Baicalein, a natural product, selectively activating AMPKα2 and ameliorates metabolic disorder in diet-induced mice

Molecular and Cellular Endocrinology 362 (2012) 128–138

Contents lists available at SciVerse ScienceDirect

Molecular and Cellular Endocrinology journal homepage: www.elsevier.com/locate/mce

Baicalein, a natural product, selectively activating AMPKa2 and ameliorates metabolic disorder in diet-induced mice Peng Pu a,b,1, Xin-An Wang a,b,1, Mohamed Salim a, Li-Hua Zhu a,b, Lang Wang a,b, kvo-Jv Chen b, Jin-Feng Xiao a,b, Wei Deng a,b, Hong-Wei Shi a, Hong Jiang a,b,⇑, Hong-Liang Li b a b

Department of Cardiology, Renmin Hospital of Wuhan University, Wuhan 430060, PR China Cardiovascular Research Institute of Wuhan University, Wuhan 430060, PR China

a r t i c l e

i n f o

Article history: Available online 12 June 2012 Keywords: Baicalein Metabolic syndrome AMPK Insulin resistance Inflammation

a b s t r a c t The aim of the present study was to determine the effect of baicalein on metabolic syndrome induced by a high-fat diet in mice. The mice developed obesity, dyslipidemia, fatty liver, diabetes and insulin resistance. These disorders were effectively normalized in baicalein-treated mice. Further investigation revealed that the inhibitory effect on inflammation and insulin resistance was mediated by inhibition of the MAPKs pathway and activation of the IRS1/PI3K/Akt pathway. The lipid-lowering effect was attributed to the blocking of synthesis way mediated by SERBP-1c, PPARc and the increased fatty acid oxidation. All of these effects depended on AMPKa activation. These results were confirmed in the primary hepatocytes from wild type and AMPKa2/ mice. However, the IRS-1/PI3K/AKT pathway showed no change, which may be due to the time of stimulation and concentration. Thus, these data suggested that baicalein protects mice from metabolic syndrome through an AMPKa2-dependent mechanism involving multiple intracellular signaling pathways. Ó 2012 Elsevier Ireland Ltd. All rights reserved.

1. Introduction Metabolic syndrome (MS) is the name given to a cluster of clinical features that often coexist and lead to a marked increase in cardiovascular risk (Unger, 2002). These features include overweight or obesity, hypertension, hyperlipemia, diabetes or impaired glucose tolerance, insulin resistance (Dandona et al., 2005). Impressive evidence has accumulated over the past decade has suggested that MS is regulated by inflammatory mechanisms Abbreviations: MS, metablic syndrome; HF, high-fat diet; B, baicalein; IPGTT, intraperitoneal glucose tolerance test; IPITT, intraperitoneal insulin tolerance test; AMPK, AMP-activated protein kinase; ACC, acetyl coenzyme A carboxylase; PPAR, peroxisome proliferator-activated receptor; SREBP-1c, sterol regulatory elementbinding factor 1; AP2, adipose fatty acid-binding protein 2; FAS, fatty acid synthase; CD36, fatty acid transporter; CPT1, carnitine palmitoyltransferase-1; ACOX, acyl coenzyme A oxidase; UCP2, uncoupling Proteins 2; SCD1, stearoyl-CoA desaturase1; mtGPAT, mitochondrial isoform of glycerol-3-phosphate acyltransferase; IRS1, insulin receptor substrate-1; PI3K, phosphatidylinositol 3-kinase; AKT, Serine/ threonine Kinase; MAPK, mitogen-activated protein kinase; AST, aspartate aminotransferase; ALT, alanine aminotransferase; GAPDH, glyceraldehydes 3-phosphate dehydrogenase; TNFa, tumor necrosis factor-alpha; MCP1, monocyte chemoattractant protein 1; NF-jB, nuclear factor-kappa B. ⇑ Corresponding author. Address: Department of Cardiology, Renmin Hospital of Wuhan University, Jiefang Road 238, Wuhan 430060, PR China. Tel./fax: +86 27 88083385. E-mail address: [email protected] (H. Jiang). 1 Authors equally contributed to this work. 0303-7207/$ - see front matter Ó 2012 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.mce.2012.06.002

(Sutherland et al., 2004). Insulin resistance, the core of MS, has also been increasingly recognized as having an important role in inflammatory pathways (Yip et al., 1998). Currently, studies has suggested that MS is closely related to the activity of adenosine 50 monophosphate-activated protein kinase (AMPK), which has a central role in regulating energy metabolism and inflammation (Ruderman and Prentki, 2004). Impairment of AMPK function is associated with T2DM, insulin resistance, obesity, hormonal disorders and cardiovascular disease (Viollet et al., 2003). Recently, natural products, such as flavonoids, have been reported to inhibit obesity, inflammation and insulin resistance, and their effects on lipogenesis may be mediated via AMPK activation (Prasain et al., 2010; Huang et al., 2005; Hwang et al., 2009). Baicalein (5,6,7-trihydroxyflavone) is a polyphenolic compound and a major bioactive flavonoid isolated from the root of Scutellaria baicalensis Georgi which is widely used in traditional Chinese medicine (Kim et al., 2001). Mounting reports have shown that it has various biological activities including antiviral, antioxidant, anti-inflammatory, neuroprotective and anticancer activities (Shen et al., 2003; Bochorakova et al., 2003; Cui et al., 2010; Ikemoto et al., 2000). A previous report has already speculated that baicalein could activated AMPK in human tumor cells (Ding et al., 2011). In the present study, we demonstrated that baicalein was able to activated AMPK in vivo and in vitro and it might be an ideal candidate to treat metabolic syndrome.

