- Email: [email protected]
PGC-1α pathway
Phytomedicine 64 (2019) 153074
Contents lists available at ScienceDirect
Phytomedicine journal homepage: www.elsevier.com/locate/phymed
Original Article
Baicalin ameliorates hepatic insulin resistance and gluconeogenic activity through inhibition of p38 MAPK/PGC-1α pathway ⁎
Penghua Fanga,d, Yabin Suna, Xinru Gua, Mingyi Shid, Ping Bod, Zhenwen Zhangb, , Le Buc,
T
⁎
a
Department of Physiology, Nanjing University of Chinese Medicine Hanlin College, Taizhou, Jiangsu, 225300, China Department of Endocrinology, Clinical Medical College, Yangzhou University, Yangzhou, Jiangsu, 225001, China c Department of Endocrinology, Shanghai Tenth People's Hospital, Tongji University, Shanghai, 200072, China d Jiangsu Key Laboratory of Integrated Traditional Chinese and Western Medicine for Prevention and Treatment of Senile Diseases, Medical College, Yangzhou University, Yangzhou, 225001, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Baicalin PGC-1α Hyperglycemia p38 MAPK Gluconeogenesis
Background: Although the results of our and other studies show that baicalin can enhance glucose uptake and insulin sensitivity in skeletal muscle and adipocytes of mice, the specific metabolic contribution of baicalin on hepatic insulin resistance and gluconeogenic activity is still unclear. Purpose: The aim of this study is to investigate whether baicalin is involved in regulation of hepatic insulin resistance and gluconeogenic activity and its underlying mechanisms. Study Design/Methods: In the present study, high-fat diet-induced obese mice were given 50 mg/kg baicalin intraperitoneally (i.p.) once a day for 21 consecutive days, and hepatocytes were treated with baicalin (100 μM) or metformin (100 μM) in the presence of glucagon (200 nM) for 12 h. Then insulin resistance indexes and genes related to gluconeogenesis were examined in liver tissues. Results: The present findings showed that baicalin decreased body weight, HOMA-IR, and alleviated high fat diet-induced glucose intolerance, hyperglycemia and insulin resistance in diet-induced obese mice. Furthermore, baicalin markedly suppressed p-p38 MAPK, p-CREB, FoxO1, PGC-1α, PEPCK and G6Pase expression in liver of obese mice and hepatocytes. Moreover, inhibition of gluconeogenic genes by baicalin was also strengthened by p38MAPK inhibitor in hepatocytes. Conclusion: Baicalin suppressed expression of PGC-1α and gluconeogenic genes, and reduced glucose production in high-fat diet-induced obese mice. Baicalin ameliorated hepatic insulin resistance and gluconeogenic activity mainly through inhibition of p38 MAPK/PGC-1α signal pathway. This study provides a possibility of using baicalin to treat hyperglycemia and hepatic insulin resistance in clinic.
Introduction
impaired glucose tolerance (IGT) (Cho et al., 2018). The proportion of patients with type 2 diabetes mellitus to total diabetic patients is 90% (Xu et al., 2013; Wang et al., 2017a). Maintaining blood glucose within a narrow range is an important objective in the treatment of type 2 diabetes mellitus, as this remarkably reduces the risk of developing type 2 diabetes-associated complications. Current strategies for treatment of hyperglycemia and insulin resistance are inadequately effective, and frequently companied with undesirable side effects. Therefore, new
The prevalence of diabetes is rapidly increasing worldwide and becomes an important health problem with its high morbidity and mortality (Wang et al., 2017a). Epidemiological investigation demonstrated that there were 451 million people with diabetes in the world and expected to rise to 693 million by 2045 (Cho et al., 2018; Zheng et al., 2018). Moreover, there was an estimated 374 million people with
Abbreviations: AMPK, adenosine 5′-monophosphate (AMP)-activated protein kinase; CPT1a, carnitine palmitoyltransferase 1a; CREB, cAMP-response element binding protein; DMSO, dimethyl sulfoxide; DMEM, Dulbecco's modified eagle medium; FAS, fatty acid synthase; FBS, fetal bovine serum; FoxO1, forkhead box O 1; GLUT2, glucose transporter 2; G6Pase, glucose-6-phosphatase; HFD, high fat diet; i.p., intraperitoneal; IGT, impaired glucose tolerance; PPARγ, peroxisome proliferator-activated receptor gamma; PGC-1α, peroxisome proliferator-activated receptor gamma coactivator 1 alpha; PEPCK, phosphenolpyruvate carboxykinase; PPARα, peroxisome proliferator-activated receptor alpha; p38 MAPK, p38 mitogen-activated protein kinases; SREBP-1c, sterol regulatory element binding protein-1c; STAT3, signal transducers transcription 3 ⁎ Corresponding authors: Department of Endocrinology, Clinical Medical College, Yangzhou University, Yangzhou 225001, China. E-mail addresses: [email protected] (Z. Zhang), [email protected] (L. Bu). https://doi.org/10.1016/j.phymed.2019.153074 Received 18 November 2018; Received in revised form 18 August 2019; Accepted 22 August 2019 0944-7113/ © 2019 Elsevier GmbH. All rights reserved.
Phytomedicine 64 (2019) 153074
P. Fang, et al.
Fig. 1. The i.p. administration of baicalin decreased the body weight, food intake, HOMA-IR index, circulating glucose levels and glucose intolerance during the glucose tolerance test of high fat diet-induced obese mice (n = 6). (A) The body weight at 21 days was significantly decreased in the baicalin group compared with the obese controls. (B) The food intake of mice was significantly decreased in the baicalin group compared with the obese controls in the first, second and third week, respectively. (C) The blood glucose level was decreased in the baicalin group compared with the obese controls. (D) The blood insulin level was decreased in the baicalin group compared with the obese controls. (E) HOMA-IR index. HOMA-IR index of mice was significantly decreased in the baicalin group compared with obese controls. (F) Glucose tolerance tests. During the glucose tolerance test, the circulating glucose levels were markedly decreased at 0 min, 60 min and 120 min in the baicalin group compared with obese controls. (G) The areas of glucose tolerance tests. The areas of glucose tolerance were significantly decreased in the baicalin group compared with the obese controls. NC, normal diet control group; OC, obese control group; Baicalin, obese group with baicalin. All data shown are the means ± SEM. *p < 0.05 &**p < 0.01 vs. OC; #p < 0.05&##p < 0.01 vs. NC.
and glucose-6-phosphatase (G6Pase), thereby enhancing hepatic glucose production (Puigserver et al., 2003; Rhee et al., 2003; Schilling et al., 2006; O-Sullivan et al., 2015). Baicalin is one of the foremost abundant polyphenolic extracts from Scutellaria baicalensis (de Oliveira et al., 2015; Xi et al., 2015; Li and Chen, 2005). The compelling evidence supported that baicalin could improve the lipid metabolism of high-fat diet-induced steatosis hepatis and non-alcoholic fatty liver disease via regulating the expression of sterol regulatory element binding protein-1c (SREBP-1c), PPARγ, fatty acid synthase (FAS), PPARα, CPT1a as well as inflammatory and oxidative stress genes (Chen et al., 2018; Dai et al., 2018; Zhang et al., 2018; Zhao et al., 2016; Zhong and Liu, 2018; Guo et al., 2009). Additionally, baicalin reduced the hepatic glucose production which might be associated with suppressing the expression of the key gluconeogenic genes, including STAT3, G6Pase, PEPCK and GLUT2 (Wang et al., 2017b; Xu et al., 2018), suggesting that its effect is partially mediated by activation of the AMPK/STAT3 signaling pathway (Wang et al., 2017b; Xu et al., 2018). Although the results of our and other studies show that baicalin can enhance glucose uptake in skeletal muscle and adipocytes of mice (Fang et al., 2017, 2018a, 2018b), the specific metabolic contribution of baicalin on hepatic insulin resistance and gluconeogenic activity has not been sufficiently explored. Therefore, the aim of this study is to
therapeutic ways to reduce hyperglycemia and insulin resistance are urgently needed. It is established that an imbalance in increased glucose production from liver and reduced glucose uptake in peripheral tissues contributes hyperglycemia that is a major factor in developing type 2 diabetes mellitus (Rines et al., 2016; Sharabi et al., 2017). Hence, suppression of hepatic gluconeogenesis and improvement of insulin sensitivity to increase glucose uptake into tissues are two main ways aimed at recovering normal blood glucose levels to treat type 2 diabetes (Moore et al., 2012). Of them, reducing hepatic glucose production by inhibiting components within the gluconeogenic pathway is a feasible strategy to reduce hyperglycemia in type 2 diabetes mellitus. Peroxisome proliferator-activated receptor gamma (PPARγ) coactivator 1 alpha (PGC-1α) was identified in brown adipose tissue as a coldinducible coactivator of PPARγ in 1998 (Puigserver et al., 1998, 1999; Wu et al., 1999). In the fasting state, hepatic PGC-1α expression is induced by glucagon and further increased by the synergistic effects of glucagon with glucocorticoids via a CREB response element in its promoter (Altarejos and Montminy, 2011; Yoon et al., 2001; Herzig et al., 2001; Rodgers et al., 2005). In combination with CREB, PGC-1α facilitates gluconeogenesis in the liver by binding to the nuclear hormone receptors forkhead box O (FoxO) 1 to induce expression of key gluconeogenic enzymes such as phosphenolpyruvate carboxykinase (PEPCK) 2
Phytomedicine 64 (2019) 153074
P. Fang, et al.
Fig. 2. The i.p. administration of baicalin suppressed the expression of gluconeogenic gene in liver (n = 6). (A) PEPCK mRNA expression of liver. The PEPCK mRNA expression level was decreased in the liver of the baicalin group compared with the obese controls. (B) G6Pase mRNA expression of liver. The G6Pase mRNA expression level was decreased in the liver of the baicalin group compared with the obese controls. (C) PGC1α mRNA expression of liver. The PGC-1α mRNA expression level was decreased in the liver of the baicalin group compared with the obese controls. (D) FoxO1 mRNA expression of liver. The FoxO1 mRNA expression level was decreased in the liver of the baicalin group compared with the obese controls. NC, normal diet control group; OC, obese control group; Baicalin, obese group with baicalin. All data shown are the means ± SEM. *p < 0.05; **p < 0.01.
50 mg/kg baicalin intraperitoneally (i.p.) once a day for 21 consecutive days at 6:00 a.m. (Fang et al., 2018b). All controls were given vehicle (DMSO) i.p. The food intake of all mice was measured once a week. The body weight of all mice was recorded every day. This experiment was performed with the specific acceptance of the Animal Studies Committee of Yangzhou University. After fasted for 12 h all animals were sacrificed on the second day after the glucose tolerance test. Then 1 ml blood and all liver tissues were fast collected. The liver tissues were rinsed and frozen at −80 °C. The blood samples were centrifugated at 3500 r.p.m. for 10 min to obtain the plasma which was stored at –80 °C until further analysis.
assess the regulative roles and molecular mechanisms of baicalin controlling insulin resistance and hepatic gluconeogenesis. Materials and methods Drugs and reagents Baicalin (purity of 95%, Cat. No. 572667), metformin (purity of 97%, Cat. No. D150959) and glucagon (purity ≥ 95%, Cat. No. G1774) were acquired from Sigma-Aldrich, USA. Antibodies against FoxO1 (Cat. No. 2880), p38 MAPK (Cat. No. 9212), p-p38 MAPK (Cat. No. 4511), AKT (Cat. No. 4691), p-AKT (Cat. No. 9271), AMPK (Cat. No. 5832), p-AMPK (Cat. No. 2535), CREB (Cat. No. 9197) and p-CREB (Cat. No. 9198) were acquired from Cell Signaling Technology Inc, USA. Antibody against PGC-1α (Cat. No. ST-1202) was purchased from Merck Millipore Inc, Germany. Antibodies against α-tubulin (Cat. No. 11224-1-AP), PEPCK (Cat. No. 16754-1-AP) and G6Pase (Cat. No. 22169-1-AP) were acquired from Proteinteck Inc, China. Antibody against glyceraldehyde-phosphate dehydrogenase (GAPDH) (Cat. No. BA2913) was purchased from BOSTER Inc., China. P38MAPK inhibitior (2-(4-Chlorophenyl)-4-(4-fluorophenyl)-5-pyridin-4-yl-1,2-dihydropyrazol-3-one, Cat. No. 219138-24-6) was purchased from Merck Millipore Inc., Germany. Insulin ELISA kits (Cat. No.CEA448Mu) was purchased from Uscn Life Science, Inc. Wuhan, China. RIPA (Cat. No.PP1901) was purchased from Bioteke Corporation, Beijing, China.
