- Email: [email protected]
Baicalein attenuates inflammatory responses by suppressing TLR4 mediated NF-κB and MAPK signaling pathways in LPS-induced mastitis in mice
International Immunopharmacology 28 (2015) 470–476
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
Baicalein attenuates inflammatory responses by suppressing TLR4 mediated NF-κB and MAPK signaling pathways in LPS-induced mastitis in mice Xuexiu He, Zhengkai Wei, Ershun Zhou, Libin Chen, Jinhua Kou, Jingjing Wang, Zhengtao Yang ⁎ College of Veterinary Medicine, Jilin University, Jilin, Changchun 130062, People's Republic of China
a r t i c l e
i n f o
Article history: Received 23 January 2015 Received in revised form 10 July 2015 Accepted 10 July 2015 Available online xxxx Keywords: Baicalein Mastitis Lipopolysaccharide TLR4 NF-κB MAPKs
a b s t r a c t Baicalein is a phenolic flavonoid presented in the dry roots of Scutellaria baicalensis Georgi. It has been reported that baicalein possesses a number of biological properties, such as antiviral, antioxidative, anti-inflammatory, antithrombotic, and anticancer properties. However, the effect of baicalein on mastitis has not yet been reported. This research aims to detect the effect of baicalein on lipopolysaccharide (LPS)-induced mastitis in mice and to investigate the molecular mechanisms. Baicalein was administered intraperitoneally 1 h before and 12 h after LPS treatment. The results indicated that baicalein treatment markedly attenuated the damage of the mammary gland induced by LPS, suppressed the activity of myeloperoxidase (MPO) and the levels of tumor necrosis factor (TNF-α) and interleukin (IL-1β) in mice with LPS-induced mastitis. Besides, baicalein blocked the expression of Toll-like receptor 4 (TLR4) and then suppressed the phosphorylation of nuclear transcription factor-kappaB (NF-κB) p65 and degradation inhibitor of NF-κBα (IκBα) and, and inhibited the phosphorylation of p38, extracellular signal-regulated kinase (ERK) and c-jun NH2-terminal kinase (JNK) in mitogen-activated protein kinase (MAPK) signal pathway. These findings suggested that baicalein may have a potential prospect against mastitis. © 2015 Published by Elsevier B.V.
Contents 1. 2.
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . Materials and methods . . . . . . . . . . . . . . . . . . . . . 2.1. Animals . . . . . . . . . . . . . . . . . . . . . . . . 2.2. Reagents . . . . . . . . . . . . . . . . . . . . . . . . 2.3. LPS-induced mouse mastitis model . . . . . . . . . . . . 2.4. Histopathological examination . . . . . . . . . . . . . . 2.5. MPO assay . . . . . . . . . . . . . . . . . . . . . . . 2.6. Real-time PCR . . . . . . . . . . . . . . . . . . . . . . 2.7. Western blot analysis . . . . . . . . . . . . . . . . . . 2.8. Electrophoretic mobility shift analysis . . . . . . . . . . . 2.9. Statistical Analysis . . . . . . . . . . . . . . . . . . . . 3. Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.1. Effect of baicalein on histopathological changes . . . . . . . 3.2. Effect of baicalein on MPO activity . . . . . . . . . . . . 3.3. Effect of baicalein on cytokine production . . . . . . . . . 3.4. Effect of baicalein on LPS-induced NF-κB and MAPK activation 3.5. Effect of baicalein on NF-κB binding activity . . . . . . . . 3.6. Effect of baicalein on the activity of TLR4 . . . . . . . . . . 4. Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . Acknowledgments . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
⁎ Corresponding author. E-mail address: [email protected] (Z. Yang).
http://dx.doi.org/10.1016/j.intimp.2015.07.012 1567-5769/© 2015 Published by Elsevier B.V.
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
471 471 471 471 471 471 471 471 472 473 473 473 473 473 473 473 473 474 474 476 476
X. He et al. / International Immunopharmacology 28 (2015) 470–476
471
1. Introduction
2.2. Reagents
Bovine mastitis is defined as an inflammation of the mammary gland, which is the most prevalent disease in dairy cattle and causes the greatest economic loss to dairy farming around the world [1,2]. The reason why the quality of milk would decline is that mastitis reduces the yield of milk and increases the somatic cell count in the milk [3]. The process of this disease consisted of all kinds of reactions, such as edema and cytokines production in mammary gland. Currently, the treatment for mastitis mainly depends on antibiotic. However, antibiotic therapy has antibiotic resistances problem [4]. Therefore, the development of novel therapies for mastitis is imminently needed. LPS, an important component of the outer membrane of gramnegative bacteria, has been reported to be an important risk factor used to establish animal models of mastitis as tools to study the disease [5,6]. The mouse model of LPS-induced mastitis supplies proper alternative with the similarities between the mammary glands of many species, and it is usually used for the study of bovine intramammary infections [7]. TLR4 can be activated by LPS, which activates the downstream signaling that leads to the release of inflammatory cytokines [8]. Moreover, the NF-κB and MAPK signaling pathways activated by LPS play vital roles in inflammation process [9]. Scutellaria baicalensis Georgi, a kind of traditional Chinese medicine, has been used to treat mastitis. Baicalein (5,6,7-trihydroxy-2-phenyl4H-1-benzopyran-4-one, C15H10O5, molecular weight 270.24), is isolated from the dry roots of S. baicalensis Georgi (Fig. 1). It has been reported that baicalein has a certain therapeutic effect in endotoxin-related multiple tissue injury including myocardial dysfunction, acute liver failure, glomerulonephritis, and endotoxic shock in mice. However, there is little information about the effect of baicalein on LPS-induced mastitis in mice. The purpose of this study is to investigate the anti-inflammatory effect and mechanism of baicalein in LPS-induced mastitis in mice.
LPS (Escherichia coli 055:B5) was obtained from the Sigma Chemical Co. (L-2880, St. Louis, MO, USA). Baicalein (purity 99.8%) was purchased from the National Institute for the Control of Pharmaceutical and Biological Products (Beijing, China). T-PER tissue protein extraction reagent (78510) was purchased from Thermo. The MPO determination kit was purchased from the Jiancheng Bioengineering Institute of Nanjing (Nanjing, Jiangsu Province, China). Rabbit monoclonal antibodies p65, p-p65, JNK, p-JNK, ERK, p-ERK, p38, p-p38, p-IκBα and mouse monoclonal antibodies IκBα, TLR4 and MyD88 were purchased from Cell Signaling Technology Inc. (Beverly, MA, USA). The second antibody was provided by GE Healthcare (Buckinghamshire, UK). A nuclear extraction kit and Electrophoretic mobility shift assay (EMSA) “Gel Shift” kit was obtained from Affymetrix (Santa Clara, CA, USA). All other chemicals were of reagent grade. 2.3. LPS-induced mouse mastitis model The LPS-induced mouse mastitis model was established by injection of LPS (200 μg/ml) dissolved in sterile phosphate buffered saline (PBS) into the mammary gland as described in our previous research [10]. The 36 healthy female lactating BALB/c mice were randomly divided into five groups: the blank control group, the LPS group and the LPS + baicalein groups (5, 10 or 20 mg/kg). Baicalein (5, 10 or 20 mg/kg) were given by intraperitoneal injection 1 h before and 12 h after LPS (200 μg/ml) instillation respectively, and the blank control group and LPS group were intraperitoneally injected with an equal volume of PBS. At 24 h after LPS injection, the mice were killed by CO2 inhalation and then mammary tissues were collected and stored at −80 °C until analysis. 2.4. Histopathological examination
2. Materials and methods 2.1. Animals BALB/c mice (quality certificate number SCXK2011-2014), 6–8 weeks old (30 female and 15 male), were provided by the Center of Experimental Animals of Baiqiuen Medical College of Jilin University (Jilin, China). The mice were fed a standard diet and housed under a 12/12 h light/dark cycle at 24 ± 1 °C and 40–80% humidity for at least 3 days to adapt themselves to the environment prior to the experiments. Then two female and one male mice were housed in each cage supplied with sufficient water and forages. All cages had been washed carefully and sterilized by autoclaving. All the animal experiments were performed in accordance with the experimental practices and standards approved by the Animal Welfare and Research Ethics Committee at Jilin University (approval ID 20111106-2), and all efforts were made to minimize suffering.