P. Pu et al. / Molecular and Cellular Endocrinology 362 (2012) 128–138

2. Materials and methods 2.1. Materials Baicalein, supplemented in diet, was purchased from Windherb Medicine Technology Co., Ltd (Shanghai, China). Commercial kits for the measurement of triglyceride (TG), total cholesterol (TC), high density lipoprotein (HDL) and low density lipoprotein (LDL) were obtained from Princeton Biotechnology Co., Ltd (Shanghai, China). Commercial kits to measure AST and ALT were purchased from Leadman Group Co., Ltd (China). Insulin was purchased from Novo Nordisk Pharmaceutical Co., Ltd (China). Glucose was bought from Wuhan Fu xing Biological Pharmaceutical Co., Ltd. ELISA kits were acquired from R&D Systems. Fetal calf serum (FCS) was obtained from Invitrogen. The antibodies used to recognize MAPKs and insulin signaling pathways were bought from Cell Signaling Technology or Bioworld. Tissue cultrue grade baicalein was obtained from Chendu Mansite Pharmacetical Co., Ltd. Cell culture reagents and all other reagents were purchased from Sigma or China National Medicines Co., Ltd. All other chemicals and reagents were of analytical grade. 2.2. Animal experiment 2.2.1. Animal model and diet 2.2.1.1. Animal experiment 1. Experiments were approved by the Animal Care Use Committee of the Renmin hospital of Wu Han University. C57BL/6J male mice were purchased from the Institute of Laboratory Animal Sciences (Cams&Pumc) at the age of 7 weeks and were acclimatized for one week prior to experimental use (permission number: 00012217). The mice were housed at 23 ± 2 °C and a humidity level of 40–60% in a temperature-controlled room with a 12-h light/dark cycle (07:00–19:00 light/ 19:00–07:00 dark). Mice were randomly divided into four groups as follows: normal control mice (Control; n = 20), normal control mice treated with 0.5% baicalein (400 mg/kg/day) (Control + B; n = 20), mice fed a high-fat diet (HF; n = 20) and mice fed a highfat diet and treated with 0.5% baicalein (400 mg/kg/day) (HF + B; n = 20). The Control and HF groups were fed with an AIN-76A diet (containing 12.4% fat, 68.8% carbohydrate, and 18.8% protein) and a high-fat diet (containing 37.1% fat, 42.4% carbohydrate, and 20.5% protein), respectively. The treated groups were fed with the corresponding diets supplemented with 0.5% baicalein (>98% pure). This dose is relevant to the daily intake of flavonoids in human diets-about 2–4 pouch of Scutellaria baicalensis tea a day. The mice were fed and watered ad libitum for 29 weeks. The food consumption were measured once a week and weight gain was measured twice a week. 2.2.1.2. Animal experiment 2. To clarify whether baicalein is able to reverse the existing obesity, we did a simple test. 15 male C57BL/6 mice were enrolled in this study. They were randomly divided into two groups according to the diet: one was fed with the normal diet (ND; n = 5); the other one was fed with the high-fat diet (n = 10). All the mice were fed the corresponding diets like animal experiment 1. When the weight difference appears, the high fat-fed animals were divided into two groups in the accordance with the treatment: one was still fed with a high-fat diet (HFD, n = 5); the other group was fed with the high-fat diet supplemented with 0.5% baicalein (400 mg/kg/day) (HFD + B, n = 5). The food consumption and weight gain were measured once a week. When the weight difference appeared between HFD group and HFD + B group, we stopped the test. All the mice were sacrificed and the samples were not used for the further test.

129

2.2.2. Sample collection and preparation Blood was collected every five weeks by etro-orbital sinus puncture, stored at 20 °C and used to monitor insulin levels. At the end of the study, animals were fasted overnight and sacrificed under anesthesia. Before being sacrificed, the animals’ body weight and length were measured. Lee’s index was calculated according to the following formula: Lee’s index = body weight (g)1/3  1000/length(cm). Blood samples were collected and centrifuged at 4000g for 30 min at 4 °C to isolate the serum. The livers were removed for weight and liver index calculations using the following formula: Index (%) = liver weight (g)/body weight (g)  100]. A part of each liver was used for histological analysis, and the remaining liver was used for frozen sections and molecular detection. Visceral fat pads, including the perirenal, retroperitoneal and epididymal fat pads, were also removed and weighed for index calculation. 2.2.3. Biochemical analysis Blood was collected from the vena orbitalis posterior into EP tubes (1.5 ml) and centrifuged at 1500g for 30 min at 4 °C. Blood glucose was measured in whole blood using a glucose meter. Insulin was analyzed using the ELISA method. The levels of the inflammatory cytokines, TNF-a and MCP-1, were determined using commercially available ELISA kits according to the manufacturer’s protocol. Serum levels of TG, TC, LDL-c, HDL-c, ALT and AST were assayed according to the protocols of the commercial clinical diagnosis kits in the Olympus AU 600 autoanalyzer. 2.2.4. Blood pressure measurement Before being sacrificed, we measured the animal blood pressure using animal noninvasive blood pressure measurement system (Kent, USA). The values of systolic and diastolic blood pressure were recorded. The average of two measurements at each time was used. 2.2.5. Evaluation of insulin resistance Insulin sensitivity was assessed based on fasting glucose, insulin levels, HOMA-IR, the intraperitoneal glucose tolerance test (IPGTT) and intraperitoneal insulin tolerance test (IPITT). The homeostasis model of insulin resistance (HOMA-IR) score was caculated using the following formula: HOMA-IR = serum glucose level [mmol/L]  insulin level [mIU/L]/22.5 (Konrad et al., 2007; Yin et al., 2008). A high HOMA-IR score indicates a high level of insulin resistance. For the IPGTT and IPITT, the mice were fasted for 6 h and subsequently injected i.p. with glucose (2 g/kg) or recombinant human regular insulin (0.75 U/kg). Blood samples were collected from the tails at 0, 15, 30, 60, and 120 min after glucose or insulin loading to evaluate glucose levels. The areas under the curve (AUC, millimolar per minute) was calculated according to the formula (Matthews et al., 1985):

AUC0120min ¼ ðG0 þ G15 Þ  15=2 þ ðG15 þ G30 Þ  15=2 þ ðG30 þ G60 Þ  30=2 þ ðG60 þ G120 Þ  60=2

2.2.6. Histological analysis Livers and adipose tissue were excised, washed with saline solution and placed in 10% formalin. Several sections of tissue (thickness of 4–5 lm) were prepared and stained with hematoxylin and eosin (H&E) for histopathology and visualized by light microscopy. Frozen liver sections were stained with Oil-Red-O. Histological variables were blindly semi-quantitated from 0 to 4 with respect to: steatosis, ballooning and inflammation according to the literature (Ishak et al., 1995).

130

P. Pu et al. / Molecular and Cellular Endocrinology 362 (2012) 128–138

2.3. Cell culture and treatment

2.4. Real-time PCR and Western blotting

A primary culture of hepatocytes was prepared as previously described(Marc et al., 2000). The cells from the liver of 8 weeks old wild type mice and AMPKa2/ mice were seeded at a density of 8  105 cells/well into 60-mm culture plates containing DMEM/ F12 medium supplemented with 15% FCS and penicillin/streptomycin. After 48 h, the culture medium was replaced every two days. After 12 h of serum starvation, primary hepatocytes were pretreated with 90 ug/ml of baicalein (dissolved in DMSO) for 60 min and subsequently incubated with normal glucose (5uM) or high glucose (25 uM) for up to 2 h. Cell viability was determined using the methylthiazolyldiphenyl- tetrazolium bromide (MTT) assay.

