Balancing the Production of Two Recombinant Proteins inEscherichia coliby Manipulating Plasmid Copy Number: High-Level Expression of Heterodimeric Ras Farnesyltransferase

PROTEIN EXPRESSION AND PURIFICATION ARTICLE NO.

11, 233–240 (1997)

PT970794

Balancing the Production of Two Recombinant Proteins in Escherichia coli by Manipulating Plasmid Copy Number: High-Level Expression of Heterodimeric Ras Farnesyltransferase Kwei-Lan Tsao and David S. Waugh1 Department of Physical Chemistry, Roche Research Center, Hoffmann-La Roche, Inc., 340 Kingsland Street, Nutley, New Jersey 07110

Received April 7, 1997, and in revised form July 23, 1997

The native Ras farnesyltransferase heterodimer (ab) and a heterodimer with a truncated a subunit (a*b) were overproduced at a high level and in a soluble form in Escherichia coli. The a, a*, and b subunits were synthesized from individual plasmid vectors under the control of bacteriophage T7 promoters. Although each subunit could be expressed at a high level by itself, when either the a or a* and the b plasmid were present in cells at the same time, the a and a* subunits were preferentially expressed to such a degree that little or none of the b subunit accumulated. A satisfactory balance between both combinations of subunits (ab and a*b) was achieved by making incremental adjustments in the copy number of the b-encoding plasmid. As the copy number of the b plasmid increased, so did the ratio of b:a or b:a*, but there was little difference in the total amount of recombinant protein (a / b or a* / b) that was produced. This may be a generally useful method for balancing the production of two recombinant polypeptides in E. coli. A noteworthy advantage of this approach is that it can be undertaken without first determining the cause of the imbalance. q 1997 Academic Press

The ras proto-oncogene product p21ras is an essential component of an intensively studied signal transduction pathway that controls cell growth and differentiation (1–3). Persistent signaling by mutant forms of p21ras is associated with cellular transformation and

1 To whom correspondence should be addressed at ABL Basic Research Program, NCI–Frederick Cancer Research and Development Center, P.O. Box B, Frederick, MD 21702. Fax: (301) 846-7148. Email: [email protected].

numerous human cancers (4,5). p21ras function is absolutely dependent on its localization to the inner surface of the plasma membrane, which can occur only after posttranslational processing of the protein (6). The first of three posttranslational modifications, addition of a farnesyl moiety to a cysteine residue near the carboxyterminus of p21ras, is catalyzed by farnesyltransferase (FTase).2 Interest in FTase stems mainly from its role in the maturation of p21ras; since the ras oncogene is frequently associated with human tumors, FTase inhibitors may prove to be effective anti-cancer drugs (7). FTase is a dimer of nonidentical subunits, termed a (377 residues) and b (417 residues). The former subunit is shared by the related enzyme geranylgeranyltransferase (8). Neither subunit of FTase by itself can form a stable complex with either farnesyl pyrophosphate or p21ras, although both substrates can be cross-linked to the b subunit under some circumstances (9–12). The preferred catalytic pathway proceeds through the enzyme–isoprenoid binary complex (12,13), and the ratelimiting step in catalysis appears to be product release (14). FTase contains a tightly bound zinc ion, which is essential for substrate binding and enzymatic activity (15–17). Thus far, only a few important or dispensable features of each polypeptide subunit have been identified (10,18–22), but the recent publication of the rat FTase crystal structure (23) is likely to inspire a multitude of site-directed mutagenesis experiments.

2 Abbreviations used: a, alpha subunit of FTase; a*, a truncated form of a that lacks residues 1-50; b, beta subunit of FTase; ATCC, American Type Culture Collection (Rockville, MD); bla, beta-lactamase gene; FTase, farnesyltransferase; IPTG, isopropyl-1-thio-b-Dgalactopyranoside; PCR, polymerase chain reaction; rop, repressor of primer gene; SDS–PAGE, sodium dodecyl sulfate–polyacrylamide gel electrophoresis; [ ], plasmid carrier state.

233

1046-5928/97 $25.00 Copyright q 1997 by Academic Press All rights of reproduction in any form reserved.