To detect histopathological changes, mammary tissues were collected and fixed in 10% formaldehyde solution. Then they were dehydrated with graded alcohol and embedded in paraffin, immediately following staining with hematoxylin and eosin. Finally, the histopathologic changes of the mammary tissues were examined under a light microscopy. 2.5. MPO assay The mammary tissue samples were collected, homogenized and centrifuged to acquire the supernatant for measuring the MPO activity. MPO activity in supernatant of mammary tissue was determined following the manufacturer's protocols. 2.6. Real-time PCR Total RNA in mammary tissues were extracted using TRIzol (Invitrogen, Carlsbad, CA, USA). RNA samples were treated with DNase I (MBI Fermentas, Lithuania) to remove genomic DNA contamination. According to the manufacturer's instructions of the Revert Aid First Strand cDNA Synthesis Kit (MBI Fermentas, Lithuania), reverse transcription (RT) reaction was carried out. Real-time PCR (RT-PCR) was operated on a 7500 real-time PCR system (Applied Biosystems, Table 1 Primers used in this study.
Fig. 1. The chemical structure of baicalein.
Primer name
Nucleotide sequence (5′–3′)
Product size
TNF-α forward TNF-α reverse IL-1β forward IL-1β reverse β-actin forward β-actin reverse
GCCTCCCTCTCATCAGTTCTA GGCAGCCTTGTCCCTTG ACCTGTGTCTTTCCCGTGG TCATCTCGGAGCCTGTAGTG TGCTGTCCCTGTATGCCTCT TTTGATGTCACGCACGATTT
246 bp 162 bp 224 bp
472
X. He et al. / International Immunopharmacology 28 (2015) 470–476
Fig. 2. Effect of baicalein on histopathologic changes in mammary tissues in LPS-induced mouse mastitis (×400). Mammary tissue of control group (A), the LPS group (B), the LPS + baicalein 5 mg/kg group (C), the LPS + baicalein 10 mg/kg group (D), and the LPS + baicalein 20 mg/kg group (E).
Carlsbad, CA, USA). Primers were acquired from Sangon Biotech Co. Ltd (Shanghai, China). The reactions were operated by using FastStart Universal SYBR Green Master (Roche Applied Science, Mannheim, Germany) according to the manufacturer's instructions as follows: the samples were incubated at 50 °C for 2 min and after that incubated at 95 °C for 10 min followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. Primers were acquired from Sangon Biotech Co. Ltd (Shanghai, China) (Table 1). 2.7. Western blot analysis Total proteins from mammary tissue were extracted by mammalian protein extraction reagent. The concentration of the protein was determined by BCA protein assay kit. The protein samples with equal amounts of protein were separated through 10% SDS polyacrylamide gels, then transferred to a polyvinylidene difluoride membrane. The membrane was blocked in 5% skim milk for 2 h at room temperature. Subsequently, the membrane was probed with primary antibodies (1:1000 dilutions in TBST) at 4 °C overnight, and then the membrane was washed three times with TBST for 5 min each time with gentle
Fig. 3. Effects of baicalein on MPO activity in mammary tissues of LPS-induced mastitis. The MPO activity was determined at 24 h after LPS administration. The values presented are the mean ± SEM. Number sign (#) indicates P b 0.01 vs. control group. Single asterisk (*) indicates P b 0.05, and double asterisks (**) indicate P b 0.01 vs. LPS group.
Fig. 4. Effects of baicalein on the mRNA levels of TNF-α (A) and IL-1β (B) in the homogenate of LPS-induced mice mammary gland tissues. The mRNA levels of TNF-α and IL-1β were measured by RT-PCR. The mRNA levels of TNF-α and IL-1β was significantly increased in the LPS group, and the pretreatment of baicalein reduced mRNA levels of TNF-α and IL-1β in a dose-dependent manner.
X. He et al. / International Immunopharmacology 28 (2015) 470–476
agitation and incubated with peroxidase-conjugated secondary antibody (1:50,000 dilutions in TBST) at room temperature for 2 h. Finally, the membrane was again washed three times for 5 min and blots were visualized with the ECLPlus Western Blotting Detection System (GE Healthcare, Chalfont St Giles, UK). 2.8. Electrophoretic mobility shift analysis The NF-κB–DNA binding activity was measured by EMSA, according to the manufacturer's protocol. DNA/protein complexes were separated from free DNA on a 6% nondenaturing polyacrylamide gel in 0.25 mM TBE buffer. Then the gel was transferred to a nylon membrane and detected using streptavidin-HRP and chemiluminescent substrate. The following sequence was used as a p65 probe: 5′-CATCGGAAATTTCCGGAA ATTTCCGGAAATTTCCGGC-3′.
2.9. Statistical Analysis All experimental data were presented as means ± S.E.M. Differences between the mean values of normally distributed data were assessed by one-way ANOVA (Dunnett's t test) and the two-tailed Student's t test. Values of P b 0.05 were considered to be statistically significant. 3. Results 3.1. Effect of baicalein on histopathological changes The mammary gland with intraperitoneal injection of LPS was histopathologically characterized by thickening of the mammary alveolus, hyperemia, edema and inflammatory cell infiltration [9]. In this study, histopathologic changes could be significantly observed in the LPS group (Fig. 2B) compared with the control group (Fig. 2A). However, pretreatment with baicalein significantly ameliorated LPS-induced pathological changes in a dose-dependent manner (Fig. 2C–E).
473
3.2. Effect of baicalein on MPO activity The MPO activity, which reflects the level of inflammation and oxidative stress, is a functional biomarker of neutrophils. Compared with the control group, MPO activity was significantly increased in the LPS group. However, the activation of MPO was significantly reduced through pretreatment with baicalein at the doses of 5, 10 and 20 mg/kg in a dose-dependent manner (Fig. 3).
3.3. Effect of baicalein on cytokine production Cytokines such as TNF-α and IL-1β play a key role in inflammatory diseases [11–13]. To determine whether the inflammatory cytokines mRNA expression was influenced by baicalein, RT-PCR was carried out to measure the mRNA levels of TNF-α and IL-1β (Fig. 4). The mRNA levels of TNF-α and IL-1β were increased in the LPS group, whereas administration of baicalein significantly reduced the LPS-induced TNF-α and IL-1β mRNA expressions in a dose-dependent manner.
3.4. Effect of baicalein on LPS-induced NF-κB and MAPK activation Injection of LPS obviously increased the levels of p65 and IκBα phosphorylation in the NF-κB signal pathway and the levels of p38, ERK and JNK phosphorylation in the MAPK signal pathway. On the contrary, pretreatment with baicalein inhibited the up-regulation of phosphorylation of p65 and IκBα, and p38, ERK and JNK as compared with the LPS group (Figs. 5 and 6).