For western blot analysis, liver tissue and primary hepatocytes were lysed in radioimmunoprecipitation (RIPA) lysis buffer. Supernatants were collected, and the protein concentration was determined using a BCA assay kit. In total, 50 lg of liver tissue lysate or 20 lg of cell lysate was used for sodium dodecyl sulfate–polyacrylamide gel electrophoresis, and proteins were then transferred to an FL membrane (Millipore). The specific protein expression levels were normalized to GAPDH. For Real-Time PCR, total RNA was extracted from frozen, pulverized mouse livers and cultured hepatocytes using TRIzol (Invitrogen) and transcribed by two-step method with Super Script First-Strand Synthesis System. The sequences of the primers are shown in Table 1. The PCR products were quantified using the SYBR Green PCR Master Mix (Applied Biosystems), and the results normalized to GAPDH gene expression.

Table 1 Nucleotide sequences of primers used for PCR amplification. Gene

Sense

Sequence (50 –30 )

SREBP-1c

SREBP-1C-FWD SREBP-1C-REV FAS-FWD FAS-REV AP2-FWD AP2-REV CPT-1a-FWD CPT-1a-REV ACOX-FWD ACOX-REV UCP2-FWD UCP2-REV SCD-1-FWD SCD-1-REV PPAR-a–FWD PPAR-a–REV PPAR-c-FWD PPAR-c-REV ACCa-FWD ACCa-REV CD36-FWD CD36-REV mGPAT -FWD mGPAT -REV Nrf2-FWD Nrf2-REV

CACTTCTGGAGACATCGCAAAC ATGGTAGACAACAGCCGCATC CTGCGGAAACTTCAGGAAATG GGTTCGGAATGCTATCCAGG TGGAAGACAGCTCCTCCTCG CCGCCATCTAGGGTTATGATG AGGACCCTGAGGCATCTATT ATGACCTCCTGGCATTCTCC CGGAAGATACATAAAGGAGACC AAGTAGGACACCATACCACCC GCTGGTGGTGGTCGGAGATA ACTGGCCCAAGGCAGAGTT TCTTCCTTATCATTGCCAACACCA GCGTTGAGCACCAGAGTGTATCG CAAGGCCTCAGGGTACCACT TTGCAGCTCCGATCACACTT ATTCTGGCCCACCAACTTCGG TGGAAGCCTGATGCTTTATCCCCA GGCCAGTGCTATGCTGAGAT AGGGTCAAGTGCTGCTCCA TGGGTTTTGCACATCAAAGA GATGGACCTGCAAATGTCAGA CCATTGTGGAGGATGAAGTG TGGATGGTGCCAGATAGGGA GGACATGGAGCAAGTTTGGC GCTGGGAACAGCGGTAGTATC

FAS AP2 CPT-1a ACOX UCP2 SCD-1 PPARa PPARc ACCa CD36 mtGPAT Nrf2

2.5. Statistical analysis The data were expressed as the Mean ± SEM. The significant differences between groups were statistically ananlyzed by one-way analysis of variance (ANOVA). Newman–Keuls compareisons were used to determine the source of significant differences. P-values less than 0.05 were considered significant. 3. Results 3.1. Metabolic syndrome was induced by a high-fat diet in C57 mice During the 29 weeks feeding period, a high-fat diet resulted in central obesity (Fig. 1, Table 2), hyperglycemia (Table 3), dyslipidemia (Table 4), insulin resistance (Table 3, Fig. 2), inflammatory state (Fig. 3) and hepatic steatosis (Fig. 4). However, the hypertension was not induced by high-fat diet (Table 2). Hypertension is indeed a key component of the metabolic syndrome, but not a prerequisite. For animals, the model criteria also refers to the criteria of humans, like central obesity, high blood sugar, hypertension, hypertriglyceridemia, reduced HDL (any 3 of 5 constitute diagnosis of metabolic syndrome) (Grundy et al., 2005; Cong et al., 2008). Hence, our study suggested a successful animal model was established.

Fig. 1. Baicalein prevents and reverses obesity. (A) For animal experiment 1, after 4 weeks high-fat diet, the body weight had a statistics difference (HF vs Con, P < 0.001). At the end of the study, body weight of the high fat-fed animals had a obvious change (P < 0.001, vs Con). However, the effect was attenuated by baicalein treatment. (P < 0.001, vs HF). (B) For animal experiment 2, after 3 weeks high-fat diet, the body weight had a obvious statistics difference (HFD vs ND, P < 0.01). Then treating with baicalein for 3 weeks, the obesity was reversed (P < 0.001, vs HFD)Values are expressed as Mean ± SEM. ⁄P < 0.05, ⁄⁄⁄P < 0.001 vs Control, #P < 0.05, ###P < 0.001 vs HF; ⁄P < 0.05, ⁄⁄P < 0.01, vs ND, ##P < 0.01 vs HFD.

131

P. Pu et al. / Molecular and Cellular Endocrinology 362 (2012) 128–138 Table 2 Baicalein lowered abdominal obesity and organ weights without affecting food intake and blood pressure.

Number Food intake(g/day) Energy intake/body weight (kJ/g/day) Body length (cm) Abdomen circumference (cm) Lee’s index Liver weight (g) White adipose tissue (g) Liver index (%) Adiposity index (%) Systolic blood pressure Diastolic blood pressure

Control

Control + B

HF

HF + B

20

20

20

20

3.1 ± 0.1 1.997 ± 0.065 9.86 ± 0.099 7.41 ± 0.060 313.06 ± 3.137 1.08 ± 0.035 1.17 ± 0.083 3.81 ± 0.117 4.11 ± 0.258 126 ± 6.54 71.8 ± 5.42

3.2 ± 0.093 2.062 ± 0.06 9.91 ± 0.106 7.48 ± 0.080 316.74 ± 3.785 1.32 ± 0.054 1.25 ± 0.106 4.19 ± 0.136 3.95 ± 0.259 119 ± 7.83 67.2 ± 6.31

3.6 ± 0.121 2.256 ± 0.078⁄ 10.13 ± 0.124 9.17 ± 0.094⁄⁄⁄ 343.33 ± 2.569⁄⁄⁄ 1.80 ± 0.060⁄⁄⁄ 3.65 ± 0.144⁄⁄⁄ 4.450 ± 0.207⁄ 8.73 ± 0.275⁄⁄⁄ 143 ± 10.21 76.5 ± 8.59

3.3 ± 0.1 2.246 ± 0.064 10.11 ± 0.111 8.26 ± 0.136### 323.3 ± 2.522 ## 1.31 ± 0.111## 2.130 ± 0.182### 3.88 ± 0.145# 6.26 ± 0.474### 134 ± 9.33 72.3 ± 7.44

High-fat diet did not affect the food intake and blood pressure. Baicalein lowered body weight gain, Lee’s index, abdomen circumference, organ weights and adiposity index, but not the food intake, energy intake, liver index and blood pressure. Lee’s index = body weight (g)1/3  103/Body length (cm). Visceral fat includes epididymal fat pad, mesentery fat tissue and abdominal adipose tissue. Visceral fat index = white adipose tissue weight(g) / body weight(g)  100. So is Liver index. All values are the mean ± SEM. ⁄P < 0.05, ⁄⁄⁄P < 0.001 vs Control, #P < 0.05, ##P < 0.01, ###P < 0.001 vs HF.