AID

PEP 0794

/

6q16$$$141

11-05-97 22:12:56

pepal

AP: PEP

234

TSAO AND WAUGH

Structure–function studies of FTase have been hindered in part by the lack of an abundant source of recombinant protein, a problem compounded by the fact that reconstitution of FTase activity from the individual subunits is very inefficient (10,16,24). Consequently, the coordinated expression of both genes appears to be the only feasible way of producing enough recombinant FTase for structural studies. Efforts along these lines have been reported in the literature for rat FTase expressed in insect cells (16) and for yeast (24) and human (10) FTase produced in Escherichia coli. Artificial dicistronic regulons were constructed to coordinate the expression and balance the production of the a and b subunits of human and yeast FTase in E. coli. Although multicistronic mRNAs are common in bacteria, exactly what governs the efficiency with which internal ribosome binding sites are utilized is not particularly well understood. Perhaps this is why neither endeavor was tremendously successful. In both cases, despite a substantial amount of tinkering with the sequence in the vicinity of the junction between the two open reading frames that was undertaken in order to rectify an initial imbalance between the two subunits, the yield of heterodimers was still quite low, with human FTase accounting for no more than 0.5% of the total intracellular protein. Nevertheless, the two recombinant enzymes were reported to have essentially the same specific activity as their natural counterparts. In the present study, we have used individual plasmid vectors instead of an artificial dicistronic regulon to overproduce the two subunits of human FTase in E. coli. This approach not only permits both coding sequences to be placed in an optimum context for expression, but also affords an opportunity to balance the production of the two subunits by manipulating the copy number of one of the plasmids. In the optimally balanced strains, the yield of soluble human FTase heterodimers is between 10 and 100 times greater than what was obtained with a dicistronic construct (10). We propose that this may be a generally useful approach for balancing the expression of two recombinant polypeptides in E. coli. MATERIALS AND METHODS

Bacterial host for FTase expression. X90/DE3 was constructed by lysogenizing E. coli X90 (25) with bacteriophage lDE3 (26), using a kit from Novagen (Madison, WI). Plasmid expression vectors. The following synthetic oligodeoxyribonucleotides were used as PCR primers to construct FTase expression vectors: 300, 5*-TAATAACCATGGCTTCTCCGAGTTCCTTCACC-3*; 301, 5*AATTTATGATCAGATCTCGAGTTAACCCGGGATCCAGTAGCAGAGCCAGGGGCG-3*; 305, 5*-AATAATCTCGAGTTAGTCGGTTGCAGGCTCTGCCGATGTC3*; 314, 5*-ATAATTTGGATCCTTATTGCTGTACATT-

AID

PEP 0794

/

6q16$$$141

11-05-97 22:12:56

TGTTGGTGAG-3*; 315, 5*-GGCTCTGCTATTGGATCCTGCACAG-3*; 316, 5*-TTATATCATATGGATTACAAAGATGACGATGACAAAGGGATCGAGGGAAGGGCGGCCACCGAGGGGGTCGGGGAG-3*; 317, 5*TTATATCATATGGATTACAAAGATGACGATGACAAAGGGATCGAGGGAAGGATGGACGACGGGTTTGTGAGCCTG-3*. The restriction sites within these primers that were used to cleave the PCR fragments prior to ligation are underlined. The initial expression vector for the b subunit of human FTase (pDW389) was constructed in two steps. First, the segment of a rat FTase b cDNA clone (27, ATCC No. 63127) which corresponds to amino acid residues 1–106 was amplified by PCR, using primers 300 and 301. The former primer included a single mismatched nucleotide which changed the codon at position 4 from one that specifies serine to one that specifies proline instead (this was done in order to eliminate the only difference between the amino acid sequences of the human and rat FTase b subunits in this interval). This PCR fragment was cleaved with NcoI and BclI and then ligated with the NcoI/BamHI vector backbone of pET11d (26) to construct pDW388. Next, the segment of a human FTase b cDNA clone (28, ATCC No. 63226) that corresponds to amino acid residues 107– 417 was amplified by PCR, using primers 315 and 305. This PCR fragment was cleaved with XhoI and BamHI and then ligated with the XhoI/BamHI vector fragment of pDW388 to construct pDW389. The latter vector directs the expression of the reconstructed, full-length human FTase b subunit. pDW401 was constructed by ligating the XbaI/BglII fragment of pDW389 that includes the complete, reconstructed FTase b coding sequence with the XbaI/BamHI vector fragment of pET3d (26). pDW407 was constructed by cleaving pDW401 with NruI and PvuII and then recircularizing the vector fragment with T4 DNA ligase so as to delete the rop gene. The SspI/AflIII fragment of pUC19 that includes the bla gene and the origin of replication was ligated with the SspI/AflIII vector backbone of pDW401 to construct pDW406. pDW408 was constructed by cleaving pDW406 with NruI and PvuII and then recircularizing the vector with T4 DNA ligase so as to delete the rop gene. The complete human FTase a coding sequence was amplified by PCR from a cDNA clone (18; ATCC No. 63225), using the 316 and 314 primers. This PCR fragment was cleaved with NdeI and BamHI before it was ligated with the NdeI/BamHI vector backbone of pDW387 to construct pDW390. pDW391 was constructed in the same manner as pDW390, except that the PCR primers were 317 and 314. pDW391 directs the synthesis of an a subunit that lacks residues 1–50 of the native polypeptide sequence (a*). pDW387 was constructed by ligating the BglII/EcoRV fragment of pET3c (26), which includes the T7 promoter and tran-