Glucose tolerance test After fasted for 12 h, 1.5 g/kg glucose dissolved in sterile water was i.p. injected into the mice after an overnight fast (12 h). The blood glucose levels in the tail vein blood were monitored at 0, 15, 30, 60 and 120 min after the glucose challenge using a Glucometer. The areas under the curve (AUC) were calculated. Fasting insulin challenge using competitive insulin ELISA kits according to the manufacturer's specification. The assay range for insulin was 123.5–10,000 pg/ml, and intraassay precision CV% < 10% and inter-assay precision CV% < 12%. The homeostasis model of insulin resistance (HOMA-IR) was calculated by fasting serum insulin concentration (mU/ml) × fasting blood glucose level (mmol/l)/22.5. All measurements were performed in duplicate and the mean of two measurements was considered.
Animals Cell culture Six-week-old male C57BL/6J mice were kept in a standard laboratory condition of temperature 21 ± 2 °C, relative humidity 50 ± 15%, 12 h light-dark cycles, with water and food available ad libitum. All mice used were closely monitored to ensure that none lived under stress and discomfort. The mice were fed a high fat diet (20% carbohydrates, 21% protein and 59% fat) for 16 weeks. Then the obese mice were divided into two groups: obese control group (n = 6) and obese group with baicalin (n = 6). Besides, a normal diet group (n = 6) was set up. The mice in the obese group with baicalin were given
Primary hepatocytes were isolated from the livers of 10–12 weeks male C57BL/6 mice using the collagenase perfusion method. Briefly, after the tissues were digested by a perfusion of collagenase type IV solution, the liver was dissected, minced and filtered by 70 μm mesh filtration. The mixture was centrifuged at 50 g for 2 min to collect hepatocytes (the pellet). The resuspended hepatocytes were seeded on plates in DMEM supplemented with 10% FBS, 1% penicillin/streptomycin at 37 °C in a humidified atmosphere included 5% CO2. When 3
Phytomedicine 64 (2019) 153074
P. Fang, et al.
Fig. 3. The i.p. administration of baicalin decreased the levels of gluconeogenic protein in liver (n = 6). (A) The PEPCK contents in the liver. The PEPCK protein level was decreased in the liver of the baicalin group compared with the obese controls. (B) The G6Pase contents in the liver. The G6Pase protein level was decreased in the liver of the baicalin group compared with the obese controls. (C) The PGC-1α contents in the liver. The PGC-1α protein level was decreased in the liver of the baicalin group compared with the obese controls. (D) The FoxO1 contents in the liver. The FoxO1 protein level was decreased in the liver of the baicalin group compared with the obese controls. (E) The representative Western blot lines of PGC-1α, FoxO1, PEPCK and G6Pase in the liver. GAPDH was used as the loading control. NC, normal diet control group; OC, obese control group; Baicalin, obese group with baicalin. All data shown are the means ± SEM. *p < 0.05; **p < 0.01.
denaturation at 95 °C for 10 min; 95 °C for 15 s, 62 °C for 60 s, 40 cycles. The 2−ΔCT × 100% method was used to analyze the PCR data.
glucagon stimulation was performed, the medium was changed to starvation medium (DMEM, 0.2% BSA, and 1% penicillin/streptomycin). The primary hepatocytes were treated with baicalin (100 μM) or metformin (100 μM) in the presence of glucagon (200 nM) for 12 h. For p38MAPK inhibition experiment, cells were pretreated with inhibitor (10 μM) for 30 min prior to stimulation with baicalin.
Western blot analysis Total proteins of liver or hepatocytes were extracted using RIPA agents and quantified with BCA protein assay kit to determine protein levels. Briefly, the samples were separated by a 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a polyvinylidene difluoride filter membranes. Membranes were blocked in Tris-buffered saline (pH 7.5) containing 0.05% Tween-20 (1 × TBST) and 5% skimmed milk for 2 h, then probed overnight at 4 °C with an antibody against AMPK, p-AMPK, CREB, p-CREB, α-Tubulin, p38 MAPK, AKT, PEPCK, G6Pase, FoxO1, p-p38 MAPK, p-AKT, GAPDH and PGC-1α, respectively. Membranes were washed with 1 × TBST for 10 min and incubated for 2 h with horseradish peroxidase-conjugated secondary antibody. Lastly, immunoreactive bands were visualized by chemiluminescence and quantified by densitometry using a Quantity One Analysis Software (Bio-Rad).
Quantitative real-time PCR analysis Total RNA was extracted with Trizol from 100 mg frozen liver tissues. cDNA was synthesized from 1 μg RNA using MMLV reverse transcriptase. Real-time quantitative PCR was performed for gene expression levels using real-time fluorescent detection in an Applied Biosystems 7500 real-time PCR instrument (ABI 7500, USA). The oligonucleotide primers were as follows: PGC-1α Forward Sequence5’ACCATGACTACTGTCAGTCACTC-3′, Reverse Sequence5’-GTCACAGGA GGCATCTTTGAAG-3′; G6Pase Forward Sequence 5′- GATTGCTGACCTGAGGAACG-3′, Reverse Sequence 5′- ATAGTATACACCTGCTGCGCC-3′; PEPCK Forward Sequence 5′- GCATAACGGTCTGGACTTCT-3′, Reverse Sequence 5′- TGATGACTGTCTTGCTTTCG-3′; FoxO1 Forward Sequence5’-CAAAGTACACATACGGCCAATCC-3′, Reverse Sequence5’CGTAACTTGATTTGCTGTCCTGAA-3′; GAPDH Forward Sequence 5′AGAACATCATCCCTGCATCC −3′, Reverse Sequence5’- TCCACCACCC TGTTGCTGTA −3′. Amplification condition was: an initial
Statistical analysis SPSS 17.0 for Windows was used for statistical analysis. Data were presented as mean ± SEM with p < 0.05 as the limit for statistical significance. Comparisons between the means of groups were analyzed 4
Phytomedicine 64 (2019) 153074
P. Fang, et al.
the obese controls, but elevated by 65.1% (p < 0.01) and 38.7% (p < 0.01) in the obese control group compared with the normal controls (Fig. 1C and D). As shown in Fig. 1E, HOMA-IR index of mice was significantly decreased by 23.1% (p < 0.01) in the baicalin group compared with obese controls, but increased by 129.1% (p < 0.01) in the obese control group compared with normal controls. During the glucose tolerance test, as shown in Fig. 1F, the circulating glucose levels were markedly decreased by 10.9%, 17.6% and 24.7% at 0 min (p < 0.05), 60 min (p < 0.05) and 120 min (p < 0.05) in the baicalin group compared with obese controls, but increased by 38.7%, 19.2% and 74.6% at 0 min (p < 0.01), 60 min (p < 0.05) and 120 min (p < 0.01) in the obese control group compared with normal controls, respectively. As shown in Fig. 1G, the areas of glucose tolerance were significantly decreased by 15.1% (p < 0.05) in the baicalin group compared with the obese controls, but increased by 28.8% (p < 0.01) in the obese control group compared with normal controls. Baicalin suppresses the expression of gluconeogenic gene in liver As shown in Fig. 2A–D, the PEPCK mRNA, G6Pase mRNA, PGC-1α mRNA and FoxO1 mRNA expression levels were decreased by 63.6% (p < 0.01), 68.1% (p < 0.01), 82.1% (p < 0.01) and 46.1% (p < 0.05) in the liver of the baicalin group compared with the obese controls, but elevated by 163.4% (p < 0.01), 209.4% (p < 0.01), 692.1% (p < 0.01) and 317.9% (p < 0.01) in the obese control group compared with the normal controls, respectively. Besides, as shown in Fig. 3A–E, the PEPCK, G6Pase, PGC-1α and FoxO1 protein levels were decreased by 38.1% (p < 0.01), 32.4% (p < 0.05), 35.8% (p < 0.01) and 34.7% (p < 0.01) in the liver of the baicalin group compared with the obese controls, but elevated by 34.1% (p < 0.01), 79.3% (p < 0.01), 59.8% (p < 0.01) and 69.6% (p < 0.01) in the obese control group compared with the normal controls (Fig. 3A and E), respectively. In vitro, as shown in Fig. 4A-B, the levels of PEPCK, G6Pase and PGC-1α protein in the hepatocytes were decreased by 66.8% (p < 0.01), 55.7% (p < 0.01) and 45.1% (p < 0.01) in baicalin group compared with glucagon controls, but increased by 58.7% (p < 0.01), 51.5% (p < 0.01) and 51.6% (p < 0.01) in the glucagon control group compared with the normal controls (Fig. 4A and B), respectively. Besides, after treatment with metformin in hepatocytes, the levels of PEPCK, G6Pase and PGC-1α protein were significantly reduced by 34.5% (p < 0.01), 21.9% (p < 0.05) and 43.7% (p < 0.01) compared with glucagon control (Fig. 4A-B).
Fig. 4. The treatment with baicalin decreased the levels of gluconeogenic protein in hepatocytes (n = 3). (A) The PGC-1α, PEPCK, G6Pase and p-p38 MAPK/p38 MAPK contents in the liver. The levels of PGC-1α, PEPCK, G6Pase and p-p38 MAPK/p38 MAPK protein were decreased in the liver of the baicalin (100 μM) or metformin (100 μM) group compared with the glucagon (200 nM) controls. (B) The representative Western blot lines of PGC-1α, PEPCK, G6Pase, p-p38 MAPK and p38 MAPK protein in hepatocytes. α-Tubulin was used as the loading control. All data shown are the means ± SEM. *p < 0.05; **p < 0.01; ns, not significant.
Regulative effects of baicalin on gluconeogenic signaling pathway
by one-way ANOVA with Duncan's tests.
As shown in Fig 5A and B, the levels of phosphorylated p38 MAPK and CREB protein were reduced by 49.6% (p < 0.01) and 37.8% (p < 0.01) in baicalin group compared with obese controls, but increased by 85.8% (p < 0.01) and 116.8% (p < 0.01) in the obese control group compared with the normal controls, respectively. However, the levels of phosphorylated AKT and AMPK protein were enhanced by 143.1% (p < 0.01) and 76.3% (p < 0.01) in baicalin group compared with obese controls, but decreased by 71.8% (p < 0.01) and 44.3% (p < 0.01) in obese control group compared with the normal controls, respectively (Fig. 5C and D). In vitro, the level of phosphorylated p38 MAPK protein was reduced by 79.5% (p < 0.01) in metformin group compared with glucagon controls, but increased by 524.6% (p < 0.01) in the glucagon control compared with the normal control (Fig. 4A and B). Moreover, the level of the phosphorylated p38 MAPK protein was significantly decreased by 48.6% (p < 0.01) in baicalin-treated hepatocytes compared with control (Fig. 4A and B). We further investigated the regulation of gluconeogenic signaling by baicalin in p38MAPK inhibitor-treated hepatocytes when cells were exposed to glucagon challenge (Fig. 6A and B). Compared with the controls, the PEPCK, G6Pase and PGC-1α protein levels in the
Results Baicalin ameliorates glucose intolerance and systemic insulin resistance All of the mice used in this experiment exhibited similar body weight and food intake at the beginning of the experiment. After feeding of the high fat diet for 12 weeks, the body weight of the mice in obese control and baicalin groups was enhanced compared with the normal diet group before the administration of baicalin (Fig. 1). As shown in Fig. 1A, the body weight at 21 days were significantly decreased by 22.6% (p < 0.01) in the baicalin group compared with the obese controls, but increased by 60.7% (p < 0.01) in the obese control group compared with the normal controls. As shown in Fig. 1B, in the first, second and third week, the food intake in the baicalin group significantly decreased by 58.0% (p < 0.01), 54.1% (p < 0.01) and 51.6% (p < 0.01) compared with the obese controls, but that in the obese control group increased by 123.6% (p < 0.01), 91.3% (p < 0.01) and 68.2% (p < 0.01) compared with the normal controls, respectively. The blood insulin and glucose levels was decreased by 13.4% (p < 0.05) and 10.9% (p < 0.05) in the baicalin group compared with 5
Phytomedicine 64 (2019) 153074
P. Fang, et al.
Fig. 5. The i.p. administration of baicalin ameliorated hepatic insulin resistance and gluconeogenic activity via the regulation of gluconeogenic signaling pathway in liver (n = 6). (A) The ratio of p-p38 MAPK/p38 MAPK in liver. The ratio of pp38 MAPK/p38 MAPK was reduced in baicalin group compared with obese controls. (B) The ratio of p-CREB/CREB in liver. The ratio of p-CREB/CREB was reduced in baicalin group compared with obese controls. (C) The ratio of p-AKT/ AKT in liver. The ratio of p-AKT/AKT was enhanced in baicalin group compared with obese controls. (D) The ratio of pAMPK/AMPK in liver. The ratio of p-AMPK/AMPK was enhanced in baicalin group compared with obese controls. (E) The representative Western blot lines of p-p38 MAPK, p38 MAPK, p-CREB, CREB, p-AKT, AKT, p-AMPK and AMPK protein in the liver. α-Tubulin was used as the loading control. NC, normal diet control group; OC, obese control group; Baicalin, obese group with baicalin. All data shown are the means ± SEM. *p < 0.05; **p < 0.01.