Table 3 Baicalein improved high-fat diet-induced insulin resistance.

Number Blood glucose (mmol L1) Serum insulin (lg L1) HOMA-IR (mmol L1 mIU L1)

Control

Control + B

HF

HF + B

10 6.64 ± 0.371 11.61 ± 0.627 3.27 ± 0.323

10 7.80 ± 0.272 15.16 ± 1.183 5.14 ± 0.548

10 9.90 ± 0.236⁄⁄⁄ 67.28 ± 12.863⁄ 26.99 ± 5.242⁄⁄

10 8.78 ± 0.549# 15.98 ± 0.475# 7.53 ± 0.436#

Blood glucose levels and serum insulin levels were measured in the fasting state of the mice. Insulin resistance was induced in model animals. Baicalein reversed these changes. And it did not lower serum glucose in normal state. All values are the mean ± SEM. ⁄P < 0.05, ⁄⁄P < 0.01, ⁄⁄⁄P < 0.001 vs Control,#P < 0.05 vs HF.

Table 4 Baicalein attenuated high-fat diet-induced lipid metabolic disorder and hepatic dysfunction.

Number Serum TC (mM) Serum TG (mM) Serum HDL (mM) Serum LDL (mM) ALT (U L1) AST (U L1)

Control

Control + B

HF

HF + B

10 1.65 ± 0.153 0.59 ± 0.069 1.14 ± 0.107 0.32 ± 0.039 34.86 ± 6.486 37.43 ± 8.178

10 2.17 ± 0.169 0.52 ± 0.042 1.59 ± 0.121 0.36 ± 0.028 39.66 ± 3.632 43.47 ± 16.324

10

10 3.25 ± 0.239### 0.66 ± 0.071 2.31 ± 0.199## 0.60 ± 0.033### 53.56 ± 7.295## 73.02 ± 6.643#

4.44 ± 0.111⁄⁄⁄ 0.691 ± 0.047 3.09 ± 0.081⁄⁄⁄ 0.90 ± 0.033⁄⁄⁄ 81.37 ± 8.457⁄⁄⁄ 117.33 ± 17.328⁄⁄⁄

Baicalein treatment significantly decreased the levels of lipid (TC, HDL and LDL) with the exception the triglycerides. And the serum hepatic functional markers (ALT and AST) were also reversed by baicalein treatment. It suggested that baicalein is safe and no liver toxicity. All values are the mean ± SEM. ⁄⁄⁄P < 0.001 vs Control, #P < 0.05, ##P < 0.01, ### P < 0.001 vs HF.

3.2. Baicalein alleviated the metabolic syndrome in vivo 3.2.1. Baicalein lowered abdominal obesity without affecting food intake and blood pressure For animal experiment 1, at the age of 8 weeks, no significant difference in weight existed among all groups. After 2 weeks, the weight of the mice fed a high-fat diet progressively incrased compared with the mice fed a standard diet (P < 0.05). However, the effect was attenuated by baicalein treatment. At the end of the study, the average body weight of the HF group and the HF + B group reached 43.01 ± 0.878 and 39.0 ± 1.20, respectively (P < 0.001). However, the average body weight of the Control + B group was similar to the average body weight of the Control group (Fig. 1). These results suggested that baicalein has a weight-lowering effect in obese mice. In addition, baicalein significantly lowered several indices, such as Lee’s index, liver weight, liver index, visceral fat weight and visceral fat index relative to the untreated mice (Table 2). There was, however, no significant difference in food intake and blood pressure among all mice (Table 2).

For animal experiment 2, after 2 weeks high fat diet-fed, the mice got a obvious weight gain compared to the normal diet-fed mice(28.88 ± 0.252 vs 27.831 ± 0.328, P < 0.05). After 3 weeks treatment, baicalein didn’t reverse the obseity; it prevented the development of further obesity (Fig. 1B). 3.2.2. Baicalein improved high-fat diet-induced insulin resistance To demonstrate the insulin resistance, we performed several tests, including fasting glucose, insulin levels, HOMA-IR index, IPGTT and IPITT. In the HF group, the HOMA-IR index, the most important index, was 7.3 times higher than that of the Control group (Table 3). But the insulin sensitivity increased this index by 668.2% in the HF + B group. The levels of fasting glucose and insulin exhibited similar changes as the HOMA-IR index. Excitingly, we did not find any evidence of hypoglycemia in Control + B mice, suggesting baicalein has glucose-lowering effects in hyperglycemia state. We used IPGTT and IPITT to confirm the above-mentioned results (Fig. 2). The high fat-fed mice showed obvious hyperglycemia at all test points after glucose loading and the AUC02h of the

132

P. Pu et al. / Molecular and Cellular Endocrinology 362 (2012) 128–138

Fig. 2. Effects of baicalein on glucose tolerance and insulin tolerance in mice Insulin resistance induced by high-fat diet in C57BL/6 mice. Time-course changes in plasma glucose (A1), serum insulin (B1) levels after orally administration of a glucose loading (2 g/kg, n = 12) or insulin loading (0.75 U/kg, n = 12). The corresponsive AUC over 2 h was shown (A2 and B2). Values are expressed as Mean ± SEM. ⁄⁄P < 0.01, ⁄⁄⁄P < 0.001 vs Control, ##P < 0.01, ###P < 0.001 vs HF.