pepal

AP: PEP

HIGH-LEVEL EXPRESSION OF Ras FARNESYLTRANSFERASE

scription terminator, with the BamHI/DraI vector fragment of pACYC177 (29). All plasmids were constructed by standard recombinant DNA techniques (30) and their structures were confirmed by dideoxy-nucleotide sequencing (31). All PCR reactions were performed in 100 ml of 10 mM Tris– HCl, pH 8.3, 50 mM KCl, 2 mM MgCl2 , with 200 mM of each dNTP, 2.5 units of AmpliTaq DNA polymerase (Perkin Elmer), 1.5 mg of each primer, and 100 ng of plasmid template. The PCR regimen entailed 25 cycles in a Perkin Elmer thermal cycler (Model 480), with each cycle consisting of 1 min at 947C, followed by 1 min at 557C, and then 1 min at 727C. Protein expression and SDS–PAGE. Cells from single colonies were grown to saturation in LB broth (32) supplemented with 1 mM ZnCl2 and the appropriate antibiotics (100 mg/ml ampicillin and/or 50 mg/ml kanamycin) at 377C. These cultures were diluted 80-fold in the same medium, except for X90/DE3[pDW391 / pDW408], which was diluted 24-fold. The cells were grown to mid-log phase (A600 Å 0.5–0.7) at 377C, and then the temperature was shifted to 257C and IPTG was added to a final concentration of 1 mM. After 3 h at 257C, the cells from 8 ml of each culture were recovered by centrifugation and resuspended in 0.8 ml of 20 mM Tris–HCl (pH 7.6), 1 mM EDTA, 0.3 mg/ml lysozyme. The cell suspensions were sonicated on ice for 1 min, and then NaCl was added to a final concentration of 100 mM. Fifty microliters of each cell suspension was added to 50 ml of 21 sample buffer (33) to generate samples of the total intracellular protein for SDS–PAGE. The remainder of the sonicated cell suspensions was centrifuged for 20 min at 14,000g. Samples of the soluble intracellular protein were prepared by combining 50 ml of the supernatants with 50 ml of 21 sample buffer. All solutions of protein in sample buffer were heated at 947C for 4 min and then centrifuged at 14,000g for 15 min prior to SDS–PAGE. Precast SDS polyacrylamide gels (12%, Tris–glycine) were purchased from Novex (San Diego, CA). RESULTS

Our FTase expression system was designed so that either the a and b or the a* and b subunits can be synthesized simultaneously from individual, compatible plasmid vectors. All three genes are under bacteriophage T7 promoter control. The chromosome of the host strain contains a T7 RNA polymerase gene which is under lac promoter control (26). Addition of IPTG to the culture medium leads, indirectly, to transcription of the target genes on the plasmid expression vectors, as depicted in Fig. 1. Construction of Compatible T7 Expression Vectors Most plasmid expression vectors, including the pET series of T7 promoter vectors (26), are derivatives of

AID

PEP 0794

/

6q16$$$141

11-05-97 22:12:56

235

the ColE1 replicon. Two plasmids cannot be stably maintained in cells at the same time if they are members of the same compatibility group (34). Therefore, before we could simultaneously produce the a and b subunits from individual plasmids, we first needed to construct a T7 expression vector that would be compatible with the pET vectors. This was accomplished by inserting the T7 promoter and transcription terminator from pET3c (26) into pACYC177 (29), a p15A derivative that is compatible with ColE1 replicons and which has a nominal copy number of 12–15 per cell (30). The a and a* coding sequences of FTase were inserted into this pACYC derivative (pDW387) to construct pDW390 and pDW391, respectively, as described under Materials and Methods. To facilitate purification of the native and truncated FTase heterodimers, a FLAG-TAG epitope (35) was added to the amino terminus of both the a and a* subunits, as depicted in Fig. 2. The enteropeptidase recognition site contained within the FLAG-TAG epitope is normally exploited to remove the affinity tag from the protein after it has been purified. However, preliminary tests revealed that rat FTase (which has nearly the same amino acid sequence as the human enzyme) was partially degraded by this protease but not by Factor Xa. For this reason, a Factor Xa site was installed between the FLAG-TAG epitope and the FTase coding sequences in pDW390 and pDW391. Both the FLAGTAG and the Factor Xa site were encoded by extra nucleotides added to the ends of the appropriate PCR primers (see Materials and Methods). The human FTase b cDNA clone that we obtained from the ATCC was incomplete (28), and so a fulllength coding sequence was created by joining together fragments of the rat and human FTase b cDNA clones at a unique BamHI restriction site that was present in both genes. At the same time, so that this segment of the rat cDNA would encode exactly the same polypeptide sequence as the human cDNA (10), one codon had to be altered to specify proline instead of serine (see Materials and Methods). The reconstructed, full-length FTase b coding sequence was inserted into pET11d (26) to construct pDW389 (Fig. 5). Like other derivatives of the pMB1 replicon (e.g., pBR322), pDW389 is expected to have a copy number of approximately 25 – 30 per cell (30). Overproduction of Individual FTase Subunits The bacterial host for overproduction of human FTase was E. coli X90/DE3. This strain was selected because some toxicity was encountered when the a and b vectors were present together in BL21/DE3 cells, or when the latter strain was transformed with high copy number derivatives of the b plasmid. X90/DE3 has a more tightly regulated T7 RNA polymerase gene in its chromosome than does BL21/DE3 (unpublished obser-