illustrate that baicalin possesses anti-hyperglycemic effect (Li et al., 2011; Shi et al., 2016; Xi et al., 2016; Han et al., 2011). I.p. injection of baicalin significantly reduced blood glucose levels in a dose-dependent manner in streptozotocin-nicotinamide induced diabetic rats and mice (Li et al., 2011; Shi et al., 2016). In vitro, treated with different doses of baicalin (100, 200, 400 μM) for 6 h, 12 h and 24 h significantly promoted glucose uptake in myotubes and adipocytes (Fang et al., 2017, 2018a, 2018b). Consistent with these studies, the current results showed that i.p. injection of baicalin decreased food intake, body weight and circulating glucose levels in the mice with insulin resistance, indicating that baicalin had the anti-hyperglycemic effect effects. Besides, our previous studies indicated that baicalin possessed the
hepatocytes were significantly decreased by 20.1% (p < 0.05), 38.9% (p < 0.01) and 37.2% (p < 0.01) in p38MAPK inhibitor group. The p38MAPK inhibitor strengthened the inhibitory effect of baicalin on PEPCK and PGC-1α expression (Fig. 6A and B). Compared with the baicalin group, the PEPCK, G6Pase and PGC-1α protein levels in the baicalin+p38MAPK inhibitor group were significantly decreased by 27.1% (p < 0.05), 41.8% (p < 0.01) and 34.4% (p < 0.01) in the hepatocytes (Fig. 6A and B). Discussion Numerous studies from animal models of diabetes and obesity 6
Phytomedicine 64 (2019) 153074
P. Fang, et al.
potency to ameliorate insulin resistance (Fang et al., 2017, 2018a, 2018b). Treatment with baicalin in obese mice significantly decreased the indexes of insulin resistance in obese mice. Similarly, current date showed that baicalin significantly increased the glucose clearance of insulin resistant mice. Therefore, all of these results provide evidence in support of a role for baicalin in increasing glucose uptake and insulin sensitivity. The activity of gluconeogenesis is responsible for fasting hyperglycemia in type 2 diabetes (Rines et al., 2016). Gluconeogenesis is under the control of G6Pase and PEPCK, two main rate limiting enzymes (Koo et al., 2005; Perry et al., 2014). In the present study, we found that short-term feeding with high fat diet increased G6Pase and PEPCK levels in liver, contributing to increased hepatic gluconeogenesis. These changes might be attenuated by administration of baicalin. Similarly, glucagon-mediated PEPCK and G6Pase protein levels were also attenuated by baicalin and metformin in primary hepatocytes. These results suggested that administration of baicalin reduced G6Pase and PEPCK levels to inhibit hepatic glucose production. As the members of the protein kinases, AMPK and AKT are able to suppress hepatic gluconeogenesis (Zhang et al., 2009; Li et al., 2007). Activation of AMPK and AKT inhibited the expression of the gluconeogenic genes PEPCK and G6Pase (Li et al., 2007; Zhang et al., 2009). We found that baicalin phosphorylated AMPK and AKT in the liver of obese mice, suggesting that baicalin down-regulated PEPCK and G6Pase levels in liver to play the antihyperglycemic effects via activation of AMPK and AKT signaling pathways. PGC-1α can upregulate hepatic gluconeogenic gene expression, such as PEPCK and G6Pase, and selective inhibition of PGC-1α potentially reduced hepatic glucose production and ameliorated hepatic insulin resistance (Rodgers et al., 2005; Yoon et al., 2001). Overexpression of PGC-1α increased gluconeogenic gene expression and promoted hepatic glucose release (Herzig et al., 2001; Yoon et al., 2001), whereas knockout of PGC-1α gene led to modest but significant defects in gluconeogenesis (Estall et al., 2009; Burgess et al., 2006). In the present study, our results showed that administration of baicalin reduced PGC-1α levels in the liver of diabetic mice and hepatocytes. However, an opposite effect of baicalin on PGC-1α expression was reported that administration of baicalin enhanced PGC-1α expression in
Fig. 6. The treatment with baicalin decreased the levels of gluconeogenic protein in hepatocytes after p38MAPK inhibition (n = 3). (A) The PGC-1α, PEPCK and G6Pase contents in the liver. Compared with the controls, the levels of PGC-1α, PEPCK and G6Pase protein were significantly decreased after treatment with 100 μM baicalin or 10 μM p38MAPK inhibitor (p38I). Compared with the baicalin group, the levels of PGC-1α, PEPCK and G6Pase protein were significantly decreased in the baicalin + p38I group. (B) The representative Western blot lines of PGC-1α, PEPCK and G6Pase protein in hepatocytes. αTubulin was used as the loading control. All data shown are the means ± SEM. *p < 0.05; **p < 0.01.
Fig. 7. The regulatory network of p38MAPK on gluconeogenesis and hepatic insulin resistance. Baicalin ameliorates hepatic insulin resistance and gluconeogenic activity mainly through inhibition of p38 MAPK/PGC-1α signal pathway. 7
Phytomedicine 64 (2019) 153074
P. Fang, et al.
References
muscle and adipocytes of obese mice (Fang et al., 2017, 2018a, 2018b). The dichotomous effects of baicalin on PGC-1α expression took place on tissue types. In liver, baicalin reduced PGC-1α levels to attenuate gluconeogenesis. But in muscle, baicalin enhanced PGC-1α expression to improve insulin sensitivity to increase glucose uptake. Both decrease in glucose release in liver and increase in glucose uptake in muscle resulted in decreased blood glucose levels. These suggest that baicalin plays anti-hyperglycemic effects via regulating PGC-1α expression in different tissue. The elevated p-p38 MAPK levels are observed in liver of diabetic mice (Qiao et al., 2006). p38 MAPK can increase PEPCK, G6pase, FoxO1 and PGC-1α gene expression, as well as CREB phosphorylation (Qiao et al., 2006; Wang et al., 2018; Collins et al., 2006; Jing et al., 2015; Cao et al., 2005; Gao et al., 2010; Lee et al., 2011; Ozcan et al., 2012, 2013), but inhibit the phosphorylation of AMPK and AKT (Liu et al., 2007; Jing et al., 2015; Li et al., 2007; Lin and Hardie, 2018) (See Fig. 7). The synergistic effects of p-P38 MAPK with p-CREB elevated the hepatic PGC-1α expression to increase hepatic gluconeogenesis (Cao et al., 2005; Herzig et al., 2001; Puigserver et al., 2001). In the current study, we found that treatment of baicalin reduced hepatic pp38 MAPK, PGC-1α, FoxO1and p-CREB expression in diabetic mice and primary hepatocytes. Consequently, low levels of PGC-1α and FoxO1 in liver suppressed expression of PEPCK and G6Pase, and reduced hepatic glucose production and insulin resistance. In addition, our study in the primary hepatocytes found that p38MAPK inhibitor strengthened the inhibited effects of baicalin on glucagon-mediated PEPCK, G6Pase and PGC-1α expression. These results supported our hypothesis that baicalin suppressed gluconeogenic activity via downregulation of p38MAPK/PGC-1α, at least in part. However, how baicalin inactivates p38 MAPK signaling in the liver is still unclear, and this requires further exploration.
Altarejos, J.Y., Montminy, M., 2011. CREB and the CRTC co-activators: sensors for hormonal and metabolic signals. Nat. Rev. Mol. Cell Biol. 12, 141–151. Burgess, S.C., Leone, T.C., Wende, A.R., Croce, M.A., Chen, Z., Sherry, A.D., Malloy, C.R., Finck, B.N., 2006. Diminished hepatic gluconeogenesis via defects in tricarboxylic acid cycle flux in peroxisome proliferator-activated receptor gamma coactivator1alpha (PGC-1alpha)-deficient mice. J. Biol. Chem. 281, 19000–19008. Cao, W., Collins, Q.F., Becker, T.C., Robidoux, J., Lupo Jr., E.G, Xiong, Y., Daniel, K.W., Floering, L., Collins, S., 2005. p38 Mitogen-activated protein kinase plays a stimulatory role in hepatic gluconeogenesis. J. Biol. Chem. 280, 42731–42737. Chen, Q., Liu, M., Yu, H., Li, J., Wang, S., Zhang, Y., Qiu, F., Wang, T., 2018. Scutellaria baicalensis regulates FFA metabolism to ameliorate NAFLD through the AMPKmediated SREBP signaling pathway. J. Nat. Med. 72, 655–666. Cho, N.H., Shaw, J.E., Karuranga, S., Huang, Y., da Rocha Fernandes, J.D., Ohlrogge, A.W., Malanda, B., 2018. IDF Diabetes Atlas: global estimates of diabetes prevalence for 2017 and projections for 2045. Diabetes Res. Clin. Pract. 138, 271–281. Collins, Q.F., Xiong, Y., Lupo Jr., E.G., Liu, H.Y., Cao, W., 2006. p38 Mitogen-activated protein kinase mediates free fatty acid-induced gluconeogenesis in hepatocytes. J. Biol. Chem. 281, 24336–24344. Dai, J., Liang, K., Zhao, S., Jia, W., Liu, Y., Wu, H., Lv, J., Cao, C., Chen, T., Zhuang, S., Hou, X., Zhou, S., Zhang, X., Chen, X.W., Huang, Y., Xiao, R.P., Wang, Y.L., Luo, T., Xiao, J., Wang, C., 2018. Chemoproteomics reveals baicalin activates hepatic CPT1 to ameliorate diet-induced obesity and hepatic steatosis. Proc. Natl. Acad. Sci. USA 115, E5896–E5905. de Oliveira, M.R., Nabavi, S.F., Habtemariam, S., Erdogan Orhan, I., Daglia, M., Nabavi, S.M., 2015. The effects of baicalein and baicalin on mitochondrial function and dynamics: a review. Pharmacol. Res. 100, 296–308. Estall, J.L., Kahn, M., Cooper, M.P., Fisher, F.M., Wu, M.K., Laznik, D., Qu, L., Cohen, D.E., Shulman, G.I., Spiegelman, B.M., 2009. Sensitivity of lipid metabolism and insulin signaling to genetic alterations in hepatic peroxisome proliferator-activated receptor-gamma coactivator-1alpha expression. Diabetes 58, 1499–1508. Fang, P., Yu, M., Zhang, L., Wan, D., Shi, M., Zhu, Y., Bo, P., Zhang, Z., 2017. Baicalin against obesity and insulin resistance through activation of AKT/AS160/GLUT4 pathway. Mol. Cell Endocrinol. 448, 77–86. Fang, P., Yu, M., Min, W., Han, S., Shi, M., Zhang, Z., Bo, P., 2018b. Beneficial effect of baicalin on insulin sensitivity in adipocytes of diet-induced obese mice. Diabetes Res. Clin. Pract. 139, 262–271. Fang, P., Yu, M., Min, W., Wan, D., Han, S., Shan, Y., Wang, R., Shi, M., Zhang, Z., Bo, P., 2018a. Effect of baicalin on GLUT4 expression and glucose uptake in myotubes of rats. Life Sci 196, 156–161. Gao, D., Nong, S., Huang, X., Lu, Y., Zhao, H., Lin, Y., Man, Y., Wang, S., Yang, J., Li, J., 2010. The effects of palmitate on hepatic insulin resistance are mediated by NADPH oxidase 3-derived reactive oxygen species through JNK and p38MAPK pathways. J. Biol. Chem. 285, 29965–29973. Guo, H.X., Liu, D.H., Ma, Y., Liu, J.F., Wang, Y., Du, Z.Y., Wang, X., Shen, J.K., Peng, H.L., 2009. Long-term baicalin administration ameliorates metabolic disorders and hepatic steatosis in rats given a high-fat diet. Acta Pharmacol. Sin. 30, 1505–1512. Herzig, S., Long, F., Jhala, U.S., Hedrick, S., Quinn, R., Bauer, A., Rudolph, D., Schutz, G., Yoon, C., Puigserver, P., Spiegelman, B., Montminy, M., 2001. CREB regulates hepatic gluconeogenesis through the coactivator PGC-1. Nature 413, 179–183. Jing, Y., Liu, W., Cao, H., Zhang, D., Yao, X., Zhang, S., Xia, H., Li, D., Wang, Y.C., Yan, J., Hui, L., Ying, H., 2015. Hepatic p38α regulates gluconeogenesis by suppressing AMPK. J. Hepatol. 62, 1319–1327. Koo, S.H., Flechner, L., Qi, L., Zhang, X., Screaton, R.A., Jeffries, S., Hedrick, S., Xu, W., Boussouar, F., Brindle, P., Takemori, H., Montminy, M., 2005. The CREB coactivator TORC2 is a key regulator of fasting glucose metabolism. Nature 437, 1109–1111. Lee, J., Sun, C., Zhou, Y., Lee, J., Gokalp, D., Herrema, H., Park, S.W., Davis, R.J., Ozcan, U., 2011. p38 MAPK-mediated regulation of Xbp1s is crucial for glucose homeostasis. Nat. Med. 17, 1251–1260. Li, H.B., Chen, F., 2005. Isolation and purification of baicalein, wogonin and oroxylin a from the medicinal plant scutellaria baicalensis by high-speed counter-current chromatography. J. Chromatogr. A. 1074, 107–110. Li, H.T., Wu, X.D., Davey, A.K., Wang, J., 2011. Antihyperglycemic effects of baicalin on streptozotocin-nicotinamide induced diabetic rats. Phytother. Res. 25, 189–194. Li, X., Monks, B., Ge, Q., Birnbaum, M.J., 2007. Akt/PKB regulates hepatic metabolism by directly inhibiting PGC-1alpha transcription coactivator. Nature 447, 1012–1016. Liu, H.Y., Collins, Q.F., Xiong, Y., Moukdar, F., Lupo Jr., E.G., Liu, Z., Cao, W., 2007. Prolonged treatment of primary hepatocytes with oleate induces insulin resistance through p38mitogen-activated protein kinase. J. Biol. Chem. 282, 14205–14212. Lin, S.C., Hardie, D.G., 2018. AMPK: sensing glucose as well as cellular energy status. Cell Metab 27, 299–313. Moore, M.C., Coate, K.C., Winnick, J.J., An, Z., Cherrington, A.D., 2012. Regulation of hepatic glucose uptake and storage in vivo. Adv. Nutr. 3, 286–294. O-Sullivan, I., Zhang, W., Wasserman, D.H., Liew, C.W., Liu, J., Paik, J., DePinho, R.A., Stolz, D.B., Kahn, C.R., Schwartz, M.W., Unterman, T.G., 2015. FoxO1 integrates direct and indirect effects of insulin on hepatic glucose production and glucose utilization. Nat. Commun. 6, 7079. Ozcan, L., Cristina de Souza, J., Harari, A.A., Backs, J., Olson, E.N., Tabas, I., 2013. Activation of calcium/calmodulin-dependent protein kinase II in obesity mediates suppression of hepatic insulin signaling. Cell Metab 18, 803–815. Ozcan, L., Wong, C.C., Li, G., Xu, T., Pajvani, U., Park, S.K., Wronska, A., Chen, B.X., Marks, A.R., Fukamizu, A., Backs, J., Singer, H.A., Yates, J.R., Accili, D., Tabas, I., 2012. Calcium signaling through CaMKII regulates hepatic glucose production in fasting and obesity. Cell Metab 15, 739–751.