Fig. 3. Baicalein inhibited inflammation in murine models of metabolic syndrome. Baicalein administration conferred benefits to several cytokines. Serum TNF-a (n = 12) and MCP-1 (n = 12) levels were significantly increase in the HF group compare to the levels in the Control group. Baicalein treatment induced a strong anti-inflammatory effect. Values are expressed as Mean ± SEM. ⁄⁄P < 0.01 vs Control, #P < 0.05 vs HF.

glucose response during the IPGTT was significantly increased compared to that of the normal Control (AUC02h of Control and HF = 1102.7 ± 50.191 and 2326.7 ± 143.34, P < 0.001). However, baicalein effectively improved glucose intolerance. The levels of glucose peak (15 min) dropped by 19.7% and AUC was reduced by 52.6% (Fig. 2A1 and A2). For IPITT, the HF group displayed a weak response to exogenous insulin. After insulin loading for 30 min, the blood glucose levels decreased to lowest by 56.3% and 10.5% in the Control and HF groups, respectively, compared to their respective baseline levels (Fig. 2B1). These results demonstrated that insulin resistance is alleviated after baicalein treatment.

3.2.3. Baicalein inhibited inflammation in metabolic syndrome To determine whether baicalein suppressed the inflammatory responses, we examined the expression of inflammatory mediators (TNF-a and MCP-1) in serum. As shown in Fig. 3, serum TNF-a and MCP-1 levels were significantly increase in the HF group compare to the levels in the Control group (7.4 ± 1.104 and 2.22 ± 0.084, respectively, for TNF-a levels, Fig. 3A; 3.68 ± 0.817 and 11.41 ± 1.409, respectively, for MCP-1 levels, Fig. 3B, P < 0.01). Baicalein treatment induced a strong anti-inflammatory effect with decreased in the TNF-a and MCP-1 levels by 50.9% and 51.6%, respectively.

P. Pu et al. / Molecular and Cellular Endocrinology 362 (2012) 128–138

133

Fig. 4. High-fat diet-induced hepatic inflammation, lipid ectopic deposition and hypertrophic adipocyte were antagonised by baicalein treatment. The panels showes liver sections stained with HE, Oil-Red O and white fatty tissue sections stained with HE. (A–H) Lipid accumulation in the liver of high-fat-fed mouse was very evident due to the presence of circular lipid droplets in the H&E and Oil-Red O stained sections, but a reduced in sections from baicalein-fed animals. Black arrows indicate hepatocyte ballooning; red arrows point to inflammatory cell, like monocytes, lymphocyte. (I–L) Representative haematoxylin–eosin staining of adipose sections is given. The hypertrophic adipocytes in the HF group were attenuated by baicalein treatment. (M) The scores for steatosis, hepetocyte ballooning and inflammation were determined by a certified pathologist (n = 6). Values are expressed as Mean ± SEM. ⁄⁄⁄P < 0.01 vs Control, #P < 0.05, ##P < 0.01 vs HF.

3.2.4. Baicalein ameliorated high-fat diet-induced lipid metabolic disorder and hepatic dysfunction Chronic high-fat diet exposure may cause lipid metabolic disorder, including hyperlipidemia and lipid deposition. In our study, hyperlipemia formed after induced by the high-fat diet and baicalein treatment significantly decreased the levels of lipids with the exception the triglycerides. The levels of serum cholesterol was increased significantly by 169.1% in the HF group and decreased to 73.2% in the baicalein-treated group. The levels of serum LDL and HDL exhibited trends that were similar to those of serum cholesterol in both groups. We also investigated the hepatic accumulation of lipids and hypertrophic adipocytes by pathological analysis of sections stained with HE (Fig. 4). Liver sections from the HF group exhibited characteristics consistent with fatty liver, such as steatosis, inflammation, ballooning degeneration, and necrosis. Administration of baicalein significantly decreased lipid accumulation in the livers (Fig. 4A–D). In addition, baicalein treatment normalized hepatocytes (black arrow), reduced inflammatory cells (red arrow) and improved the structural integrity of the portal area. Oil red O staining comfirmed these results (Fig. 4E–H). Representative haematoxylin–eosin staining of adipose sections was shown in Fig. 4I–L. The

hypertrophic adipocytes in the HF group were attenuated by baicalein treatment. To shed light on the safety of baicalein, we measured the levels of baicalein-induced toxicity in the liver. No elevation of serum hepatic functional markers (ALT and AST) was detected in the Control + B group. And baicalein attenuated the liver toxicity induced by high-fat diet (Table 4). 3.2.5. Molecular changes of hepatic genes involved in energy metabolism and antioxidation To analyze the mechanism of baicalein-mediating lipid metabolism in the liver, twelve target genes related to lipid metabolism and one gene related to oxidative stress (Nrf2) in the liver were assessed by Real-Time PCR (Fig. 5). Baicalein supplementation did not significantly affect mRNA levels of the target genes in Control mice compared to Control + B mice. As shown in Fig. 5(A1–A3), during 29 weeks of eating a high-fat diet, the mice had a 1.13-fold increase in SREBP-1c mRNA levels and a 2.26-fold increase in FAS mRNA levels relative to mice mice fed a normal diet. However, baicalein treatment normalized the expression of these two genes. No changes in the expression levels of the ACCa were detected. The mRNA levels of PPARc and its target genes, AP2 and CD36, were

134

P. Pu et al. / Molecular and Cellular Endocrinology 362 (2012) 128–138

Fig. 5. Effects of baicalein on expression of hepatic genes controlling fatty acid synthesis, oxidation and metabolism. Lipid metabolism-related genes in liver: (A1–A3) Genes expression of the beginning synthesis way mediated by SERBP-1c and its target genes; (B1–B3) PPARc and the target genes involved with the hepatic lipoogenesis; (C1–C4) The fatty acid oxidation way regulated by PPARaand its target genes; (D1–D2) Genes expression of SCD-1 and mtGPAT; (E) Genes expression of Nrf2. Values represented the mRNA levels of respective proteins expressed as a ratio relative to GAPDH. Then the values were expressed as a fold change of those in control mice (n = 4). Relative mRNA levels are expressed as Mean ± SEM. ⁄P < 0.05, ⁄⁄P < 0.01, ⁄⁄⁄P < 0.001 vs Control, #P < 0.05, ##P < 0.01, ###P < 0.001 vs HF.

P. Pu et al. / Molecular and Cellular Endocrinology 362 (2012) 128–138

evaluated in the present study. The levels of PPARc, AP2 and CD36 obviously changed (increased by 51%, increased by 203% and decreased by 35%, respectively) in the HF group. The increased PPARc, AP2 mRNA levels returned to normal levels, and CD36 expression showed no change in the HF + B group (Fig. 5B1–B3). The expression of the genes promoting fatty acid oxidation (PPARa, UCP2, CPT1) showed a significant difference in HF + B vs. HF mice, except ACOX (Fig. 5C1–C4). Great change occurred in the levels of SCD-1 mRNA, which were increased 61% in high fat-fed mice, but no significant difference was observed in high-fat fed mice supplemented with baicalein (Fig. 5D1). And the levels of mtGPAT mRNA showed no change (Fig. 5D2). The levels of Nrf2 mRNA, related to oxidative stress, were also up-regulated by high-fat diet, but they were attenuated by baicalein treatment (Fig. 5E).