3.5. Effect of baicalein on NF-κB binding activity EMSA analyses showed that LPS groups had increased NF-κB binding activity. However, pretreatment with baicalein reduced NF-κB binding activity (Fig. 7).
Fig. 5. Western blot analysis in mammary tissues derived from LPS-induced mice. Baicalein inhibited LPS-induced activation of NF-κB.
474
X. He et al. / International Immunopharmacology 28 (2015) 470–476
Fig. 6. Western blot analysis in mammary tissues derived from LPS-induced mice. Baicalein inhibits phosphorylation of MAPK p38, ERK, and JNK.
3.6. Effect of baicalein on the activity of TLR4 The expression of TLR4 will directly affect the downstream NF-κB and MAPK activation in LPS-induced mouse mastitis. Western blot was carried out to measure the activity of TLR4. The results showed that baicalein dose-dependently down-regulated the expression of TLR4 up-regulated by LPS (Fig. 8).
4. Discussion Bovine mastitis can be caused by many bacterial pathogens entering the mammary gland via the teat canal when the teat sphincter is relaxed following milking or suckling [14]. It is a complex infection and inflammation of the mammary gland, and the inflammatory process is a multiple and complex interactions between host and pathogens [15]. Because of high costs, a long gestation period and an uncertain health status, bovine mastitis research is limited. For these reasons, the mouse model of LPS-induced mastitis is used for the research of bovine intramammary infections. We were committed to the screening of drugs to treat mastitis for a long time. We have detected the effects of multiple drugs on LPSinduced mastitis in mice in our previous studies, such as bergenin, curcumin, cyaniding-3-β-glucoside, baicalein and salidroside etc. Meanwhile, baicalein emerged the better effect than baicalein, but worse than
that of curcumin and salidroside on LPS-induced mouse mastitis by comparison. After injection with LPS, we found that large numbers of inflammatory cell infiltration were present in thickened mammary alveolus compared with the control group. However, treatment with baicalein reduced the histopathologic changes induced by LPS. MPO activity, a marker of neutrophil influx into tissue, is directly proportional to the number of neutrophils in the tissue [16]. The MPO activity was significantly increased after LPS injection. In this study, baicalein obviously decreased the MPO activity induced by LPS, which is related to the reduction of neutrophils and macrophages infiltration into the mammary tissues. Inflammatory responses was regulated by cytokines during infection, which is a multiple and complex process [17]. Cytokines, such as TNF-α and IL-1β, the signal of various kinds of interaction between cells, play important roles in the process of host defense and infection and inflammation pathological development [18]. The pro-inflammatory cytokines have been reported in bovine mastitis such as TNF-α and IL-1β [19]. TNFα is the earliest and primary endogenous mediator and has been shown to play crucial roles in both inflammatory and neuropathic hyperalgesia [20]. TNF-α can elicit infiltration and activation of neutrophils, impair vascular endothelial cells, enhance cellular adhesion molecules. IL-1β, a subtype of IL-1, is a pro-inflammatory cytokine released by monocytes, macrophages, and endothelial cells during the inflammatory response and has been demonstrated to have the ability to stimulate the
X. He et al. / International Immunopharmacology 28 (2015) 470–476
Fig. 7. Effects of baicalein on NF-κB-binding activity. Binding activity of NF-κB was examined in nuclear proteins from the mammary tissue by EMSA.
475
production of several secondary cytokines [21]. In the current study, the concentrations of TNF-α and IL-1β were significantly increased in the LPS group compared with the control group. However, pretreatment with baicalein inhibited the expression of TNF-α and IL-1β in a dosedependent manner in LPS-induced mouse mastitis. These results indicated that baicalein reduced inflammatory responses via inhibiting the release of the pro-inflammatory cytokines TNF-α and IL-1β. NF-κB is a multi-subunit nuclear transcription factor rapidly activating the transcription of various cytokines and chemokines [22]. It is a prevalent heterodimeric transcription factor and exists in an inactive form in the cytoplasm bound to the inhibitory IκB proteins [23]. The expression of many inflammation-related genes is controlled through the NF-κB signaling pathway [24]. To further explore the potential molecular mechanism of baicalein suppressing the production of proinflammatory cytokines, we examined the activation of NF-κB p65 subunit and IκBα in the NF-κB signaling pathway. Our data showed that the phosphorylation of IκBα and NF-κB protein were increased by LPS, but baicalein inhibited NF-κB activation and IκBα degradation. Therefore, these results demonstrated that anti-inflammatory effect of baicalein correlated with the inhibition of NF-κB activation. We also examined the activation of p38, ERK and JNK in the MAPK signal pathway which play a key role during inflammatory responses [25]. Our results showed that baicalein significantly inhibited the phosphorylation of p38, ERK and JNK by LPS-induced mouse mastitis. From the above, the results in our study confirmed that baicalein could exert the anti-inflammatory effect against LPS-induced mice mastitis through inhibiting the activation of NF-κB and MAPK signal pathways. TLR4, one of the best characterized TLRs, is a pattern recognition receptor for LPS [26]. TLR4 initiates the MyD88 activation of the downstream NF-κB and MAPK signaling pathways [27]. We investigated how did to baicalein exert the anti-inflammatory activity through TLR4-mediated signaling. The Western blot results show that baicalein significantly inhibited the activity of TLR4 by LPS-induced mouse mastitis, which demonstrates that the downstream NF-κB and MAPK signaling pathways were suppressed (Fig. 9).
Fig. 8. Baicalein inhibited LPS-induced activation of TLR4 and MyD88 expression with Western blotting.
476
X. He et al. / International Immunopharmacology 28 (2015) 470–476
[6]
[7] [8]
[9] [10]
[11]
[12]
[13]
[14]
[15] [16]
Fig. 9. Anti-inflammatory mechanism of baicalein is associated with suppressing the TLR4mediated NF-B and MAPK signaling pathways induced by LPS.
Bergenin and salidroside attenuates inflammatory responses by suppressing NF-κB and MAPK signaling pathways [28,29]. Curcumin attenuates inflammatory responses by suppressing TLR4 signaling pathways [30]. Cyaniding-3-O-β-glucoside inhibits inflammatory responses by regulating liver X receptor (LXR) [13]. Baicalein inhibits inflammatory responses by reductions in TLR2 signaling pathways [31]. In this study, our results showed that baicalein attenuates inflammatory responses by suppressing TLR4 signaling pathways in LPS-induced mastitis in mice. In conclusion, the present study demonstrated that baicalein has anti-inflammatory effects on LPS-induced mouse mastitis may be related to inhibition of TLR4 expression, which subsequently decrease the mRNA levels of pro-inflammatory cytokines and suppress NF-κB and MAPK signal pathways. These findings provide new insights in understanding the complex actions of baicalein in immune response and suggest that baicalein may be a potential agent for prophylaxis of mastitis.
[17]
[18]
[19] [20]
[21] [22] [23]
[24]
[25]
Acknowledgments
[26]
This study was supported by the China Postdoctoral Science Foundation (2013M540255).