Conclusion Taken together, baicalin displayed its antihyperglycemic characteristics through suppression of hepatic p-p38 MAPK, PGC-1α, FoxO1, p-CREB, PEPCK and G6Pase expression, suggesting baicalin ameliorated hepatic insulin resistance and gluconeogenic activity mainly through inhibition of p38 MAPK/PGC-1α signaling pathways. Thus, our study reveals a novel regulatory network of baicalin on gluconeogenesis, in which p38 MAPK signaling crosstalks with gluconeogenic signaling through downstream PGC-1α. In addition, this study provided evidence that inhibition of hepatic p38 MAPK/PGC-1α signal pathway by baicalin could be a new therapeutic approach to treat obesity and insulin resistance in clinic. CRediT authorship contribution statement Penghua Fang: Conceptualization, Methodology, Writing - original draft, Writing - review & editing. Yabin Sun: Methodology, Writing review & editing. Xinru Gu: Methodology, Writing - review & editing. Mingyi Shi: Formal analysis, Writing - review & editing. Ping Bo: Formal analysis, Writing - original draft, Writing - review & editing. Zhenwen Zhang: Conceptualization, Writing - original draft, Writing review & editing. Le Bu: Conceptualization, Writing - original draft, Writing - review & editing. Declaration of Competing Interest The authors declared no conflict of interest. Acknowledgments This work was supported by the National Natural Scientific Fund of China (no. 81673736; no.81803792) and the Natural Scientific Fund of Jiangsu(no. BK20171319) and Qing Lan Project of Jiangsu. 8
Phytomedicine 64 (2019) 153074
P. Fang, et al.
diabetes and prediabetes in China in 2013. JAMA 317, 2515–2523. Wang, T., Jiang, H., Cao, S., Chen, Q., Cui, M., Wang, Z., Li, D., Zhou, J., Wang, T., Qiu, F., Kang, N., 2017b. Baicalin and its metabolites suppresses gluconeogenesis through activation of AMPK or AKT in insulin resistant HepG-2 cells. Eur. J. Med. Chem. 141, 92–100. Wu, Z., Puigserver, P., Andersson, U., Zhang, C., Adelmant, G., Mootha, V., Troy, A., Cinti, S., Lowell, B., Scarpulla, R.C., Spiegelman, B.M., 1999. Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1. Cell 98, 115–124. Xi, Y.L., Li, H.X., Chen, C., Liu, Y.Q., Lv, H.M., Dong, S.Q., Luo, E.F., Gu, M.B., Liu, H., 2016. Baicalin attenuates high fat diet-induced insulin resistance and ectopic fat storage in skeletal muscle, through modulating the protein kinase B/Glycogen synthase kinase 3 beta pathway. Chin. J. Nat. Med. 14, 48–55. Xi, Y., Wu, M., Li, H., Dong, S., Luo, E., Gu, M., Shen, X., Jiang, Y., Liu, Y., Liu, H., 2015. Baicalin attenuates high fat diet-induced obesity and liver dysfunction: doseResponse and potential role of caMKKβ/AMPK/ACC pathway. Cell Physiol. Biochem. 35, 2349–2359. Xu, J., Li, Y., Lou, M., Xia, W., Liu, Q., Xie, G., Liu, L., Liu, B., Yang, J., Qin, M., 2018. Baicalin regulates Sirt1/STAT3 pathway and restrains excessive hepatic glucose production. Pharmacol. Res. 136, 62–73. Xu, Y., Wang, L., He, J., Bi, Y., Li, M., Wang, T., Wang, L., Jiang, Y., Dai, M., Lu, J., Xu, M., Li, Y., Hu, N., Li, J., Mi, S., Chen, C.S., Li, G., Mu, Y., Zhao, J., Kong, L., Chen, J., Lai, S., Wang, W., Zhao, W., Ning, G., 2010 China Noncommunicable Disease Surveillance Group., 2013. Prevalence and control of diabetes in Chinese adults. JAMA 310, 948–959. Yoon, J.C., Puigserver, P., Chen, G., Donovan, J., Wu, Z., Rhee, J., Adelmant, G., Stafford, J., Kahn, C.R., Granner, D.K., Newgard, C.B., Spiegelman, B.M., 2001. Control of hepatic gluconeogenesis through the transcriptional coactivator PGC-1. Nature 413, 131–138. Zhang, B.B., Zhou, G., Li, C., 2009. AMPK: an emerging drug target for diabetes and the metabolic syndrome. Cell Metab 9, 407–416. Zhang, J., Zhang, H., Deng, X., Zhang, N., Liu, B., Xin, S., Li, G., Xu, K., 2018. Baicalin attenuates non-alcoholic steatohepatitis by suppressing key regulators of lipid metabolism, inflammation and fibrosis in mice. Life Sci. 192, 46–54. Zhao, W., Liu, L., Wang, Y., Mao, T., Li, J., 2016. Effects of a combination of puerarin, baicalin and berberine on the expression of proliferator-activated receptor-γ and insulin receptor in a rat model of nonalcoholic fatty liver disease. Exp. Ther. Med. 11, 183–190. Zheng, Y., Ley, S.H., Hu, F.B., 2018. Global aetiology and epidemiology of type 2 diabetes mellitus and its complications. Nat. Rev. Endocrinol. 14, 88–98. Zhong, X., Liu, H., 2018. Baicalin attenuates diet induced nonalcoholic steatohepatitis by inhibiting inflammation and oxidative stress via suppressing JNK signaling pathways. Biomed. Pharmacother. 98, 111–117.
Puigserver, P., Rhee, J., Lin, J., Wu, Z., Yoon, J.C., Zhang, C.Y., Krauss, S., Mootha, V.K., Lowell, B.B., Spiegelman, B.M., 2001. Cytokine stimulation of energy expenditure through p38 MAP kinase activation of PPARgamma coactivator-1. Mol. Cell. 8, 971–982. Perry, R.J., Samuel, V.T., Petersen, K.F., Shulman, G.I., 2014. The role of hepatic lipids in hepatic insulin resistance and type 2 diabetes. Nature 510, 84–91. Puigserver, P., Adelmant, G., Wu, Z., Fan, M., Xu, J., O'Malley, B., Spiegelman, B.M., 1999. Activation of PPARg coactivator-1 through transcription factor docking. Science 286, 1368–1371. Puigserver, P., Wu, Z., Park, C.W., Graves, R., Wright, M., Spiegelman, B.M., 1998. A coldinducible coactivator of nuclear receptors linked to adaptive thermogenesis. Cell 92, 829–839. Puigserver, P., Rhee, J., Donovan, J., Walkey, C.J., Yoon, J.C., Oriente, F., Kitamura, Y., Altomonte, J., Dong, H., Accili, D., Spiegelman, B.M., 2003. Insulin-regulated hepatic gluconeogenesis through FOXO1-PGC-1alpha interaction. Nature 423, 550–555. Qiao, L., MacDougald, O.A., Shao, J., 2006. CCAAT/enhancer-binding protein alpha mediates induction of hepatic phosphoenolpyruvate carboxykinase by p38 mitogenactivated protein kinase. J. Biol. Chem. 281, 24390–24397. Rhee, J., Inoue, Y., Yoon, J.C., Puigserver, P., Fan, M., Gonzalez, F.J., Spiegelman, B.M., 2003. Regulation of hepatic fasting response by PPARgamma coactivator-1alpha (PGC-1): requirement for hepatocyte nuclear factor 4alpha in gluconeogenesis. Proc. Natl. Acad. Sci. USA 100, 4012–4017. Rines, A.K., Sharabi, K., Tavares, C.D., Puigserver, P., 2016. Targeting hepatic glucose metabolism in the treatment of type 2 diabetes. Nat. Rev. Drug Discov. 15, 786–804. Rodgers, J.T., Lerin, C., Haas, W., Gygi, S.P., Spiegelman, B.M., Puigserver, P., 2005. Nutrient control of glucose homeostasis through a complex of PGC-1alpha and SIRT1. Nature 434, 113–118. Schilling, M.M., Oeser, J.K., Boustead, J.N., Flemming, B.P., O'Brien, R.M., 2006. Gluconeogenesis: re-evaluating the FOXO1-PGC-1alpha connection. Nature 443, E10–E11. Sharabi, K., Lin, H., Tavares, C.D.J., Dominy, J.E., Camporez, J.P., Perry, R.J., Schilling, R., Rines, A.K., Lee, J., Hickey, M., Bennion, M., Palmer, M., Nag, P.P., Bittker, J.A., Perez, J., Jedrychowski, M.P., Ozcan, U., Gygi, S.P., Kamenecka, T.M., Shulman, G.I., Schreiber, S.L., Griffin, P.R., Puigserver, P., 2017. Selective chemical inhibition of PGC-1α gluconeogenic activity ameliorates type 2 diabetes. Cell 169, 148–160. Shi, F., Wei, Z., Zhao, Y., Xu, X., 2016. Nanostructured lipid carriers loaded with Baicalin: an efficient carrier for enhanced antidiabetic effects. Pharmacogn. Mag. 12, 198–202. Wang, Y., Yan, S., Xiao, B., Zuo, S., Zhang, Q., Chen, G., Yu, Y., Chen, D., Liu, Q., Liu, Y., Shen, Y., Yu, Y., 2018. Prostaglandin F2α facilitates hepatic glucose production through CaMKIIγ/p38/FOXO1 signaling pathway in fasting and obesity. Diabetes 67, 1748–1760. Wang, L., Gao, P., Zhang, M., Huang, Z., Zhang, D., Deng, Q., Li, Y., Zhao, Z., Qin, X., Jin, D., Zhou, M., Tang, X., Hu, Y., Wang, L., 2017a. Prevalence and ethnic pattern of
9
Contents lists available at ScienceDirect
Phytomedicine journal homepage: www.elsevier.com/locate/phymed
Original Article
Baicalin ameliorates hepatic insulin resistance and gluconeogenic activity through inhibition of p38 MAPK/PGC-1α pathway ⁎
Penghua Fanga,d, Yabin Suna, Xinru Gua, Mingyi Shid, Ping Bod, Zhenwen Zhangb, , Le Buc,
T
⁎
a
Department of Physiology, Nanjing University of Chinese Medicine Hanlin College, Taizhou, Jiangsu, 225300, China Department of Endocrinology, Clinical Medical College, Yangzhou University, Yangzhou, Jiangsu, 225001, China c Department of Endocrinology, Shanghai Tenth People's Hospital, Tongji University, Shanghai, 200072, China d Jiangsu Key Laboratory of Integrated Traditional Chinese and Western Medicine for Prevention and Treatment of Senile Diseases, Medical College, Yangzhou University, Yangzhou, 225001, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Baicalin PGC-1α Hyperglycemia p38 MAPK Gluconeogenesis
Background: Although the results of our and other studies show that baicalin can enhance glucose uptake and insulin sensitivity in skeletal muscle and adipocytes of mice, the specific metabolic contribution of baicalin on hepatic insulin resistance and gluconeogenic activity is still unclear. Purpose: The aim of this study is to investigate whether baicalin is involved in regulation of hepatic insulin resistance and gluconeogenic activity and its underlying mechanisms. Study Design/Methods: In the present study, high-fat diet-induced obese mice were given 50 mg/kg baicalin intraperitoneally (i.p.) once a day for 21 consecutive days, and hepatocytes were treated with baicalin (100 μM) or metformin (100 μM) in the presence of glucagon (200 nM) for 12 h. Then insulin resistance indexes and genes related to gluconeogenesis were examined in liver tissues. Results: The present findings showed that baicalin decreased body weight, HOMA-IR, and alleviated high fat diet-induced glucose intolerance, hyperglycemia and insulin resistance in diet-induced obese mice. Furthermore, baicalin markedly suppressed p-p38 MAPK, p-CREB, FoxO1, PGC-1α, PEPCK and G6Pase expression in liver of obese mice and hepatocytes. Moreover, inhibition of gluconeogenic genes by baicalin was also strengthened by p38MAPK inhibitor in hepatocytes. Conclusion: Baicalin suppressed expression of PGC-1α and gluconeogenic genes, and reduced glucose production in high-fat diet-induced obese mice. Baicalin ameliorated hepatic insulin resistance and gluconeogenic activity mainly through inhibition of p38 MAPK/PGC-1α signal pathway. This study provides a possibility of using baicalin to treat hyperglycemia and hepatic insulin resistance in clinic.