135

3.2.6. Effects of baicalein on MAPKs and insulin signaling pathways in liver tissue To investigate the molecular mechanism of baicalein in metabolic sysdrom, we examined the effects of baicalein on MAPKs, insulin signaling pathway components (IRS1/PI3K/AKT), AMPK and ACC (a key enzyme in lipogenesis). Moreover, we evaluated NF-jB signaling in the mice (Fig. 6). In the present study, increased levels of activated ERK1/2, JNK1/2/3 were present in mice fed a high-fat diet compared to mice fed a normal diet. Baicalein inhibited the activities of ERK1/2 and JNK1/2/3, but did not affect the activity P38. The NF-jB signaling component p-P65 also increased in mice fed a high-fat diet compared to mice fed a normal diet and this increase was inhibited by baicalein (Fig. 6A1 and A2).

Fig. 6. The possible molecular mechanisms of baicalein in attenuating metabolic sysdrom induced by high-fat diet. Baicalein plays the anti-inflammatory by suppressing the MAPKs pathways activation (A1), and improves the insulin resistance by activating IRS1/PI3K/AKT signaling pathways (B1). All the effects are dependent on the activation of AMPKa (C1). (A2) Representative Western blot and quantification of ERK1/2, JNK1/2/3, P38 and P65 phosphorylation and corresponding total protein expressions in the liver (n = 4); (B2) Representative Western blot and quantification of IRS1/P85/AKT phosphorylation and corresponding total protein expressions in the liver (n = 4); (C2) Representative Western blot and quantification of AMPKa and ACC phosphorylation and corresponding total protein expressions in the liver (n = 4).These changes are possible cross-linking to the activity of AMPKa (C). GAPDH was used as internal control (n = 4). Values are expressed as Mean ± SEM. ⁄P < 0.05, ⁄⁄P < 0.01, ⁄⁄⁄P < 0.001 vs Control, ##P < 0.01, ###P < 0.001 vs HF.

136

P. Pu et al. / Molecular and Cellular Endocrinology 362 (2012) 128–138

The IRS1/PI3K/Akt signaling pathway is another important mediator in metabolic syndrome and is related to insulin sensitivity. To elucidate the possible molecular mechanism of insulin resistance, we evaluated the phosphorylation levels of IRS1, P85 (a subunit of PI3K) and Akt. As shown in Fig. 6B, chronic exposure to a high-fat diet decreased the levels of p-IRS1 and p-Akt. In addition, p-P85 expression was slightly elevated. However, these effects were abolished by baicalein treatment. Moreover, the down-regulation of p-ACC in the HF group was altered after baicalein treatment. Baicalein activated AMPK which is an upstream regulator linking the insulin signaling pathway, MAPK activity and lipogenesis (Fig. 6C1 and C2). Altogether, these data suggested that the effects of baicalein on metabolic syndrome require AMPK. 3.3. Testing the effect of baicalein on hepatocytes cultured in high glucose To confirm the aprevious in vivo results, we tested primary hepatocytes cultured in high glucose (25 mM glucose for 2 h). We used cultured primary hepatocytes isolated from wild type and AMPKa2/ mice to examine the above-mentioned signal transduction pathways identified in vivo study. In wild-type hepatocytes of wild type cultured in high glucose, the levels of p-ERK1/ 2, p-P38, p-P65 (Fig. 7A1 and A2) and p-AMPKa (Fig. 7B1 and B2) displayed significant difference from the hepatocytes exposed into normal glucose (5 mM glucose). However, p-JNK1/2/3 and p-ACC showed no change. Baicalein treatment abolished all of these noted effects with the exception of p-JNK1/2/3. Thus, these data sug-

gested that in vitro the MAPKs signaling was conducted by ERK1/ 2 and p38 but not JNK1/2/3. In stimulated AMPKa2/ hepatocytes, the baicalein-mediated effects on the MAPKs signaling pathway were inhibited. This result confirmed that baicalein ameliorates metabolic syndrome in an AMPK-dependent manner. Under the same culture conditions, the phosphorylation levels of the IRS1/ PI3K/Akt signaling pathway components (data not shown) were not altered. Importantly, these data may be affected by the stimulation time and glucose concentration.

4. Discussion As a traditional Chinese medicine material, Scutellaria baicalensis Georgi has been used for cardiovascular and cerebrovascular diseases for 2000 years. Baicalein is a major and active flavanone glycoside. Compared with other diabetes drugs, baicalein has its own advantages: wide variety of sources, low cost, simple extraction process, pleiotropic effects. What is more, baicalein has no side effects and toxicity, which might be more helpful to prevent metabolic syndrome. The results of the present study demonstrated that baicalein may be protective against metabolic syndrome in vivo and in vitro and reversed existing obesity. These protective effects were dependented on AMPKa2-mediated suppression of the lipid synthesis, MAPKs and the activation of fatty acid oxidation, insulin signaling pathways. The AMPK activities led to the inhibition of obesity, insulin resistance, inflammation, hyperglycemia and dyslipidemia, thereby preventing metabolic disorder. These data indi-

Fig. 7. Western blot analysis of the effects of baicalein on AMPK mediated signaling molecules in vitro induced by high-glucose (A1) In wild-type hepatocytes of wild type cultured in high glucose, the activity of MAPKs pathway, especially the P-ERK1/2, P-P38 are up-regulated. And these changes were reversed by baicalein treatment. But these effects were abolished in AMPKa2/ hepatocytes (n = 4). (A2) Representative Western blot and quantification of ERK1/2, JNK1/2/3, P38 and P65 phosphorylation and corresponding total protein expressions in vitro; (B1) Protein expression of phosphorylated and total AMPKa, ACC. (B2) Representative Western blot and quantification of AMPKa and ACC phosphorylation and corresponding total protein expressions in vitro. GAPDH was used as internal control (n = 4). WT: wild type hepatocytes; KO: knock out hepatocytes (AMPKa2/); B: baicalein. Values are expressed as Mean ± SEM. ⁄P < 0.05, ⁄⁄P < 0.01, ⁄⁄⁄P < 0.001 vs Control, ##P < 0.01, ##P < 0.01,###P < 0.001 vs HF.