[27] [28]
References [1] K.R. Petrovski, M. Trajcev, G. Buneski, A review of the factors affecting the costs of bovine mastitis, J. S. Afr. Vet. Assoc. 77 (2006) 52–60. [2] M. Geiszt, J. Witta, J. Baffi, K. Lekstrom, T.L. Leto, Dual oxidases represent novel hydrogen peroxide sources supporting mucosal surface host defense, FASEB J. 17 (2003) 1502–1504. [3] C. Viguier, S. Arora, N. Gilmartin, K. Welbeck, R. O'Kennedy, Mastitis detection: current trends and future perspectives, Trends Biotechnol. 27 (2009) 486–493. [4] B.E. Gillespie, H. Moorehead, P. Lunn, H.H. Dowlen, D.L. Johnson, K.C. Lamar, et al., Efficacy of extended pirlimycin hydrochloride therapy for treatment of environmental Streptococcus spp. and Staphylococcus aureus intramammary infections in lactating dairy cows, Vet. Ther. 3 (2002) 373–380. [5] S. Schmitz, M.W. Pfaffl, H.H.D. Meyer, R.M. Bruckmaier, Short-term changes of mRNA expression of various inflammatory factors and milk proteins in
[29]
[30]
[31]
mammary tissue during LPS-induced mastitis, Domest. Anim. Endocrinol. 26 (2004) 111–126. S. Elazar, E. Gonen, A. Livneh-Kol, I. Rosenshine, N.Y. Shpigel, Essential role of neutrophils but not mammary alveolar macrophages in a murine model of acute Escherichia coli mastitis, Vet. Res. 41 (2010). S. Notebaert, E. Meyer, Mouse models to study the pathogenesis and control of bovine mastitis. A review, Vet. Q. 28 (2006) 2–13. S. De Schepper, A. De Ketelaere, D.D. Bannerman, M.J. Paape, L. Peelman, C. Burvenich, The toll-like receptor-4 (TLR-4) pathway and its possible role in the pathogenesis of Escherichia coli mastitis in dairy cattle, Vet. Res. 39 (2008). P.A. Baeuerle, V.R. Baichwal, NF-kappa B as a frequent target for immunosuppressive and anti-inflammatory molecules, Adv. Immunol. 65 (1997) 111–137. S. Bhattarai, R.G. Alany, C.R. Bunt, H. Abdelkader, M.J. Rathbone, Design and characterisation of a polyethylene oxide matrix with the potential use as a teat insert for prevention/treatment of bovine mastitis, AAPS J. 17 (2015) 167–174. J. Wu, H. Suzuki, A.A. Akhand, Y.W. Zhou, K. Hossain, I. Nakashima, Modes of activation of mitogen-activated protein kinases and their roles in cepharanthine-induced apoptosis in human leukemia cells, Cell. Signal. 14 (2002) 509–515. J. Zheng, A.D. Watson, D.E. Kerr, Genome-wide expression analysis of lipopolysaccharide-induced mastitis in a mouse model, Infect. Immun. 74 (2006) 1907–1915. Y. Fu, Z. Wei, E. Zhou, N. Zhang, Z. Yang, Cyanidin-3-O-beta-glucoside inhibits lipopolysaccharide-induced inflammatory response in mouse mastitis model, J. Lipid Res. 55 (2014) 1111–1119. D.E. Morin, G.C. Petersen, H.L. Whitmore, L.L. Hungerford, R.A. Hinton, Economic analysis of a mastitis monitoring and control program in four dairy herds, J. Am. Vet. Med. Assoc. 202 (1993) 540–548. A. Bradley, Bovine mastitis: an evolving disease, Vet. J. 164 (2002) 116–128. J.E. Krawisz, P. Sharon, W.F. Stenson, Quantitative assay for acute intestinal inflammation based on myeloperoxidase activity. Assessment of inflammation in rat and hamster models, Gastroenterology 87 (1984) 1344–1350. J.W. Lee, D.D. Bannerman, M.J. Paape, M.K. Huang, X. Zhao, Characterization of cytokine expression in milk somatic cells during intramammary infections with Escherichia coli or Staphylococcus aureus by real-time PCR, Vet. Res. 37 (2006) 219–229. N. Boudjellab, H.S. Chan-Tang, X. Zhao, Bovine interleukin-1 expression by cultured mammary epithelial cells (MAC-T) and its involvement in the release of MAC-T derived interleukin-8, Comp. Biochem. Physiol. A Mol. Integr. Physiol. 127 (2000) 191–199. P. Rainard, C. Riollet, Innate immunity of the bovine mammary gland, Vet. Res. 37 (2006) 369–400. M.K. Connolly, A.S. Bedrosian, J.M.S. Clair, A.P. Mitchell, J. Ibrahim, A. Stroud, et al., In liver fibrosis, dendritic cells govern hepatic inflammation in mice via TNF-alpha, J. Clin. Investig. 119 (2009) 3213–3225. J.W. Christman, R.T. Sadikot, T.S. Blackwell, The role of nuclear factor-kappa B in pulmonary diseases, Chest 117 (2000) 1482–1487. S. Vallabhapurapu, M. Karin, Regulation and function of NF-kappaB transcription factors in the immune system, Annu. Rev. Immunol. 27 (2009) 693–733. A. Rai, S. Kapoor, S. Singh, B.P. Chatterji, D. Panda, Transcription factor NF-kappaB associates with microtubules and stimulates apoptosis in response to suppression of microtubule dynamics in MCF-7 cells, Biochem. Pharmacol. 93 (2015) 277–289. K. Heyninck, M. Lahtela-Kakkonen, P. Van der Veken, G. Haegeman, W. Vanden Berghe, Withaferin A inhibits NF-kappaB activation by targeting cysteine 179 in IKKbeta, Biochem. Pharmacol. 91 (2014) 501–509. S.D. Kim, Y.J. Lee, J.S. Baik, J.Y. Han, C.G. Lee, K. Heo, et al., Baicalein inhibits agonistand tumor cell-induced platelet aggregation while suppressing pulmonary tumor metastasis via cAMP-mediated VASP phosphorylation along with impaired MAPKs and PI3K-Akt activation, Biochem. Pharmacol. 92 (2014) 251–265. T. Shuto, K. Kato, Y. Mori, S. Viriyakosol, M. Oba, T. Furuta, et al., Membraneanchored CD14 is required for LPS-induced TLR4 endocytosis in TLR4/MD-2/CD14 overexpressing CHO cells, Biochem. Biophys. Res. Commun. 338 (2005) 1402–1409. Y.C. Lu, W.C. Yeh, P.S. Ohashi, LPS/TLR4 signal transduction pathway, Cytokine 42 (2008) 145–151. X.J. Gao, M.Y. Guo, Z.C. Zhang, T.C. Wang, Y.G. Cao, N.S. Zhang, Bergenin plays an anti-inflammatory role via the modulation of MAPK and NF-kappaB signaling pathways in a mouse model of LPS-induced mastitis, Inflammation 38 (2015) 1142–1150. D.P. Li, Y.H. Fu, W. Zhang, G.L. Su, B. Liu, M.Y. Guo, et al., Salidroside attenuates inflammatory responses by suppressing nuclear factor-kappa B and mitogen activated protein kinases activation in lipopolysaccharide-induced mastitis in mice, Inflamm. Res. 62 (2013) 9–15. Y. Fu, R. Gao, Y. Cao, M. Guo, Z. Wei, E. Zhou, et al., Curcumin attenuates inflammatory responses by suppressing TLR4-mediated NF-kappaB signaling pathway in lipopolysaccharide-induced mastitis in mice, Int. Immunopharmacol. 20 (2014) 54–58. M.Y. Guo, Y.G. Cao, T.C. Wang, X.J. Song, Z.C. Liu, E.S. Zhou, et al., Baicalin inhibits Staphylococcus aureus-induced apoptosis by regulating TLR2 and TLR2-related apoptotic factors in the mouse mammary glands, Eur. J. Pharmacol. 723 (2014) 481–488.