Introduction
impaired glucose tolerance (IGT) (Cho et al., 2018). The proportion of patients with type 2 diabetes mellitus to total diabetic patients is 90% (Xu et al., 2013; Wang et al., 2017a). Maintaining blood glucose within a narrow range is an important objective in the treatment of type 2 diabetes mellitus, as this remarkably reduces the risk of developing type 2 diabetes-associated complications. Current strategies for treatment of hyperglycemia and insulin resistance are inadequately effective, and frequently companied with undesirable side effects. Therefore, new
The prevalence of diabetes is rapidly increasing worldwide and becomes an important health problem with its high morbidity and mortality (Wang et al., 2017a). Epidemiological investigation demonstrated that there were 451 million people with diabetes in the world and expected to rise to 693 million by 2045 (Cho et al., 2018; Zheng et al., 2018). Moreover, there was an estimated 374 million people with
Abbreviations: AMPK, adenosine 5′-monophosphate (AMP)-activated protein kinase; CPT1a, carnitine palmitoyltransferase 1a; CREB, cAMP-response element binding protein; DMSO, dimethyl sulfoxide; DMEM, Dulbecco's modified eagle medium; FAS, fatty acid synthase; FBS, fetal bovine serum; FoxO1, forkhead box O 1; GLUT2, glucose transporter 2; G6Pase, glucose-6-phosphatase; HFD, high fat diet; i.p., intraperitoneal; IGT, impaired glucose tolerance; PPARγ, peroxisome proliferator-activated receptor gamma; PGC-1α, peroxisome proliferator-activated receptor gamma coactivator 1 alpha; PEPCK, phosphenolpyruvate carboxykinase; PPARα, peroxisome proliferator-activated receptor alpha; p38 MAPK, p38 mitogen-activated protein kinases; SREBP-1c, sterol regulatory element binding protein-1c; STAT3, signal transducers transcription 3 ⁎ Corresponding authors: Department of Endocrinology, Clinical Medical College, Yangzhou University, Yangzhou 225001, China. E-mail addresses: [email protected] (Z. Zhang), [email protected] (L. Bu). https://doi.org/10.1016/j.phymed.2019.153074 Received 18 November 2018; Received in revised form 18 August 2019; Accepted 22 August 2019 0944-7113/ © 2019 Elsevier GmbH. All rights reserved.
Phytomedicine 64 (2019) 153074
P. Fang, et al.
Fig. 1. The i.p. administration of baicalin decreased the body weight, food intake, HOMA-IR index, circulating glucose levels and glucose intolerance during the glucose tolerance test of high fat diet-induced obese mice (n = 6). (A) The body weight at 21 days was significantly decreased in the baicalin group compared with the obese controls. (B) The food intake of mice was significantly decreased in the baicalin group compared with the obese controls in the first, second and third week, respectively. (C) The blood glucose level was decreased in the baicalin group compared with the obese controls. (D) The blood insulin level was decreased in the baicalin group compared with the obese controls. (E) HOMA-IR index. HOMA-IR index of mice was significantly decreased in the baicalin group compared with obese controls. (F) Glucose tolerance tests. During the glucose tolerance test, the circulating glucose levels were markedly decreased at 0 min, 60 min and 120 min in the baicalin group compared with obese controls. (G) The areas of glucose tolerance tests. The areas of glucose tolerance were significantly decreased in the baicalin group compared with the obese controls. NC, normal diet control group; OC, obese control group; Baicalin, obese group with baicalin. All data shown are the means ± SEM. *p < 0.05 &**p < 0.01 vs. OC; #p < 0.05&##p < 0.01 vs. NC.
and glucose-6-phosphatase (G6Pase), thereby enhancing hepatic glucose production (Puigserver et al., 2003; Rhee et al., 2003; Schilling et al., 2006; O-Sullivan et al., 2015). Baicalin is one of the foremost abundant polyphenolic extracts from Scutellaria baicalensis (de Oliveira et al., 2015; Xi et al., 2015; Li and Chen, 2005). The compelling evidence supported that baicalin could improve the lipid metabolism of high-fat diet-induced steatosis hepatis and non-alcoholic fatty liver disease via regulating the expression of sterol regulatory element binding protein-1c (SREBP-1c), PPARγ, fatty acid synthase (FAS), PPARα, CPT1a as well as inflammatory and oxidative stress genes (Chen et al., 2018; Dai et al., 2018; Zhang et al., 2018; Zhao et al., 2016; Zhong and Liu, 2018; Guo et al., 2009). Additionally, baicalin reduced the hepatic glucose production which might be associated with suppressing the expression of the key gluconeogenic genes, including STAT3, G6Pase, PEPCK and GLUT2 (Wang et al., 2017b; Xu et al., 2018), suggesting that its effect is partially mediated by activation of the AMPK/STAT3 signaling pathway (Wang et al., 2017b; Xu et al., 2018). Although the results of our and other studies show that baicalin can enhance glucose uptake in skeletal muscle and adipocytes of mice (Fang et al., 2017, 2018a, 2018b), the specific metabolic contribution of baicalin on hepatic insulin resistance and gluconeogenic activity has not been sufficiently explored. Therefore, the aim of this study is to
therapeutic ways to reduce hyperglycemia and insulin resistance are urgently needed. It is established that an imbalance in increased glucose production from liver and reduced glucose uptake in peripheral tissues contributes hyperglycemia that is a major factor in developing type 2 diabetes mellitus (Rines et al., 2016; Sharabi et al., 2017). Hence, suppression of hepatic gluconeogenesis and improvement of insulin sensitivity to increase glucose uptake into tissues are two main ways aimed at recovering normal blood glucose levels to treat type 2 diabetes (Moore et al., 2012). Of them, reducing hepatic glucose production by inhibiting components within the gluconeogenic pathway is a feasible strategy to reduce hyperglycemia in type 2 diabetes mellitus. Peroxisome proliferator-activated receptor gamma (PPARγ) coactivator 1 alpha (PGC-1α) was identified in brown adipose tissue as a coldinducible coactivator of PPARγ in 1998 (Puigserver et al., 1998, 1999; Wu et al., 1999). In the fasting state, hepatic PGC-1α expression is induced by glucagon and further increased by the synergistic effects of glucagon with glucocorticoids via a CREB response element in its promoter (Altarejos and Montminy, 2011; Yoon et al., 2001; Herzig et al., 2001; Rodgers et al., 2005). In combination with CREB, PGC-1α facilitates gluconeogenesis in the liver by binding to the nuclear hormone receptors forkhead box O (FoxO) 1 to induce expression of key gluconeogenic enzymes such as phosphenolpyruvate carboxykinase (PEPCK) 2
Phytomedicine 64 (2019) 153074
P. Fang, et al.
Fig. 2. The i.p. administration of baicalin suppressed the expression of gluconeogenic gene in liver (n = 6). (A) PEPCK mRNA expression of liver. The PEPCK mRNA expression level was decreased in the liver of the baicalin group compared with the obese controls. (B) G6Pase mRNA expression of liver. The G6Pase mRNA expression level was decreased in the liver of the baicalin group compared with the obese controls. (C) PGC1α mRNA expression of liver. The PGC-1α mRNA expression level was decreased in the liver of the baicalin group compared with the obese controls. (D) FoxO1 mRNA expression of liver. The FoxO1 mRNA expression level was decreased in the liver of the baicalin group compared with the obese controls. NC, normal diet control group; OC, obese control group; Baicalin, obese group with baicalin. All data shown are the means ± SEM. *p < 0.05; **p < 0.01.
50 mg/kg baicalin intraperitoneally (i.p.) once a day for 21 consecutive days at 6:00 a.m. (Fang et al., 2018b). All controls were given vehicle (DMSO) i.p. The food intake of all mice was measured once a week. The body weight of all mice was recorded every day. This experiment was performed with the specific acceptance of the Animal Studies Committee of Yangzhou University. After fasted for 12 h all animals were sacrificed on the second day after the glucose tolerance test. Then 1 ml blood and all liver tissues were fast collected. The liver tissues were rinsed and frozen at −80 °C. The blood samples were centrifugated at 3500 r.p.m. for 10 min to obtain the plasma which was stored at –80 °C until further analysis.
assess the regulative roles and molecular mechanisms of baicalin controlling insulin resistance and hepatic gluconeogenesis. Materials and methods Drugs and reagents Baicalin (purity of 95%, Cat. No. 572667), metformin (purity of 97%, Cat. No. D150959) and glucagon (purity ≥ 95%, Cat. No. G1774) were acquired from Sigma-Aldrich, USA. Antibodies against FoxO1 (Cat. No. 2880), p38 MAPK (Cat. No. 9212), p-p38 MAPK (Cat. No. 4511), AKT (Cat. No. 4691), p-AKT (Cat. No. 9271), AMPK (Cat. No. 5832), p-AMPK (Cat. No. 2535), CREB (Cat. No. 9197) and p-CREB (Cat. No. 9198) were acquired from Cell Signaling Technology Inc, USA. Antibody against PGC-1α (Cat. No. ST-1202) was purchased from Merck Millipore Inc, Germany. Antibodies against α-tubulin (Cat. No. 11224-1-AP), PEPCK (Cat. No. 16754-1-AP) and G6Pase (Cat. No. 22169-1-AP) were acquired from Proteinteck Inc, China. Antibody against glyceraldehyde-phosphate dehydrogenase (GAPDH) (Cat. No. BA2913) was purchased from BOSTER Inc., China. P38MAPK inhibitior (2-(4-Chlorophenyl)-4-(4-fluorophenyl)-5-pyridin-4-yl-1,2-dihydropyrazol-3-one, Cat. No. 219138-24-6) was purchased from Merck Millipore Inc., Germany. Insulin ELISA kits (Cat. No.CEA448Mu) was purchased from Uscn Life Science, Inc. Wuhan, China. RIPA (Cat. No.PP1901) was purchased from Bioteke Corporation, Beijing, China.