P. Pu et al. / Molecular and Cellular Endocrinology 362 (2012) 128–138

cated that baicalein may be used as a potential medical treatment for metabolic syndrome. Mounting reports have demonstrated that metabolic syndrome is regulated by inflammatory mechanisms (Sutherland et al., 2004). Specifically, excessive caloric intake will induce visceral fat accumulation. Hypertrophic and enlarged adipocytes tend to release a number of cytokines and chemokines, such as TNF-a, IL-1, MCP-1 and so on (Vincent and Taylor, 2006). These cytokines provoke systemic inflammatory stress by activating MAP kinase kinases, leading to phosphorylation of ERK, JNK, P38 and causing NF-jB activation (de Luca and Olefsky, 2008). NF-jB, an important transcriptional factor, regulates the transcriptional activity of at least 125 genes, most of which are proinflammatory (Patel and Santani, 2009). In the present study, we demonstrated that baicalein potently inhibited proinflammatory responses in the liver by inducing AMPK activation to decrease MAPKs activity. To further confirm the animal experiment results, we used AMPKa2/ primary hepatocytes in a cell culture model. As expected, wild type primary hepatocytes exposed to elevated glucose confirmed the results of the animal model, and the effects caused by high glucose were blocked in AMPKa2/ primary hepatocytes. Collectively, baicalein exerted its inhibitory effects on metabolic syndrome by blocking of AMPKa2-mediated MAPKs signaling pathways. Insulin resistance (IR) is a crucial pathophysiological factor in the development and progression of metabolic syndrome (Haas and Biddinger, 2009). Dephosphorylation of the serine residues of IRS-1 is a common mechanisms stimulated by inflammatory factors (Aguirre et al., 2002). Several pathways are activated in response to IRS phosphorylation, such as the MAPK pathway and the PI3K/AKT pathway and so on (de Luca and Olefsky, 2008). Inflammatory signals, such as JNK or IKKb, are also involved in IR signaling (Steinberg and Kemp, 2009). Activated AMPK may prevent metabolic syndrome through the phosphorylation of insulin receptor substrate1 (IRS-1) and GSK-3b and/or inhibition of MAPK activation, which interferes with the PI3K/AKT pathway (Jakobsen et al., 2001; Horike et al., 2008). In the present study, baicalein significantly reversed the downregulation of IRS1 and AKT as well as the upregulation of MAPKs, NF-jB and P85 in the liver. However, no change was detected in the insulin signaling pathway and JNK in vitro. We considered that the alteration of signaling transduction may have been rapid and the time of stimulation may have been too long (2 h) to detect these changes. After 2 h, the signaling molecule changes were normalized. In our study, the increased dyslipidaemia in high fat-fed mice was also attenuated by baicalein, which might be related to AMPK. Long-term administration of baicalein enhanced hepatic AMPK activation by promoting AMPK phosphorylation. The activated AMPK could repress fatty acid and cholesterol synthesis through two downstream pathways: chronically via decreased transcription of SREBP-1c and its target genes (e.g., FAS) and acutely via increased phosphorylation of ACC and 3-hydroxy-3-methylglutaryl (HMG) CoA reductase (Farrell and Larter, 2006). The activation of AMPK upregulates PPARa gene expression and its target genes, which promote the fatty acid oxidation. In addition, a high-fat diet significantly increased the expression of PPARc, which may promote the elimination of fatty acids, reduce the uptake of FFA in liver, and lower the inflammation (Heikkinen et al., 2007). CD36, a target gene of PPARc, was slightly increased but not significantly affected by baicalein treatment. Moreover, SCD-1 and mtGPAT, two very important lipogenic enzymes responsible for triglyceride metabolism, had no alteration after baicalein treatment. This explained why baicalein had no effect on increased triglyceride. In addition, we measured the gene about oxidative stress, like Nrf2. Our study suggested that baicalein has antioxidant and anti-inflammatory abilities. While the anti-inflammation effect,

137

activated by AMPK, is the major mechanism, other possibilities could not be excluded, like antioxidant. In conclusion, our present work provided evidence that baicalein may be an alternative treatment to prevent metabolic disorder. The major mechanism of its action was up-regulation of AMPK and its related signal pathway. AMPK is not only a major cellular energy sensor, but also a master regulator of metabolic homeostasis involving inflammation and oxidative stress. Activated AMPK could abolish inflammation through the MAPKs signaling pathway; Activated AMPK could attenuate insulin resistance by phosphorylating IRS-1, AKT and dephosphorylate ERK, JNK and NF-jB; It also suppresses fatty acid synthesis, gluconeogenesis and increases mitochondrial b-oxidation. Altogether, these findings indicate that baicalein may be an effective therapeutic strategy for the treatment of metabolic syndrome and its associated complications; further experimental and clinical studies are required to explore the additional mechanisms and establish its clinical utility. Acknowledgement This research was supported by the Fundamental Research Funds for the Central Universities (20103020201000188), National college students’ innovative experiment project (101048637) and the Major Subject of Health Department of Hubei Province of China (No. JX4A02). References Aguirre, V., Werner, E.D., Giraud, J., Lee, Y.H., Shoelson, S.E., White, M.F., 2002. Phosphorylation of Ser307 in insulin receptor substrate-1 blocks interactions with the insulin receptor and inhibits insulin action. J. Biol. Chem. 277, 1531– 1537. Bochorakova, H., Paulova, H., Slanina, J., Musil, P., Taborska, E., 2003. Main flavonoids in the root of I cultivated in Europe and their comparative antiradical properties. Phytother. Res. 17, 640–644. Cong, W.N., Tao, R.Y., Tian, J.Y., Liu, G.T., Ye, F., 2008. The establishment of a novel non-alcoholic steatohepatitis model accompanied with obesity and insulin resistance in mice. Life Sci. 82, 983–990. Cui, L., Zhang, X., Yang, R., Liu, L., Wang, L., Li, M., Du, W., 2010. Baicalein is neuroprotective in rat MCAO model: role of 12/15-lipoxygenase, mitogenactivated protein kinase and cytosolic phospholipase A2. Pharmacol. Biochem. Behav. 96, 469–475. Dandona, P., Aljada, A., Chaudhuri, A., Mohanty, P., Garg, R., 2005. Metabolic syndrome: a comprehensive perspective based on interactions between obesity, diabetes, and inflammation. Circulation 111, 1448–1454. de Luca, C., Olefsky, J.M., 2008. Inflammation and insulin resistance. FEBS Lett. 582, 97–105. Ding, D., Zhang, B., Meng, T., Ma, Y., Wang, X., Peng, H., Shen, J., 2011. Novel synthetic baicalein derivatives caused apoptosis and activated AMP-activated protein kinase in human tumor cells. Org. Biomol. Chem. 9, 7287–7291. Farrell, G.C., Larter, C.Z., 2006. Nonalcoholic fatty liver disease: from steatosis to cirrhosis. Hepatology 43, S99–S112. Grundy, S.M., Cleeman, J.I., Daniels, S.R., Donato, K.A., Eckel, R.H., Franklin, B.A., Gordon, D.J., Krauss, R.M., Savage, P.J., Smith Jr., S.C., Spertus, J.A., Costa, F., 2005. Diagnosis and management of the metabolic syndrome: an american heart association/national heart, lung, and blood institute scientific statement. Circulation 112, 2735–2752. Haas, J.T., Biddinger, S.B., 2009. Dissecting the role of insulin resistance in the metabolic syndrome. Curr. Opin. Lipidol. 20, 206–210. Heikkinen, S., Auwerx, J., Argmann, C.A., 2007. PPARgamma in human and mouse physiology. Biochim. Biophys. Acta 1771, 999–1013. Horike, N., Sakoda, H., Kushiyama, A., Ono, H., Fujishiro, M., Kamata, H., Nishiyama, K., Uchijima, Y., Kurihara, Y., Kurihara, H., Asano, T., 2008. AMP-activated protein kinase activation increases phosphorylation of glycogen synthase kinase 3beta and thereby reduces cAMP-responsive element transcriptional activity and phosphoenolpyruvate carboxykinase C gene expression in the liver. J. Biol. Chem. 283, 33902–33910. Huang, T.H., Kota, B.P., Razmovski, V., Roufogalis, B.D., 2005. Herbal or natural medicines as modulators of peroxisome proliferator-activated receptors and related nuclear receptors for therapy of metabolic syndrome. Basic Clin. Pharmacol. Toxicol. 96, 3–14. Hwang, J.T., Kwon, D.Y., Yoon, S.H., 2009. AMP-activated protein kinase: a potential target for the diseases prevention by natural occurring polyphenols. N. Biotechnol. 26, 17–22. Ikemoto, S., Sugimura, K., Yoshida, N., Yasumoto, R., Wada, S., Yamamoto, K., Kishimoto, T., 2000. Antitumor effects of Scutellariae radix and its components