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
Baicalein attenuates inflammatory responses by suppressing TLR4 mediated NF-κB and MAPK signaling pathways in LPS-induced mastitis in mice Xuexiu He, Zhengkai Wei, Ershun Zhou, Libin Chen, Jinhua Kou, Jingjing Wang, Zhengtao Yang ⁎ College of Veterinary Medicine, Jilin University, Jilin, Changchun 130062, People's Republic of China
a r t i c l e
i n f o
Article history: Received 23 January 2015 Received in revised form 10 July 2015 Accepted 10 July 2015 Available online xxxx Keywords: Baicalein Mastitis Lipopolysaccharide TLR4 NF-κB MAPKs
a b s t r a c t Baicalein is a phenolic flavonoid presented in the dry roots of Scutellaria baicalensis Georgi. It has been reported that baicalein possesses a number of biological properties, such as antiviral, antioxidative, anti-inflammatory, antithrombotic, and anticancer properties. However, the effect of baicalein on mastitis has not yet been reported. This research aims to detect the effect of baicalein on lipopolysaccharide (LPS)-induced mastitis in mice and to investigate the molecular mechanisms. Baicalein was administered intraperitoneally 1 h before and 12 h after LPS treatment. The results indicated that baicalein treatment markedly attenuated the damage of the mammary gland induced by LPS, suppressed the activity of myeloperoxidase (MPO) and the levels of tumor necrosis factor (TNF-α) and interleukin (IL-1β) in mice with LPS-induced mastitis. Besides, baicalein blocked the expression of Toll-like receptor 4 (TLR4) and then suppressed the phosphorylation of nuclear transcription factor-kappaB (NF-κB) p65 and degradation inhibitor of NF-κBα (IκBα) and, and inhibited the phosphorylation of p38, extracellular signal-regulated kinase (ERK) and c-jun NH2-terminal kinase (JNK) in mitogen-activated protein kinase (MAPK) signal pathway. These findings suggested that baicalein may have a potential prospect against mastitis. © 2015 Published by Elsevier B.V.
Contents 1. 2.
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . Materials and methods . . . . . . . . . . . . . . . . . . . . . 2.1. Animals . . . . . . . . . . . . . . . . . . . . . . . . 2.2. Reagents . . . . . . . . . . . . . . . . . . . . . . . . 2.3. LPS-induced mouse mastitis model . . . . . . . . . . . . 2.4. Histopathological examination . . . . . . . . . . . . . . 2.5. MPO assay . . . . . . . . . . . . . . . . . . . . . . . 2.6. Real-time PCR . . . . . . . . . . . . . . . . . . . . . . 2.7. Western blot analysis . . . . . . . . . . . . . . . . . . 2.8. Electrophoretic mobility shift analysis . . . . . . . . . . . 2.9. Statistical Analysis . . . . . . . . . . . . . . . . . . . . 3. Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.1. Effect of baicalein on histopathological changes . . . . . . . 3.2. Effect of baicalein on MPO activity . . . . . . . . . . . . 3.3. Effect of baicalein on cytokine production . . . . . . . . . 3.4. Effect of baicalein on LPS-induced NF-κB and MAPK activation 3.5. Effect of baicalein on NF-κB binding activity . . . . . . . . 3.6. Effect of baicalein on the activity of TLR4 . . . . . . . . . . 4. Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . Acknowledgments . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
⁎ Corresponding author. E-mail address: [email protected] (Z. Yang).
http://dx.doi.org/10.1016/j.intimp.2015.07.012 1567-5769/© 2015 Published by Elsevier B.V.
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . .
471 471 471 471 471 471 471 471 472 473 473 473 473 473 473 473 473 474 474 476 476
X. He et al. / International Immunopharmacology 28 (2015) 470–476
471
1. Introduction
2.2. Reagents
Bovine mastitis is defined as an inflammation of the mammary gland, which is the most prevalent disease in dairy cattle and causes the greatest economic loss to dairy farming around the world [1,2]. The reason why the quality of milk would decline is that mastitis reduces the yield of milk and increases the somatic cell count in the milk [3]. The process of this disease consisted of all kinds of reactions, such as edema and cytokines production in mammary gland. Currently, the treatment for mastitis mainly depends on antibiotic. However, antibiotic therapy has antibiotic resistances problem [4]. Therefore, the development of novel therapies for mastitis is imminently needed. LPS, an important component of the outer membrane of gramnegative bacteria, has been reported to be an important risk factor used to establish animal models of mastitis as tools to study the disease [5,6]. The mouse model of LPS-induced mastitis supplies proper alternative with the similarities between the mammary glands of many species, and it is usually used for the study of bovine intramammary infections [7]. TLR4 can be activated by LPS, which activates the downstream signaling that leads to the release of inflammatory cytokines [8]. Moreover, the NF-κB and MAPK signaling pathways activated by LPS play vital roles in inflammation process [9]. Scutellaria baicalensis Georgi, a kind of traditional Chinese medicine, has been used to treat mastitis. Baicalein (5,6,7-trihydroxy-2-phenyl4H-1-benzopyran-4-one, C15H10O5, molecular weight 270.24), is isolated from the dry roots of S. baicalensis Georgi (Fig. 1). It has been reported that baicalein has a certain therapeutic effect in endotoxin-related multiple tissue injury including myocardial dysfunction, acute liver failure, glomerulonephritis, and endotoxic shock in mice. However, there is little information about the effect of baicalein on LPS-induced mastitis in mice. The purpose of this study is to investigate the anti-inflammatory effect and mechanism of baicalein in LPS-induced mastitis in mice.
LPS (Escherichia coli 055:B5) was obtained from the Sigma Chemical Co. (L-2880, St. Louis, MO, USA). Baicalein (purity 99.8%) was purchased from the National Institute for the Control of Pharmaceutical and Biological Products (Beijing, China). T-PER tissue protein extraction reagent (78510) was purchased from Thermo. The MPO determination kit was purchased from the Jiancheng Bioengineering Institute of Nanjing (Nanjing, Jiangsu Province, China). Rabbit monoclonal antibodies p65, p-p65, JNK, p-JNK, ERK, p-ERK, p38, p-p38, p-IκBα and mouse monoclonal antibodies IκBα, TLR4 and MyD88 were purchased from Cell Signaling Technology Inc. (Beverly, MA, USA). The second antibody was provided by GE Healthcare (Buckinghamshire, UK). A nuclear extraction kit and Electrophoretic mobility shift assay (EMSA) “Gel Shift” kit was obtained from Affymetrix (Santa Clara, CA, USA). All other chemicals were of reagent grade. 2.3. LPS-induced mouse mastitis model The LPS-induced mouse mastitis model was established by injection of LPS (200 μg/ml) dissolved in sterile phosphate buffered saline (PBS) into the mammary gland as described in our previous research [10]. The 36 healthy female lactating BALB/c mice were randomly divided into five groups: the blank control group, the LPS group and the LPS + baicalein groups (5, 10 or 20 mg/kg). Baicalein (5, 10 or 20 mg/kg) were given by intraperitoneal injection 1 h before and 12 h after LPS (200 μg/ml) instillation respectively, and the blank control group and LPS group were intraperitoneally injected with an equal volume of PBS. At 24 h after LPS injection, the mice were killed by CO2 inhalation and then mammary tissues were collected and stored at −80 °C until analysis. 2.4. Histopathological examination
2. Materials and methods 2.1. Animals BALB/c mice (quality certificate number SCXK2011-2014), 6–8 weeks old (30 female and 15 male), were provided by the Center of Experimental Animals of Baiqiuen Medical College of Jilin University (Jilin, China). The mice were fed a standard diet and housed under a 12/12 h light/dark cycle at 24 ± 1 °C and 40–80% humidity for at least 3 days to adapt themselves to the environment prior to the experiments. Then two female and one male mice were housed in each cage supplied with sufficient water and forages. All cages had been washed carefully and sterilized by autoclaving. All the animal experiments were performed in accordance with the experimental practices and standards approved by the Animal Welfare and Research Ethics Committee at Jilin University (approval ID 20111106-2), and all efforts were made to minimize suffering.
