez, J., Vidriales, M.B., Garayoa, M., Ocio, E.M., Montero, J.C., Pandiella, A. and San Miguel, J.F. (2008) The effect of the proteasome inhibitor bortezomib on acute myeloid leukemia cells and drug resistance associated with the CD34+ immature phenotype. Haematologica 93, 57–66. [20] Shen, L., Au, W.Y., Guo, T., Wong, K.Y., Wong, M.L., Tsuchiyama, J., Yuen, P.W., Kwong, Y.L., Liang, R.H. and Srivastava, G. (2007) Proteasome inhibitor bortezomib-induced apoptosis in natural killer (NK)-cell leukemia and lymphoma: an in vitro and in vivo preclinical evaluation. Blood 110, 469–470. [21] Satou, Y., Nosaka, K., Koya, Y., Yasunaga, J.I., Toyokuni, S. and Matsuoka, M. (2004) Proteasome inhibitor, bortezomib, potently inhibits the growth of adult T-cell leukemia cells both in vivo and in vitro. Leukemia 18, 1357–1363. [22] LeBlanc, R., Catley, L.P., Hideshima, T., Lentzsch, S., Mitsiades, C.S., Mitsiades, N., Neuberg, D., Goloubeva, O., Pien, C.S., Adams, J., Gupta, D., Richardson, P.G., Munshi, N.C. and Anderson, K.C. (2002) Proteasome inhibitor PS-341 inhibits human myeloma cell growth in vivo and prolongs survival in a murine model. Cancer Res. 62, 4996–5000. [23] Adams, J., Palombella, V.J., Sausville, E.A., Johnson, J., Destree, A., Lazarus, D.D., Maas, J., Pien, C.S., Prakash, S. and Elliott, P.J. (1999) Proteasome inhibitors: a novel class of potent and effective antitumor agents. Cancer Res. 59, 2615– 2622. [24] Koepp, D.M., Harper, J.W. and Elledge, S.J. (1999) How the cyclin became a cyclin: regulated proteolysis in the cell cycle. Cell 97, 431–434. [25] Karin, M., Yamamoto, Y. and Wang, Q.M. (2004) The IKK NF-kappa B system: a treasure trove for drug development. Nat. Rev. Drug Discov. 3, 17–26. [26] Ciechanover, A. (1998) The ubiquitin–proteasome pathway: on protein death and cell life. EMBO J. 17, 7151–7160. [27] Pagano, M., Tam, S.W., Theodoras, A.M., Beer-Romero, P., Del Sal, G., Chau, V., Yew, P.R., Draetta, G.F. and Rolfe, M. (1995) Role of the ubiquitin–proteasome pathway in regulating abundance of the cyclin-dependent kinase inhibitor p27. Science 269, 682–685. [28] Sulahian, R., Sikder, D., Johnston, S.A. and Kodadek, T. (2006) The proteasomal ATPase complex is required for stress-induced transcription in yeast. Nucleic Acids Res. 34, 1351–1357.
406
P. Liu et al. / FEBS Letters 583 (2009) 401–406
[29] Adams, J. (2004) The proteasome: a suitable antineoplastic target. Nat. Rev. Cancer 4, 349–360. [30] Takayama, S., Bimston, D.N., Matsuzawa, S., Freeman, B.C., Aime-Sempe, C., Xie, Z., Morimoto, R.I. and Reed, J.C. (1997) BAG-1 modulates the chaperone activity of Hsp70/Hsc70. EMBO J. 16, 4887–4896. [31] Rosati, A., Ammirante, M., Gentilella, A., Basile, A., Festa, M., Pascale, M., Marzullo, L., Belisario, M.A., Tosco, A., Franceschelli, S., Moltedo, O., Pagliuca, G., Lerose, R. and Turco, M.C. (2007) Apoptosis inhibition in cancer cells: a novel molecular pathway that involves BAG3 protein. Int. J. Biochem. Cell Biol. 39, 1337–1342. [32] Homma, S., Iwasaki, M., Shelton, G.D., Engvall, E., Reed, J.C. and Takayama, S. (2006) BAG3 deficiency results in fulminant myopathy and early lethality. Am. J. Pathol. 169, 761–773.
[33] Chiappetta, G., Ammirante, M., Basile, A., Rosati, A., Festa, M., Monaco, M., Vuttariello, E., Pasquinelli, R., Arra, C., Zerilli, M., Todaro, M., Stassi, G., Pezzullo, L., Gentilella, A., Tosco, A., Pascale, M., Marzullo, L., Belisario, M.A., Turco, M.C. and Leone, A. (2007) The antiapoptotic protein BAG3 is expressed in thyroid carcinomas and modulates apoptosis mediated by tumor necrosis factorrelated apoptosis-inducing ligand. J. Clin. Endocrinol. Metab. 92, 1159–1163. [34] Wang, H.Q., Liu, H.M., Zhang, H.Y., Guan, Y. and Du, Z.X. (2008) Transcriptional upregulation of BAG3 upon proteasome inhibition. Biochem. Biophys. Res. Commun. 365, 381–385. [35] Sarközi, R., Perco, P., Hochegger, K., Enrich, J., Wiesinger, M., Pirklbauer, M., Eder, S., Rudnicki, M., Rosenkranz, A.R., Mayer, B., Mayer, G. and Schramek, H. (2008) Bortezomib-induced survival signals and genes in human proximal tubular cells. J. Pharmacol. Exp. Ther. 327, 645–656.