138

P. Pu et al. / Molecular and Cellular Endocrinology 362 (2012) 128–138

baicalein, baicalin, and wogonin on bladder cancer cell lines. Urology 55, 951– 955. Ishak, K., Baptista, A., Bianchi, L., Callea, F., De Groote, J., Gudat, F., Denk, H., Desmet, V., Korb, G., MacSween, R.N., et al., 1995. Histological grading and staging of chronic hepatitis. J. Hepatol. 22, 696–699. Jakobsen, S.N., Hardie, D.G., Morrice, N., Tornqvist, H.E., 2001. 5’-AMP-activated protein kinase phosphorylates IRS-1 on Ser-789 in mouse C2C12 myotubes in response to 5-aminoimidazole-4-carboxamide riboside. J. Biol. Chem. 276, 46912–46916. Kim, Y.O., Leem, K., Park, J., Lee, P., Ahn, D.K., Lee, B.C., Park, H.K., Suk, K., Kim, S.Y., Kim, H., 2001. Cytoprotective effect of Scutellaria baicalensis in CA1 hippocampal neurons of rats after global cerebral ischemia. J. Ethnopharmacol. 77, 183–188. Konrad, D., Rudich, A., Schoenle, E.J., 2007. Improved glucose tolerance in mice receiving intraperitoneal transplantation of normal fat tissue. Diabetologia 50, 833–839. Marc, N., Galisteo, M., Lagadic-Gossmann, D., Fautrel, A., Joannard, F., Guillouzo, A., Corcos, L., 2000. Regulation of phenobarbital induction of the cytochrome P450 2b9/10 genes in primary mouse hepatocyte culture – involvement of calciumand cAMP-dependent pathways. Eur. J. Biochem. 267, 963–970. Matthews, D.R., Hosker, J.P., Rudenski, A.S., Naylor, B.A., Treacher, D.F., Turner, R.C., 1985. Homeostasis model assessment: insulin resistance and beta-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia 28, 412–419. Patel, S., Santani, D., 2009. Role of NF-kappa B in the pathogenesis of diabetes and its associated complications. Pharmacol. Rep. 61, 595–603.

Prasain, J.K., Carlson, S.H., Wyss, J.M., 2010. Flavonoids and age-related disease: risk, benefits and critical windows. Maturitas 66, 163–171. Ruderman, N., Prentki, M., 2004. AMP kinase and malonyl-CoA: targets for therapy of the metabolic syndrome. Nat. Rev. Drug. Discov. 3, 340–351. Shen, Y.C., Chiou, W.F., Chou, Y.C., Chen, C.F., 2003. Mechanisms in mediating the anti-inflammatory effects of baicalin and baicalein in human leukocytes. Eur. J. Pharmacol. 465, 171–181. Steinberg, G.R., Kemp, B.E., 2009. AMPK in health and disease. Physiol. Rev. 89, 1025–1078. Sutherland, J.P., McKinley, B., Eckel, R.H., 2004. The metabolic syndrome and inflammation. Metab. Syndr. Relat. Disord. 2, 82–104. Unger, R.H., 2002. Lipotoxic diseases. Annu. Rev. Med. 53, 319–336. Vincent, H.K., Taylor, A.G., 2006. Biomarkers and potential mechanisms of obesityinduced oxidant stress in humans. Int. J. Obes. (Lond). 30, 400–418. Viollet, B., Andreelli, F., Jorgensen, S.B., Perrin, C., Flamez, D., Mu, J., Wojtaszewski, J.F., Schuit, F.C., Birnbaum, M., Richter, E., Burcelin, R., Vaulont, S., 2003. Physiological role of AMP-activated protein kinase (AMPK): insights from knockout mouse models. Biochem. Soc. Trans. 31, 216–219. Yin, J., Gao, Z., Liu, D., Liu, Z., Ye, J., 2008. Berberine improves glucose metabolism through induction of glycolysis. Am. J. Physiol. Endocrinol. Metab. 294, E148– E156. Yip, J., Facchini, F.S., Reaven, G.M., 1998. Resistance to insulin-mediated glucose disposal as a predictor of cardiovascular disease. J. Clin. Endocrinol. Metab. 83, 2773–2776.