To detect histopathological changes, mammary tissues were collected and fixed in 10% formaldehyde solution. Then they were dehydrated with graded alcohol and embedded in paraffin, immediately following staining with hematoxylin and eosin. Finally, the histopathologic changes of the mammary tissues were examined under a light microscopy. 2.5. MPO assay The mammary tissue samples were collected, homogenized and centrifuged to acquire the supernatant for measuring the MPO activity. MPO activity in supernatant of mammary tissue was determined following the manufacturer's protocols. 2.6. Real-time PCR Total RNA in mammary tissues were extracted using TRIzol (Invitrogen, Carlsbad, CA, USA). RNA samples were treated with DNase I (MBI Fermentas, Lithuania) to remove genomic DNA contamination. According to the manufacturer's instructions of the Revert Aid First Strand cDNA Synthesis Kit (MBI Fermentas, Lithuania), reverse transcription (RT) reaction was carried out. Real-time PCR (RT-PCR) was operated on a 7500 real-time PCR system (Applied Biosystems, Table 1 Primers used in this study.
Fig. 1. The chemical structure of baicalein.
Primer name
Nucleotide sequence (5′–3′)
Product size
TNF-α forward TNF-α reverse IL-1β forward IL-1β reverse β-actin forward β-actin reverse
GCCTCCCTCTCATCAGTTCTA GGCAGCCTTGTCCCTTG ACCTGTGTCTTTCCCGTGG TCATCTCGGAGCCTGTAGTG TGCTGTCCCTGTATGCCTCT TTTGATGTCACGCACGATTT
246 bp 162 bp 224 bp
472
X. He et al. / International Immunopharmacology 28 (2015) 470–476
Fig. 2. Effect of baicalein on histopathologic changes in mammary tissues in LPS-induced mouse mastitis (×400). Mammary tissue of control group (A), the LPS group (B), the LPS + baicalein 5 mg/kg group (C), the LPS + baicalein 10 mg/kg group (D), and the LPS + baicalein 20 mg/kg group (E).
Carlsbad, CA, USA). Primers were acquired from Sangon Biotech Co. Ltd (Shanghai, China). The reactions were operated by using FastStart Universal SYBR Green Master (Roche Applied Science, Mannheim, Germany) according to the manufacturer's instructions as follows: the samples were incubated at 50 °C for 2 min and after that incubated at 95 °C for 10 min followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. Primers were acquired from Sangon Biotech Co. Ltd (Shanghai, China) (Table 1). 2.7. Western blot analysis Total proteins from mammary tissue were extracted by mammalian protein extraction reagent. The concentration of the protein was determined by BCA protein assay kit. The protein samples with equal amounts of protein were separated through 10% SDS polyacrylamide gels, then transferred to a polyvinylidene difluoride membrane. The membrane was blocked in 5% skim milk for 2 h at room temperature. Subsequently, the membrane was probed with primary antibodies (1:1000 dilutions in TBST) at 4 °C overnight, and then the membrane was washed three times with TBST for 5 min each time with gentle
Fig. 3. Effects of baicalein on MPO activity in mammary tissues of LPS-induced mastitis. The MPO activity was determined at 24 h after LPS administration. The values presented are the mean ± SEM. Number sign (#) indicates P b 0.01 vs. control group. Single asterisk (*) indicates P b 0.05, and double asterisks (**) indicate P b 0.01 vs. LPS group.
Fig. 4. Effects of baicalein on the mRNA levels of TNF-α (A) and IL-1β (B) in the homogenate of LPS-induced mice mammary gland tissues. The mRNA levels of TNF-α and IL-1β were measured by RT-PCR. The mRNA levels of TNF-α and IL-1β was significantly increased in the LPS group, and the pretreatment of baicalein reduced mRNA levels of TNF-α and IL-1β in a dose-dependent manner.
X. He et al. / International Immunopharmacology 28 (2015) 470–476
agitation and incubated with peroxidase-conjugated secondary antibody (1:50,000 dilutions in TBST) at room temperature for 2 h. Finally, the membrane was again washed three times for 5 min and blots were visualized with the ECLPlus Western Blotting Detection System (GE Healthcare, Chalfont St Giles, UK). 2.8. Electrophoretic mobility shift analysis The NF-κB–DNA binding activity was measured by EMSA, according to the manufacturer's protocol. DNA/protein complexes were separated from free DNA on a 6% nondenaturing polyacrylamide gel in 0.25 mM TBE buffer. Then the gel was transferred to a nylon membrane and detected using streptavidin-HRP and chemiluminescent substrate. The following sequence was used as a p65 probe: 5′-CATCGGAAATTTCCGGAA ATTTCCGGAAATTTCCGGC-3′.
2.9. Statistical Analysis All experimental data were presented as means ± S.E.M. Differences between the mean values of normally distributed data were assessed by one-way ANOVA (Dunnett's t test) and the two-tailed Student's t test. Values of P b 0.05 were considered to be statistically significant. 3. Results 3.1. Effect of baicalein on histopathological changes The mammary gland with intraperitoneal injection of LPS was histopathologically characterized by thickening of the mammary alveolus, hyperemia, edema and inflammatory cell infiltration [9]. In this study, histopathologic changes could be significantly observed in the LPS group (Fig. 2B) compared with the control group (Fig. 2A). However, pretreatment with baicalein significantly ameliorated LPS-induced pathological changes in a dose-dependent manner (Fig. 2C–E).
473
3.2. Effect of baicalein on MPO activity The MPO activity, which reflects the level of inflammation and oxidative stress, is a functional biomarker of neutrophils. Compared with the control group, MPO activity was significantly increased in the LPS group. However, the activation of MPO was significantly reduced through pretreatment with baicalein at the doses of 5, 10 and 20 mg/kg in a dose-dependent manner (Fig. 3).
3.3. Effect of baicalein on cytokine production Cytokines such as TNF-α and IL-1β play a key role in inflammatory diseases [11–13]. To determine whether the inflammatory cytokines mRNA expression was influenced by baicalein, RT-PCR was carried out to measure the mRNA levels of TNF-α and IL-1β (Fig. 4). The mRNA levels of TNF-α and IL-1β were increased in the LPS group, whereas administration of baicalein significantly reduced the LPS-induced TNF-α and IL-1β mRNA expressions in a dose-dependent manner.
3.4. Effect of baicalein on LPS-induced NF-κB and MAPK activation Injection of LPS obviously increased the levels of p65 and IκBα phosphorylation in the NF-κB signal pathway and the levels of p38, ERK and JNK phosphorylation in the MAPK signal pathway. On the contrary, pretreatment with baicalein inhibited the up-regulation of phosphorylation of p65 and IκBα, and p38, ERK and JNK as compared with the LPS group (Figs. 5 and 6).