Glucose tolerance test After fasted for 12 h, 1.5 g/kg glucose dissolved in sterile water was i.p. injected into the mice after an overnight fast (12 h). The blood glucose levels in the tail vein blood were monitored at 0, 15, 30, 60 and 120 min after the glucose challenge using a Glucometer. The areas under the curve (AUC) were calculated. Fasting insulin challenge using competitive insulin ELISA kits according to the manufacturer's specification. The assay range for insulin was 123.5–10,000 pg/ml, and intraassay precision CV% < 10% and inter-assay precision CV% < 12%. The homeostasis model of insulin resistance (HOMA-IR) was calculated by fasting serum insulin concentration (mU/ml) × fasting blood glucose level (mmol/l)/22.5. All measurements were performed in duplicate and the mean of two measurements was considered.
Animals Cell culture Six-week-old male C57BL/6J mice were kept in a standard laboratory condition of temperature 21 ± 2 °C, relative humidity 50 ± 15%, 12 h light-dark cycles, with water and food available ad libitum. All mice used were closely monitored to ensure that none lived under stress and discomfort. The mice were fed a high fat diet (20% carbohydrates, 21% protein and 59% fat) for 16 weeks. Then the obese mice were divided into two groups: obese control group (n = 6) and obese group with baicalin (n = 6). Besides, a normal diet group (n = 6) was set up. The mice in the obese group with baicalin were given
Primary hepatocytes were isolated from the livers of 10–12 weeks male C57BL/6 mice using the collagenase perfusion method. Briefly, after the tissues were digested by a perfusion of collagenase type IV solution, the liver was dissected, minced and filtered by 70 μm mesh filtration. The mixture was centrifuged at 50 g for 2 min to collect hepatocytes (the pellet). The resuspended hepatocytes were seeded on plates in DMEM supplemented with 10% FBS, 1% penicillin/streptomycin at 37 °C in a humidified atmosphere included 5% CO2. When 3
Phytomedicine 64 (2019) 153074
P. Fang, et al.
Fig. 3. The i.p. administration of baicalin decreased the levels of gluconeogenic protein in liver (n = 6). (A) The PEPCK contents in the liver. The PEPCK protein level was decreased in the liver of the baicalin group compared with the obese controls. (B) The G6Pase contents in the liver. The G6Pase protein level was decreased in the liver of the baicalin group compared with the obese controls. (C) The PGC-1α contents in the liver. The PGC-1α protein level was decreased in the liver of the baicalin group compared with the obese controls. (D) The FoxO1 contents in the liver. The FoxO1 protein level was decreased in the liver of the baicalin group compared with the obese controls. (E) The representative Western blot lines of PGC-1α, FoxO1, PEPCK and G6Pase in the liver. GAPDH was used as the loading control. NC, normal diet control group; OC, obese control group; Baicalin, obese group with baicalin. All data shown are the means ± SEM. *p < 0.05; **p < 0.01.
denaturation at 95 °C for 10 min; 95 °C for 15 s, 62 °C for 60 s, 40 cycles. The 2−ΔCT × 100% method was used to analyze the PCR data.
glucagon stimulation was performed, the medium was changed to starvation medium (DMEM, 0.2% BSA, and 1% penicillin/streptomycin). The primary hepatocytes were treated with baicalin (100 μM) or metformin (100 μM) in the presence of glucagon (200 nM) for 12 h. For p38MAPK inhibition experiment, cells were pretreated with inhibitor (10 μM) for 30 min prior to stimulation with baicalin.
Western blot analysis Total proteins of liver or hepatocytes were extracted using RIPA agents and quantified with BCA protein assay kit to determine protein levels. Briefly, the samples were separated by a 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a polyvinylidene difluoride filter membranes. Membranes were blocked in Tris-buffered saline (pH 7.5) containing 0.05% Tween-20 (1 × TBST) and 5% skimmed milk for 2 h, then probed overnight at 4 °C with an antibody against AMPK, p-AMPK, CREB, p-CREB, α-Tubulin, p38 MAPK, AKT, PEPCK, G6Pase, FoxO1, p-p38 MAPK, p-AKT, GAPDH and PGC-1α, respectively. Membranes were washed with 1 × TBST for 10 min and incubated for 2 h with horseradish peroxidase-conjugated secondary antibody. Lastly, immunoreactive bands were visualized by chemiluminescence and quantified by densitometry using a Quantity One Analysis Software (Bio-Rad).
Quantitative real-time PCR analysis Total RNA was extracted with Trizol from 100 mg frozen liver tissues. cDNA was synthesized from 1 μg RNA using MMLV reverse transcriptase. Real-time quantitative PCR was performed for gene expression levels using real-time fluorescent detection in an Applied Biosystems 7500 real-time PCR instrument (ABI 7500, USA). The oligonucleotide primers were as follows: PGC-1α Forward Sequence5’ACCATGACTACTGTCAGTCACTC-3′, Reverse Sequence5’-GTCACAGGA GGCATCTTTGAAG-3′; G6Pase Forward Sequence 5′- GATTGCTGACCTGAGGAACG-3′, Reverse Sequence 5′- ATAGTATACACCTGCTGCGCC-3′; PEPCK Forward Sequence 5′- GCATAACGGTCTGGACTTCT-3′, Reverse Sequence 5′- TGATGACTGTCTTGCTTTCG-3′; FoxO1 Forward Sequence5’-CAAAGTACACATACGGCCAATCC-3′, Reverse Sequence5’CGTAACTTGATTTGCTGTCCTGAA-3′; GAPDH Forward Sequence 5′AGAACATCATCCCTGCATCC −3′, Reverse Sequence5’- TCCACCACCC TGTTGCTGTA −3′. Amplification condition was: an initial
Statistical analysis SPSS 17.0 for Windows was used for statistical analysis. Data were presented as mean ± SEM with p < 0.05 as the limit for statistical significance. Comparisons between the means of groups were analyzed 4
Phytomedicine 64 (2019) 153074
P. Fang, et al.
the obese controls, but elevated by 65.1% (p < 0.01) and 38.7% (p < 0.01) in the obese control group compared with the normal controls (Fig. 1C and D). As shown in Fig. 1E, HOMA-IR index of mice was significantly decreased by 23.1% (p < 0.01) in the baicalin group compared with obese controls, but increased by 129.1% (p < 0.01) in the obese control group compared with normal controls. During the glucose tolerance test, as shown in Fig. 1F, the circulating glucose levels were markedly decreased by 10.9%, 17.6% and 24.7% at 0 min (p < 0.05), 60 min (p < 0.05) and 120 min (p < 0.05) in the baicalin group compared with obese controls, but increased by 38.7%, 19.2% and 74.6% at 0 min (p < 0.01), 60 min (p < 0.05) and 120 min (p < 0.01) in the obese control group compared with normal controls, respectively. As shown in Fig. 1G, the areas of glucose tolerance were significantly decreased by 15.1% (p < 0.05) in the baicalin group compared with the obese controls, but increased by 28.8% (p < 0.01) in the obese control group compared with normal controls. Baicalin suppresses the expression of gluconeogenic gene in liver As shown in Fig. 2A–D, the PEPCK mRNA, G6Pase mRNA, PGC-1α mRNA and FoxO1 mRNA expression levels were decreased by 63.6% (p < 0.01), 68.1% (p < 0.01), 82.1% (p < 0.01) and 46.1% (p < 0.05) in the liver of the baicalin group compared with the obese controls, but elevated by 163.4% (p < 0.01), 209.4% (p < 0.01), 692.1% (p < 0.01) and 317.9% (p < 0.01) in the obese control group compared with the normal controls, respectively. Besides, as shown in Fig. 3A–E, the PEPCK, G6Pase, PGC-1α and FoxO1 protein levels were decreased by 38.1% (p < 0.01), 32.4% (p < 0.05), 35.8% (p < 0.01) and 34.7% (p < 0.01) in the liver of the baicalin group compared with the obese controls, but elevated by 34.1% (p < 0.01), 79.3% (p < 0.01), 59.8% (p < 0.01) and 69.6% (p < 0.01) in the obese control group compared with the normal controls (Fig. 3A and E), respectively. In vitro, as shown in Fig. 4A-B, the levels of PEPCK, G6Pase and PGC-1α protein in the hepatocytes were decreased by 66.8% (p < 0.01), 55.7% (p < 0.01) and 45.1% (p < 0.01) in baicalin group compared with glucagon controls, but increased by 58.7% (p < 0.01), 51.5% (p < 0.01) and 51.6% (p < 0.01) in the glucagon control group compared with the normal controls (Fig. 4A and B), respectively. Besides, after treatment with metformin in hepatocytes, the levels of PEPCK, G6Pase and PGC-1α protein were significantly reduced by 34.5% (p < 0.01), 21.9% (p < 0.05) and 43.7% (p < 0.01) compared with glucagon control (Fig. 4A-B).
Fig. 4. The treatment with baicalin decreased the levels of gluconeogenic protein in hepatocytes (n = 3). (A) The PGC-1α, PEPCK, G6Pase and p-p38 MAPK/p38 MAPK contents in the liver. The levels of PGC-1α, PEPCK, G6Pase and p-p38 MAPK/p38 MAPK protein were decreased in the liver of the baicalin (100 μM) or metformin (100 μM) group compared with the glucagon (200 nM) controls. (B) The representative Western blot lines of PGC-1α, PEPCK, G6Pase, p-p38 MAPK and p38 MAPK protein in hepatocytes. α-Tubulin was used as the loading control. All data shown are the means ± SEM. *p < 0.05; **p < 0.01; ns, not significant.
Regulative effects of baicalin on gluconeogenic signaling pathway
by one-way ANOVA with Duncan's tests.
As shown in Fig 5A and B, the levels of phosphorylated p38 MAPK and CREB protein were reduced by 49.6% (p < 0.01) and 37.8% (p < 0.01) in baicalin group compared with obese controls, but increased by 85.8% (p < 0.01) and 116.8% (p < 0.01) in the obese control group compared with the normal controls, respectively. However, the levels of phosphorylated AKT and AMPK protein were enhanced by 143.1% (p < 0.01) and 76.3% (p < 0.01) in baicalin group compared with obese controls, but decreased by 71.8% (p < 0.01) and 44.3% (p < 0.01) in obese control group compared with the normal controls, respectively (Fig. 5C and D). In vitro, the level of phosphorylated p38 MAPK protein was reduced by 79.5% (p < 0.01) in metformin group compared with glucagon controls, but increased by 524.6% (p < 0.01) in the glucagon control compared with the normal control (Fig. 4A and B). Moreover, the level of the phosphorylated p38 MAPK protein was significantly decreased by 48.6% (p < 0.01) in baicalin-treated hepatocytes compared with control (Fig. 4A and B). We further investigated the regulation of gluconeogenic signaling by baicalin in p38MAPK inhibitor-treated hepatocytes when cells were exposed to glucagon challenge (Fig. 6A and B). Compared with the controls, the PEPCK, G6Pase and PGC-1α protein levels in the
Results Baicalin ameliorates glucose intolerance and systemic insulin resistance All of the mice used in this experiment exhibited similar body weight and food intake at the beginning of the experiment. After feeding of the high fat diet for 12 weeks, the body weight of the mice in obese control and baicalin groups was enhanced compared with the normal diet group before the administration of baicalin (Fig. 1). As shown in Fig. 1A, the body weight at 21 days were significantly decreased by 22.6% (p < 0.01) in the baicalin group compared with the obese controls, but increased by 60.7% (p < 0.01) in the obese control group compared with the normal controls. As shown in Fig. 1B, in the first, second and third week, the food intake in the baicalin group significantly decreased by 58.0% (p < 0.01), 54.1% (p < 0.01) and 51.6% (p < 0.01) compared with the obese controls, but that in the obese control group increased by 123.6% (p < 0.01), 91.3% (p < 0.01) and 68.2% (p < 0.01) compared with the normal controls, respectively. The blood insulin and glucose levels was decreased by 13.4% (p < 0.05) and 10.9% (p < 0.05) in the baicalin group compared with 5
Phytomedicine 64 (2019) 153074
P. Fang, et al.
Fig. 5. The i.p. administration of baicalin ameliorated hepatic insulin resistance and gluconeogenic activity via the regulation of gluconeogenic signaling pathway in liver (n = 6). (A) The ratio of p-p38 MAPK/p38 MAPK in liver. The ratio of pp38 MAPK/p38 MAPK was reduced in baicalin group compared with obese controls. (B) The ratio of p-CREB/CREB in liver. The ratio of p-CREB/CREB was reduced in baicalin group compared with obese controls. (C) The ratio of p-AKT/ AKT in liver. The ratio of p-AKT/AKT was enhanced in baicalin group compared with obese controls. (D) The ratio of pAMPK/AMPK in liver. The ratio of p-AMPK/AMPK was enhanced in baicalin group compared with obese controls. (E) The representative Western blot lines of p-p38 MAPK, p38 MAPK, p-CREB, CREB, p-AKT, AKT, p-AMPK and AMPK protein in the liver. α-Tubulin was used as the loading control. NC, normal diet control group; OC, obese control group; Baicalin, obese group with baicalin. All data shown are the means ± SEM. *p < 0.05; **p < 0.01.