3.5. Effect of baicalein on NF-κB binding activity EMSA analyses showed that LPS groups had increased NF-κB binding activity. However, pretreatment with baicalein reduced NF-κB binding activity (Fig. 7).
Fig. 5. Western blot analysis in mammary tissues derived from LPS-induced mice. Baicalein inhibited LPS-induced activation of NF-κB.
474
X. He et al. / International Immunopharmacology 28 (2015) 470–476
Fig. 6. Western blot analysis in mammary tissues derived from LPS-induced mice. Baicalein inhibits phosphorylation of MAPK p38, ERK, and JNK.
3.6. Effect of baicalein on the activity of TLR4 The expression of TLR4 will directly affect the downstream NF-κB and MAPK activation in LPS-induced mouse mastitis. Western blot was carried out to measure the activity of TLR4. The results showed that baicalein dose-dependently down-regulated the expression of TLR4 up-regulated by LPS (Fig. 8).
4. Discussion Bovine mastitis can be caused by many bacterial pathogens entering the mammary gland via the teat canal when the teat sphincter is relaxed following milking or suckling [14]. It is a complex infection and inflammation of the mammary gland, and the inflammatory process is a multiple and complex interactions between host and pathogens [15]. Because of high costs, a long gestation period and an uncertain health status, bovine mastitis research is limited. For these reasons, the mouse model of LPS-induced mastitis is used for the research of bovine intramammary infections. We were committed to the screening of drugs to treat mastitis for a long time. We have detected the effects of multiple drugs on LPSinduced mastitis in mice in our previous studies, such as bergenin, curcumin, cyaniding-3-β-glucoside, baicalein and salidroside etc. Meanwhile, baicalein emerged the better effect than baicalein, but worse than
that of curcumin and salidroside on LPS-induced mouse mastitis by comparison. After injection with LPS, we found that large numbers of inflammatory cell infiltration were present in thickened mammary alveolus compared with the control group. However, treatment with baicalein reduced the histopathologic changes induced by LPS. MPO activity, a marker of neutrophil influx into tissue, is directly proportional to the number of neutrophils in the tissue [16]. The MPO activity was significantly increased after LPS injection. In this study, baicalein obviously decreased the MPO activity induced by LPS, which is related to the reduction of neutrophils and macrophages infiltration into the mammary tissues. Inflammatory responses was regulated by cytokines during infection, which is a multiple and complex process [17]. Cytokines, such as TNF-α and IL-1β, the signal of various kinds of interaction between cells, play important roles in the process of host defense and infection and inflammation pathological development [18]. The pro-inflammatory cytokines have been reported in bovine mastitis such as TNF-α and IL-1β [19]. TNFα is the earliest and primary endogenous mediator and has been shown to play crucial roles in both inflammatory and neuropathic hyperalgesia [20]. TNF-α can elicit infiltration and activation of neutrophils, impair vascular endothelial cells, enhance cellular adhesion molecules. IL-1β, a subtype of IL-1, is a pro-inflammatory cytokine released by monocytes, macrophages, and endothelial cells during the inflammatory response and has been demonstrated to have the ability to stimulate the
X. He et al. / International Immunopharmacology 28 (2015) 470–476
Fig. 7. Effects of baicalein on NF-κB-binding activity. Binding activity of NF-κB was examined in nuclear proteins from the mammary tissue by EMSA.
475
production of several secondary cytokines [21]. In the current study, the concentrations of TNF-α and IL-1β were significantly increased in the LPS group compared with the control group. However, pretreatment with baicalein inhibited the expression of TNF-α and IL-1β in a dosedependent manner in LPS-induced mouse mastitis. These results indicated that baicalein reduced inflammatory responses via inhibiting the release of the pro-inflammatory cytokines TNF-α and IL-1β. NF-κB is a multi-subunit nuclear transcription factor rapidly activating the transcription of various cytokines and chemokines [22]. It is a prevalent heterodimeric transcription factor and exists in an inactive form in the cytoplasm bound to the inhibitory IκB proteins [23]. The expression of many inflammation-related genes is controlled through the NF-κB signaling pathway [24]. To further explore the potential molecular mechanism of baicalein suppressing the production of proinflammatory cytokines, we examined the activation of NF-κB p65 subunit and IκBα in the NF-κB signaling pathway. Our data showed that the phosphorylation of IκBα and NF-κB protein were increased by LPS, but baicalein inhibited NF-κB activation and IκBα degradation. Therefore, these results demonstrated that anti-inflammatory effect of baicalein correlated with the inhibition of NF-κB activation. We also examined the activation of p38, ERK and JNK in the MAPK signal pathway which play a key role during inflammatory responses [25]. Our results showed that baicalein significantly inhibited the phosphorylation of p38, ERK and JNK by LPS-induced mouse mastitis. From the above, the results in our study confirmed that baicalein could exert the anti-inflammatory effect against LPS-induced mice mastitis through inhibiting the activation of NF-κB and MAPK signal pathways. TLR4, one of the best characterized TLRs, is a pattern recognition receptor for LPS [26]. TLR4 initiates the MyD88 activation of the downstream NF-κB and MAPK signaling pathways [27]. We investigated how did to baicalein exert the anti-inflammatory activity through TLR4-mediated signaling. The Western blot results show that baicalein significantly inhibited the activity of TLR4 by LPS-induced mouse mastitis, which demonstrates that the downstream NF-κB and MAPK signaling pathways were suppressed (Fig. 9).
Fig. 8. Baicalein inhibited LPS-induced activation of TLR4 and MyD88 expression with Western blotting.
476
X. He et al. / International Immunopharmacology 28 (2015) 470–476
[6]
[7] [8]
[9] [10]
[11]
[12]
[13]
[14]
[15] [16]
Fig. 9. Anti-inflammatory mechanism of baicalein is associated with suppressing the TLR4mediated NF-B and MAPK signaling pathways induced by LPS.
Bergenin and salidroside attenuates inflammatory responses by suppressing NF-κB and MAPK signaling pathways [28,29]. Curcumin attenuates inflammatory responses by suppressing TLR4 signaling pathways [30]. Cyaniding-3-O-β-glucoside inhibits inflammatory responses by regulating liver X receptor (LXR) [13]. Baicalein inhibits inflammatory responses by reductions in TLR2 signaling pathways [31]. In this study, our results showed that baicalein attenuates inflammatory responses by suppressing TLR4 signaling pathways in LPS-induced mastitis in mice. In conclusion, the present study demonstrated that baicalein has anti-inflammatory effects on LPS-induced mouse mastitis may be related to inhibition of TLR4 expression, which subsequently decrease the mRNA levels of pro-inflammatory cytokines and suppress NF-κB and MAPK signal pathways. These findings provide new insights in understanding the complex actions of baicalein in immune response and suggest that baicalein may be a potential agent for prophylaxis of mastitis.
[17]
[18]
[19] [20]
[21] [22] [23]
[24]
[25]
Acknowledgments
[26]
This study was supported by the China Postdoctoral Science Foundation (2013M540255).
[27] [28]
References [1] K.R. Petrovski, M. Trajcev, G. Buneski, A review of the factors affecting the costs of bovine mastitis, J. S. Afr. Vet. Assoc. 77 (2006) 52–60. [2] M. Geiszt, J. Witta, J. Baffi, K. Lekstrom, T.L. Leto, Dual oxidases represent novel hydrogen peroxide sources supporting mucosal surface host defense, FASEB J. 17 (2003) 1502–1504. [3] C. Viguier, S. Arora, N. Gilmartin, K. Welbeck, R. O'Kennedy, Mastitis detection: current trends and future perspectives, Trends Biotechnol. 27 (2009) 486–493. [4] B.E. Gillespie, H. Moorehead, P. Lunn, H.H. Dowlen, D.L. Johnson, K.C. Lamar, et al., Efficacy of extended pirlimycin hydrochloride therapy for treatment of environmental Streptococcus spp. and Staphylococcus aureus intramammary infections in lactating dairy cows, Vet. Ther. 3 (2002) 373–380. [5] S. Schmitz, M.W. Pfaffl, H.H.D. Meyer, R.M. Bruckmaier, Short-term changes of mRNA expression of various inflammatory factors and milk proteins in
[29]
[30]
[31]
mammary tissue during LPS-induced mastitis, Domest. Anim. Endocrinol. 26 (2004) 111–126. S. Elazar, E. Gonen, A. Livneh-Kol, I. Rosenshine, N.Y. Shpigel, Essential role of neutrophils but not mammary alveolar macrophages in a murine model of acute Escherichia coli mastitis, Vet. Res. 41 (2010). S. Notebaert, E. Meyer, Mouse models to study the pathogenesis and control of bovine mastitis. A review, Vet. Q. 28 (2006) 2–13. S. De Schepper, A. De Ketelaere, D.D. Bannerman, M.J. Paape, L. Peelman, C. Burvenich, The toll-like receptor-4 (TLR-4) pathway and its possible role in the pathogenesis of Escherichia coli mastitis in dairy cattle, Vet. Res. 39 (2008). P.A. Baeuerle, V.R. Baichwal, NF-kappa B as a frequent target for immunosuppressive and anti-inflammatory molecules, Adv. Immunol. 65 (1997) 111–137. S. Bhattarai, R.G. Alany, C.R. Bunt, H. Abdelkader, M.J. Rathbone, Design and characterisation of a polyethylene oxide matrix with the potential use as a teat insert for prevention/treatment of bovine mastitis, AAPS J. 17 (2015) 167–174. J. Wu, H. Suzuki, A.A. Akhand, Y.W. Zhou, K. Hossain, I. Nakashima, Modes of activation of mitogen-activated protein kinases and their roles in cepharanthine-induced apoptosis in human leukemia cells, Cell. Signal. 14 (2002) 509–515. J. Zheng, A.D. Watson, D.E. Kerr, Genome-wide expression analysis of lipopolysaccharide-induced mastitis in a mouse model, Infect. Immun. 74 (2006) 1907–1915. Y. Fu, Z. Wei, E. Zhou, N. Zhang, Z. Yang, Cyanidin-3-O-beta-glucoside inhibits lipopolysaccharide-induced inflammatory response in mouse mastitis model, J. Lipid Res. 55 (2014) 1111–1119. D.E. Morin, G.C. Petersen, H.L. Whitmore, L.L. Hungerford, R.A. Hinton, Economic analysis of a mastitis monitoring and control program in four dairy herds, J. Am. Vet. Med. Assoc. 202 (1993) 540–548. A. Bradley, Bovine mastitis: an evolving disease, Vet. J. 164 (2002) 116–128. J.E. Krawisz, P. Sharon, W.F. Stenson, Quantitative assay for acute intestinal inflammation based on myeloperoxidase activity. Assessment of inflammation in rat and hamster models, Gastroenterology 87 (1984) 1344–1350. J.W. Lee, D.D. Bannerman, M.J. Paape, M.K. Huang, X. Zhao, Characterization of cytokine expression in milk somatic cells during intramammary infections with Escherichia coli or Staphylococcus aureus by real-time PCR, Vet. Res. 37 (2006) 219–229. N. Boudjellab, H.S. Chan-Tang, X. Zhao, Bovine interleukin-1 expression by cultured mammary epithelial cells (MAC-T) and its involvement in the release of MAC-T derived interleukin-8, Comp. Biochem. Physiol. A Mol. Integr. Physiol. 127 (2000) 191–199. P. Rainard, C. Riollet, Innate immunity of the bovine mammary gland, Vet. Res. 37 (2006) 369–400. M.K. Connolly, A.S. Bedrosian, J.M.S. Clair, A.P. Mitchell, J. Ibrahim, A. Stroud, et al., In liver fibrosis, dendritic cells govern hepatic inflammation in mice via TNF-alpha, J. Clin. Investig. 119 (2009) 3213–3225. J.W. Christman, R.T. Sadikot, T.S. Blackwell, The role of nuclear factor-kappa B in pulmonary diseases, Chest 117 (2000) 1482–1487. S. Vallabhapurapu, M. Karin, Regulation and function of NF-kappaB transcription factors in the immune system, Annu. Rev. Immunol. 27 (2009) 693–733. A. Rai, S. Kapoor, S. Singh, B.P. Chatterji, D. Panda, Transcription factor NF-kappaB associates with microtubules and stimulates apoptosis in response to suppression of microtubule dynamics in MCF-7 cells, Biochem. Pharmacol. 93 (2015) 277–289. K. Heyninck, M. Lahtela-Kakkonen, P. Van der Veken, G. Haegeman, W. Vanden Berghe, Withaferin A inhibits NF-kappaB activation by targeting cysteine 179 in IKKbeta, Biochem. Pharmacol. 91 (2014) 501–509. S.D. Kim, Y.J. Lee, J.S. Baik, J.Y. Han, C.G. Lee, K. Heo, et al., Baicalein inhibits agonistand tumor cell-induced platelet aggregation while suppressing pulmonary tumor metastasis via cAMP-mediated VASP phosphorylation along with impaired MAPKs and PI3K-Akt activation, Biochem. Pharmacol. 92 (2014) 251–265. T. Shuto, K. Kato, Y. Mori, S. Viriyakosol, M. Oba, T. Furuta, et al., Membraneanchored CD14 is required for LPS-induced TLR4 endocytosis in TLR4/MD-2/CD14 overexpressing CHO cells, Biochem. Biophys. Res. Commun. 338 (2005) 1402–1409. Y.C. Lu, W.C. Yeh, P.S. Ohashi, LPS/TLR4 signal transduction pathway, Cytokine 42 (2008) 145–151. X.J. Gao, M.Y. Guo, Z.C. Zhang, T.C. Wang, Y.G. Cao, N.S. Zhang, Bergenin plays an anti-inflammatory role via the modulation of MAPK and NF-kappaB signaling pathways in a mouse model of LPS-induced mastitis, Inflammation 38 (2015) 1142–1150. D.P. Li, Y.H. Fu, W. Zhang, G.L. Su, B. Liu, M.Y. Guo, et al., Salidroside attenuates inflammatory responses by suppressing nuclear factor-kappa B and mitogen activated protein kinases activation in lipopolysaccharide-induced mastitis in mice, Inflamm. Res. 62 (2013) 9–15. Y. Fu, R. Gao, Y. Cao, M. Guo, Z. Wei, E. Zhou, et al., Curcumin attenuates inflammatory responses by suppressing TLR4-mediated NF-kappaB signaling pathway in lipopolysaccharide-induced mastitis in mice, Int. Immunopharmacol. 20 (2014) 54–58. M.Y. Guo, Y.G. Cao, T.C. Wang, X.J. Song, Z.C. Liu, E.S. Zhou, et al., Baicalin inhibits Staphylococcus aureus-induced apoptosis by regulating TLR2 and TLR2-related apoptotic factors in the mouse mammary glands, Eur. J. Pharmacol. 723 (2014) 481–488.