illustrate that baicalin possesses anti-hyperglycemic effect (Li et al., 2011; Shi et al., 2016; Xi et al., 2016; Han et al., 2011). I.p. injection of baicalin significantly reduced blood glucose levels in a dose-dependent manner in streptozotocin-nicotinamide induced diabetic rats and mice (Li et al., 2011; Shi et al., 2016). In vitro, treated with different doses of baicalin (100, 200, 400 μM) for 6 h, 12 h and 24 h significantly promoted glucose uptake in myotubes and adipocytes (Fang et al., 2017, 2018a, 2018b). Consistent with these studies, the current results showed that i.p. injection of baicalin decreased food intake, body weight and circulating glucose levels in the mice with insulin resistance, indicating that baicalin had the anti-hyperglycemic effect effects. Besides, our previous studies indicated that baicalin possessed the
hepatocytes were significantly decreased by 20.1% (p < 0.05), 38.9% (p < 0.01) and 37.2% (p < 0.01) in p38MAPK inhibitor group. The p38MAPK inhibitor strengthened the inhibitory effect of baicalin on PEPCK and PGC-1α expression (Fig. 6A and B). Compared with the baicalin group, the PEPCK, G6Pase and PGC-1α protein levels in the baicalin+p38MAPK inhibitor group were significantly decreased by 27.1% (p < 0.05), 41.8% (p < 0.01) and 34.4% (p < 0.01) in the hepatocytes (Fig. 6A and B). Discussion Numerous studies from animal models of diabetes and obesity 6
Phytomedicine 64 (2019) 153074
P. Fang, et al.
potency to ameliorate insulin resistance (Fang et al., 2017, 2018a, 2018b). Treatment with baicalin in obese mice significantly decreased the indexes of insulin resistance in obese mice. Similarly, current date showed that baicalin significantly increased the glucose clearance of insulin resistant mice. Therefore, all of these results provide evidence in support of a role for baicalin in increasing glucose uptake and insulin sensitivity. The activity of gluconeogenesis is responsible for fasting hyperglycemia in type 2 diabetes (Rines et al., 2016). Gluconeogenesis is under the control of G6Pase and PEPCK, two main rate limiting enzymes (Koo et al., 2005; Perry et al., 2014). In the present study, we found that short-term feeding with high fat diet increased G6Pase and PEPCK levels in liver, contributing to increased hepatic gluconeogenesis. These changes might be attenuated by administration of baicalin. Similarly, glucagon-mediated PEPCK and G6Pase protein levels were also attenuated by baicalin and metformin in primary hepatocytes. These results suggested that administration of baicalin reduced G6Pase and PEPCK levels to inhibit hepatic glucose production. As the members of the protein kinases, AMPK and AKT are able to suppress hepatic gluconeogenesis (Zhang et al., 2009; Li et al., 2007). Activation of AMPK and AKT inhibited the expression of the gluconeogenic genes PEPCK and G6Pase (Li et al., 2007; Zhang et al., 2009). We found that baicalin phosphorylated AMPK and AKT in the liver of obese mice, suggesting that baicalin down-regulated PEPCK and G6Pase levels in liver to play the antihyperglycemic effects via activation of AMPK and AKT signaling pathways. PGC-1α can upregulate hepatic gluconeogenic gene expression, such as PEPCK and G6Pase, and selective inhibition of PGC-1α potentially reduced hepatic glucose production and ameliorated hepatic insulin resistance (Rodgers et al., 2005; Yoon et al., 2001). Overexpression of PGC-1α increased gluconeogenic gene expression and promoted hepatic glucose release (Herzig et al., 2001; Yoon et al., 2001), whereas knockout of PGC-1α gene led to modest but significant defects in gluconeogenesis (Estall et al., 2009; Burgess et al., 2006). In the present study, our results showed that administration of baicalin reduced PGC-1α levels in the liver of diabetic mice and hepatocytes. However, an opposite effect of baicalin on PGC-1α expression was reported that administration of baicalin enhanced PGC-1α expression in
Fig. 6. The treatment with baicalin decreased the levels of gluconeogenic protein in hepatocytes after p38MAPK inhibition (n = 3). (A) The PGC-1α, PEPCK and G6Pase contents in the liver. Compared with the controls, the levels of PGC-1α, PEPCK and G6Pase protein were significantly decreased after treatment with 100 μM baicalin or 10 μM p38MAPK inhibitor (p38I). Compared with the baicalin group, the levels of PGC-1α, PEPCK and G6Pase protein were significantly decreased in the baicalin + p38I group. (B) The representative Western blot lines of PGC-1α, PEPCK and G6Pase protein in hepatocytes. αTubulin was used as the loading control. All data shown are the means ± SEM. *p < 0.05; **p < 0.01.
Fig. 7. The regulatory network of p38MAPK on gluconeogenesis and hepatic insulin resistance. Baicalin ameliorates hepatic insulin resistance and gluconeogenic activity mainly through inhibition of p38 MAPK/PGC-1α signal pathway. 7
Phytomedicine 64 (2019) 153074
P. Fang, et al.
References
muscle and adipocytes of obese mice (Fang et al., 2017, 2018a, 2018b). The dichotomous effects of baicalin on PGC-1α expression took place on tissue types. In liver, baicalin reduced PGC-1α levels to attenuate gluconeogenesis. But in muscle, baicalin enhanced PGC-1α expression to improve insulin sensitivity to increase glucose uptake. Both decrease in glucose release in liver and increase in glucose uptake in muscle resulted in decreased blood glucose levels. These suggest that baicalin plays anti-hyperglycemic effects via regulating PGC-1α expression in different tissue. The elevated p-p38 MAPK levels are observed in liver of diabetic mice (Qiao et al., 2006). p38 MAPK can increase PEPCK, G6pase, FoxO1 and PGC-1α gene expression, as well as CREB phosphorylation (Qiao et al., 2006; Wang et al., 2018; Collins et al., 2006; Jing et al., 2015; Cao et al., 2005; Gao et al., 2010; Lee et al., 2011; Ozcan et al., 2012, 2013), but inhibit the phosphorylation of AMPK and AKT (Liu et al., 2007; Jing et al., 2015; Li et al., 2007; Lin and Hardie, 2018) (See Fig. 7). The synergistic effects of p-P38 MAPK with p-CREB elevated the hepatic PGC-1α expression to increase hepatic gluconeogenesis (Cao et al., 2005; Herzig et al., 2001; Puigserver et al., 2001). In the current study, we found that treatment of baicalin reduced hepatic pp38 MAPK, PGC-1α, FoxO1and p-CREB expression in diabetic mice and primary hepatocytes. Consequently, low levels of PGC-1α and FoxO1 in liver suppressed expression of PEPCK and G6Pase, and reduced hepatic glucose production and insulin resistance. In addition, our study in the primary hepatocytes found that p38MAPK inhibitor strengthened the inhibited effects of baicalin on glucagon-mediated PEPCK, G6Pase and PGC-1α expression. These results supported our hypothesis that baicalin suppressed gluconeogenic activity via downregulation of p38MAPK/PGC-1α, at least in part. However, how baicalin inactivates p38 MAPK signaling in the liver is still unclear, and this requires further exploration.
Altarejos, J.Y., Montminy, M., 2011. CREB and the CRTC co-activators: sensors for hormonal and metabolic signals. Nat. Rev. Mol. Cell Biol. 12, 141–151. Burgess, S.C., Leone, T.C., Wende, A.R., Croce, M.A., Chen, Z., Sherry, A.D., Malloy, C.R., Finck, B.N., 2006. Diminished hepatic gluconeogenesis via defects in tricarboxylic acid cycle flux in peroxisome proliferator-activated receptor gamma coactivator1alpha (PGC-1alpha)-deficient mice. J. Biol. Chem. 281, 19000–19008. Cao, W., Collins, Q.F., Becker, T.C., Robidoux, J., Lupo Jr., E.G, Xiong, Y., Daniel, K.W., Floering, L., Collins, S., 2005. p38 Mitogen-activated protein kinase plays a stimulatory role in hepatic gluconeogenesis. J. Biol. Chem. 280, 42731–42737. Chen, Q., Liu, M., Yu, H., Li, J., Wang, S., Zhang, Y., Qiu, F., Wang, T., 2018. Scutellaria baicalensis regulates FFA metabolism to ameliorate NAFLD through the AMPKmediated SREBP signaling pathway. J. Nat. Med. 72, 655–666. Cho, N.H., Shaw, J.E., Karuranga, S., Huang, Y., da Rocha Fernandes, J.D., Ohlrogge, A.W., Malanda, B., 2018. IDF Diabetes Atlas: global estimates of diabetes prevalence for 2017 and projections for 2045. Diabetes Res. Clin. Pract. 138, 271–281. Collins, Q.F., Xiong, Y., Lupo Jr., E.G., Liu, H.Y., Cao, W., 2006. p38 Mitogen-activated protein kinase mediates free fatty acid-induced gluconeogenesis in hepatocytes. J. Biol. Chem. 281, 24336–24344. Dai, J., Liang, K., Zhao, S., Jia, W., Liu, Y., Wu, H., Lv, J., Cao, C., Chen, T., Zhuang, S., Hou, X., Zhou, S., Zhang, X., Chen, X.W., Huang, Y., Xiao, R.P., Wang, Y.L., Luo, T., Xiao, J., Wang, C., 2018. Chemoproteomics reveals baicalin activates hepatic CPT1 to ameliorate diet-induced obesity and hepatic steatosis. Proc. Natl. Acad. Sci. USA 115, E5896–E5905. de Oliveira, M.R., Nabavi, S.F., Habtemariam, S., Erdogan Orhan, I., Daglia, M., Nabavi, S.M., 2015. The effects of baicalein and baicalin on mitochondrial function and dynamics: a review. Pharmacol. Res. 100, 296–308. Estall, J.L., Kahn, M., Cooper, M.P., Fisher, F.M., Wu, M.K., Laznik, D., Qu, L., Cohen, D.E., Shulman, G.I., Spiegelman, B.M., 2009. Sensitivity of lipid metabolism and insulin signaling to genetic alterations in hepatic peroxisome proliferator-activated receptor-gamma coactivator-1alpha expression. Diabetes 58, 1499–1508. Fang, P., Yu, M., Zhang, L., Wan, D., Shi, M., Zhu, Y., Bo, P., Zhang, Z., 2017. Baicalin against obesity and insulin resistance through activation of AKT/AS160/GLUT4 pathway. Mol. Cell Endocrinol. 448, 77–86. Fang, P., Yu, M., Min, W., Han, S., Shi, M., Zhang, Z., Bo, P., 2018b. Beneficial effect of baicalin on insulin sensitivity in adipocytes of diet-induced obese mice. Diabetes Res. Clin. Pract. 139, 262–271. Fang, P., Yu, M., Min, W., Wan, D., Han, S., Shan, Y., Wang, R., Shi, M., Zhang, Z., Bo, P., 2018a. Effect of baicalin on GLUT4 expression and glucose uptake in myotubes of rats. Life Sci 196, 156–161. Gao, D., Nong, S., Huang, X., Lu, Y., Zhao, H., Lin, Y., Man, Y., Wang, S., Yang, J., Li, J., 2010. The effects of palmitate on hepatic insulin resistance are mediated by NADPH oxidase 3-derived reactive oxygen species through JNK and p38MAPK pathways. J. Biol. Chem. 285, 29965–29973. Guo, H.X., Liu, D.H., Ma, Y., Liu, J.F., Wang, Y., Du, Z.Y., Wang, X., Shen, J.K., Peng, H.L., 2009. Long-term baicalin administration ameliorates metabolic disorders and hepatic steatosis in rats given a high-fat diet. Acta Pharmacol. Sin. 30, 1505–1512. Herzig, S., Long, F., Jhala, U.S., Hedrick, S., Quinn, R., Bauer, A., Rudolph, D., Schutz, G., Yoon, C., Puigserver, P., Spiegelman, B., Montminy, M., 2001. CREB regulates hepatic gluconeogenesis through the coactivator PGC-1. Nature 413, 179–183. Jing, Y., Liu, W., Cao, H., Zhang, D., Yao, X., Zhang, S., Xia, H., Li, D., Wang, Y.C., Yan, J., Hui, L., Ying, H., 2015. Hepatic p38α regulates gluconeogenesis by suppressing AMPK. J. Hepatol. 62, 1319–1327. Koo, S.H., Flechner, L., Qi, L., Zhang, X., Screaton, R.A., Jeffries, S., Hedrick, S., Xu, W., Boussouar, F., Brindle, P., Takemori, H., Montminy, M., 2005. The CREB coactivator TORC2 is a key regulator of fasting glucose metabolism. Nature 437, 1109–1111. Lee, J., Sun, C., Zhou, Y., Lee, J., Gokalp, D., Herrema, H., Park, S.W., Davis, R.J., Ozcan, U., 2011. p38 MAPK-mediated regulation of Xbp1s is crucial for glucose homeostasis. Nat. Med. 17, 1251–1260. Li, H.B., Chen, F., 2005. Isolation and purification of baicalein, wogonin and oroxylin a from the medicinal plant scutellaria baicalensis by high-speed counter-current chromatography. J. Chromatogr. A. 1074, 107–110. Li, H.T., Wu, X.D., Davey, A.K., Wang, J., 2011. Antihyperglycemic effects of baicalin on streptozotocin-nicotinamide induced diabetic rats. Phytother. Res. 25, 189–194. Li, X., Monks, B., Ge, Q., Birnbaum, M.J., 2007. Akt/PKB regulates hepatic metabolism by directly inhibiting PGC-1alpha transcription coactivator. Nature 447, 1012–1016. Liu, H.Y., Collins, Q.F., Xiong, Y., Moukdar, F., Lupo Jr., E.G., Liu, Z., Cao, W., 2007. Prolonged treatment of primary hepatocytes with oleate induces insulin resistance through p38mitogen-activated protein kinase. J. Biol. Chem. 282, 14205–14212. Lin, S.C., Hardie, D.G., 2018. AMPK: sensing glucose as well as cellular energy status. Cell Metab 27, 299–313. Moore, M.C., Coate, K.C., Winnick, J.J., An, Z., Cherrington, A.D., 2012. Regulation of hepatic glucose uptake and storage in vivo. Adv. Nutr. 3, 286–294. O-Sullivan, I., Zhang, W., Wasserman, D.H., Liew, C.W., Liu, J., Paik, J., DePinho, R.A., Stolz, D.B., Kahn, C.R., Schwartz, M.W., Unterman, T.G., 2015. FoxO1 integrates direct and indirect effects of insulin on hepatic glucose production and glucose utilization. Nat. Commun. 6, 7079. Ozcan, L., Cristina de Souza, J., Harari, A.A., Backs, J., Olson, E.N., Tabas, I., 2013. Activation of calcium/calmodulin-dependent protein kinase II in obesity mediates suppression of hepatic insulin signaling. Cell Metab 18, 803–815. Ozcan, L., Wong, C.C., Li, G., Xu, T., Pajvani, U., Park, S.K., Wronska, A., Chen, B.X., Marks, A.R., Fukamizu, A., Backs, J., Singer, H.A., Yates, J.R., Accili, D., Tabas, I., 2012. Calcium signaling through CaMKII regulates hepatic glucose production in fasting and obesity. Cell Metab 15, 739–751.
Conclusion Taken together, baicalin displayed its antihyperglycemic characteristics through suppression of hepatic p-p38 MAPK, PGC-1α, FoxO1, p-CREB, PEPCK and G6Pase expression, suggesting baicalin ameliorated hepatic insulin resistance and gluconeogenic activity mainly through inhibition of p38 MAPK/PGC-1α signaling pathways. Thus, our study reveals a novel regulatory network of baicalin on gluconeogenesis, in which p38 MAPK signaling crosstalks with gluconeogenic signaling through downstream PGC-1α. In addition, this study provided evidence that inhibition of hepatic p38 MAPK/PGC-1α signal pathway by baicalin could be a new therapeutic approach to treat obesity and insulin resistance in clinic. CRediT authorship contribution statement Penghua Fang: Conceptualization, Methodology, Writing - original draft, Writing - review & editing. Yabin Sun: Methodology, Writing review & editing. Xinru Gu: Methodology, Writing - review & editing. Mingyi Shi: Formal analysis, Writing - review & editing. Ping Bo: Formal analysis, Writing - original draft, Writing - review & editing. Zhenwen Zhang: Conceptualization, Writing - original draft, Writing review & editing. Le Bu: Conceptualization, Writing - original draft, Writing - review & editing. Declaration of Competing Interest The authors declared no conflict of interest. Acknowledgments This work was supported by the National Natural Scientific Fund of China (no. 81673736; no.81803792) and the Natural Scientific Fund of Jiangsu(no. BK20171319) and Qing Lan Project of Jiangsu. 8
Phytomedicine 64 (2019) 153074
P. Fang, et al.
diabetes and prediabetes in China in 2013. JAMA 317, 2515–2523. Wang, T., Jiang, H., Cao, S., Chen, Q., Cui, M., Wang, Z., Li, D., Zhou, J., Wang, T., Qiu, F., Kang, N., 2017b. Baicalin and its metabolites suppresses gluconeogenesis through activation of AMPK or AKT in insulin resistant HepG-2 cells. Eur. J. Med. Chem. 141, 92–100. Wu, Z., Puigserver, P., Andersson, U., Zhang, C., Adelmant, G., Mootha, V., Troy, A., Cinti, S., Lowell, B., Scarpulla, R.C., Spiegelman, B.M., 1999. Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1. Cell 98, 115–124. Xi, Y.L., Li, H.X., Chen, C., Liu, Y.Q., Lv, H.M., Dong, S.Q., Luo, E.F., Gu, M.B., Liu, H., 2016. Baicalin attenuates high fat diet-induced insulin resistance and ectopic fat storage in skeletal muscle, through modulating the protein kinase B/Glycogen synthase kinase 3 beta pathway. Chin. J. Nat. Med. 14, 48–55. Xi, Y., Wu, M., Li, H., Dong, S., Luo, E., Gu, M., Shen, X., Jiang, Y., Liu, Y., Liu, H., 2015. Baicalin attenuates high fat diet-induced obesity and liver dysfunction: doseResponse and potential role of caMKKβ/AMPK/ACC pathway. Cell Physiol. Biochem. 35, 2349–2359. Xu, J., Li, Y., Lou, M., Xia, W., Liu, Q., Xie, G., Liu, L., Liu, B., Yang, J., Qin, M., 2018. Baicalin regulates Sirt1/STAT3 pathway and restrains excessive hepatic glucose production. Pharmacol. Res. 136, 62–73. Xu, Y., Wang, L., He, J., Bi, Y., Li, M., Wang, T., Wang, L., Jiang, Y., Dai, M., Lu, J., Xu, M., Li, Y., Hu, N., Li, J., Mi, S., Chen, C.S., Li, G., Mu, Y., Zhao, J., Kong, L., Chen, J., Lai, S., Wang, W., Zhao, W., Ning, G., 2010 China Noncommunicable Disease Surveillance Group., 2013. Prevalence and control of diabetes in Chinese adults. JAMA 310, 948–959. Yoon, J.C., Puigserver, P., Chen, G., Donovan, J., Wu, Z., Rhee, J., Adelmant, G., Stafford, J., Kahn, C.R., Granner, D.K., Newgard, C.B., Spiegelman, B.M., 2001. Control of hepatic gluconeogenesis through the transcriptional coactivator PGC-1. Nature 413, 131–138. Zhang, B.B., Zhou, G., Li, C., 2009. AMPK: an emerging drug target for diabetes and the metabolic syndrome. Cell Metab 9, 407–416. Zhang, J., Zhang, H., Deng, X., Zhang, N., Liu, B., Xin, S., Li, G., Xu, K., 2018. Baicalin attenuates non-alcoholic steatohepatitis by suppressing key regulators of lipid metabolism, inflammation and fibrosis in mice. Life Sci. 192, 46–54. Zhao, W., Liu, L., Wang, Y., Mao, T., Li, J., 2016. Effects of a combination of puerarin, baicalin and berberine on the expression of proliferator-activated receptor-γ and insulin receptor in a rat model of nonalcoholic fatty liver disease. Exp. Ther. Med. 11, 183–190. Zheng, Y., Ley, S.H., Hu, F.B., 2018. Global aetiology and epidemiology of type 2 diabetes mellitus and its complications. Nat. Rev. Endocrinol. 14, 88–98. Zhong, X., Liu, H., 2018. Baicalin attenuates diet induced nonalcoholic steatohepatitis by inhibiting inflammation and oxidative stress via suppressing JNK signaling pathways. Biomed. Pharmacother. 98, 111–117.
Puigserver, P., Rhee, J., Lin, J., Wu, Z., Yoon, J.C., Zhang, C.Y., Krauss, S., Mootha, V.K., Lowell, B.B., Spiegelman, B.M., 2001. Cytokine stimulation of energy expenditure through p38 MAP kinase activation of PPARgamma coactivator-1. Mol. Cell. 8, 971–982. Perry, R.J., Samuel, V.T., Petersen, K.F., Shulman, G.I., 2014. The role of hepatic lipids in hepatic insulin resistance and type 2 diabetes. Nature 510, 84–91. Puigserver, P., Adelmant, G., Wu, Z., Fan, M., Xu, J., O'Malley, B., Spiegelman, B.M., 1999. Activation of PPARg coactivator-1 through transcription factor docking. Science 286, 1368–1371. Puigserver, P., Wu, Z., Park, C.W., Graves, R., Wright, M., Spiegelman, B.M., 1998. A coldinducible coactivator of nuclear receptors linked to adaptive thermogenesis. Cell 92, 829–839. Puigserver, P., Rhee, J., Donovan, J., Walkey, C.J., Yoon, J.C., Oriente, F., Kitamura, Y., Altomonte, J., Dong, H., Accili, D., Spiegelman, B.M., 2003. Insulin-regulated hepatic gluconeogenesis through FOXO1-PGC-1alpha interaction. Nature 423, 550–555. Qiao, L., MacDougald, O.A., Shao, J., 2006. CCAAT/enhancer-binding protein alpha mediates induction of hepatic phosphoenolpyruvate carboxykinase by p38 mitogenactivated protein kinase. J. Biol. Chem. 281, 24390–24397. Rhee, J., Inoue, Y., Yoon, J.C., Puigserver, P., Fan, M., Gonzalez, F.J., Spiegelman, B.M., 2003. Regulation of hepatic fasting response by PPARgamma coactivator-1alpha (PGC-1): requirement for hepatocyte nuclear factor 4alpha in gluconeogenesis. Proc. Natl. Acad. Sci. USA 100, 4012–4017. Rines, A.K., Sharabi, K., Tavares, C.D., Puigserver, P., 2016. Targeting hepatic glucose metabolism in the treatment of type 2 diabetes. Nat. Rev. Drug Discov. 15, 786–804. Rodgers, J.T., Lerin, C., Haas, W., Gygi, S.P., Spiegelman, B.M., Puigserver, P., 2005. Nutrient control of glucose homeostasis through a complex of PGC-1alpha and SIRT1. Nature 434, 113–118. Schilling, M.M., Oeser, J.K., Boustead, J.N., Flemming, B.P., O'Brien, R.M., 2006. Gluconeogenesis: re-evaluating the FOXO1-PGC-1alpha connection. Nature 443, E10–E11. Sharabi, K., Lin, H., Tavares, C.D.J., Dominy, J.E., Camporez, J.P., Perry, R.J., Schilling, R., Rines, A.K., Lee, J., Hickey, M., Bennion, M., Palmer, M., Nag, P.P., Bittker, J.A., Perez, J., Jedrychowski, M.P., Ozcan, U., Gygi, S.P., Kamenecka, T.M., Shulman, G.I., Schreiber, S.L., Griffin, P.R., Puigserver, P., 2017. Selective chemical inhibition of PGC-1α gluconeogenic activity ameliorates type 2 diabetes. Cell 169, 148–160. Shi, F., Wei, Z., Zhao, Y., Xu, X., 2016. Nanostructured lipid carriers loaded with Baicalin: an efficient carrier for enhanced antidiabetic effects. Pharmacogn. Mag. 12, 198–202. Wang, Y., Yan, S., Xiao, B., Zuo, S., Zhang, Q., Chen, G., Yu, Y., Chen, D., Liu, Q., Liu, Y., Shen, Y., Yu, Y., 2018. Prostaglandin F2α facilitates hepatic glucose production through CaMKIIγ/p38/FOXO1 signaling pathway in fasting and obesity. Diabetes 67, 1748–1760. Wang, L., Gao, P., Zhang, M., Huang, Z., Zhang, D., Deng, Q., Li, Y., Zhao, Z., Qin, X., Jin, D., Zhou, M., Tang, X., Hu, Y., Wang, L., 2017a. Prevalence and ethnic pattern of
9