pepal

AP: PEP

236

TSAO AND WAUGH

FIG. 1. T7 expression system for human FTase. The host strain contains a single copy of an IPTG-inducible T7 RNA polymerase gene in its chromosome. The a and b subunits, or the a* and b subunits (not shown), are synthesized simultaneously from separate, compatible, multicopy plasmid expression vectors, both of which are under T7 promoter control. The FTase heterodimers assemble in vivo. lac PO, lac promoter and operator sequences; T7 RNAP, bacteriophage T7 RNA polymerase; IPTG, isopropyl-b-D-thiogalactoside; a and b, alpha and beta subunits of human FTase.

vations), possibly because it carries the overproducing allele of lac repressor (lacIQ) on an episome (25). As shown in Fig. 3, each of the individual subunits could be expressed at a high level in E. coli X90/DE3 cells upon induction with IPTG, with yields ranging between 5 and 25% of the total intracellular protein. As reported previously (10), the a and a* subunits are soluble in the crude cell lysate (Fig. 3B, compare lanes 4 and 6 with lanes 3 and 5, respectively), whereas very little of the b subunit is found in the soluble fraction (Fig. 3A, compare lanes 4, 7, and 10 with lanes 3, 6, and 9, respectively). In fact, the small fraction of the b subunit that appears to be soluble may be so only by virtue of its association with the molecular chaperone GroEL, which was reported to be the predominant species in affinity purified preparations of FTase b (10). It is noteworthy that, although their copy numbers differ by as much as an order of magnitude (see below), all

three b vectors tested in this experiment produce about the same amount of recombinant protein. This suggests that the copy number of the expression vector is not what restricts the accumulation of FTase b under these conditions. Overproduction of ab and a*b FTase Heterodimers Despite the fact that the nominal copy number of the b vector is roughly twice that of the a vector, when the two were combined in X90/DE3 cells and induced simultaneously, a great deal more of the a subunit than the b subunit was produced (Fig. 4A, lanes 4 and 5). An even greater discrepancy was observed when the b subunit was coexpressed with the a* subunit (Fig. 4B, lanes 4 and 5). Hence, although the b subunit accounted for approximately 5% of the total intracellular protein when expressed by itself, it was very poorly expressed in conjunction with either a or a*.

FIG. 2. Schematic illustration of the human FTase a and a* subunits produced by pDW390 and pDW391, respectively. The location of the FLAG-TAG epitope and the cleavage sites for Enteropeptidase and Factor Xa proteases are indicated. The single letter abbreviation for amino acid residues is employed. See text for discussion.

AID

PEP 0794

/

6q16$$$141

11-05-97 22:12:56

pepal

AP: PEP

HIGH-LEVEL EXPRESSION OF Ras FARNESYLTRANSFERASE

237

FIG. 3. Overproduction of individual FTase subunits (a, a* and b) in E. coli. Samples of the total or soluble intracellular protein from an equivalent number of cells were resolved by SDS–PAGE (12% running gel) and stained with Coomassie brilliant blue. (A) Overproduction of the b subunit. Lanes: 1, See-Blue molecular weight standards (Novex); 2, total protein from uninduced X90/DE3[pDW389] cells; 3, total protein from induced X90/DE3[pDW389] cells; 4, soluble protein from induced X90/DE3[pDW389] cells; 5, total protein from uninduced X90/DE3[pDW407] cells; 6, total protein from induced X90/DE3[pDW407] cells; 7, soluble protein from induced X90/DE3[pDW407] cells; 8, total protein from uninduced X90/DE3[pDW408] cells; 9, total protein from induced X90/DE3[pDW408] cells; 10, soluble protein from induced X90/DE3[pDW408] cells. (B) Overproduction of the a and a* subunits. Lanes: 1, See-Blue molecular weight standards (Novex); 2, total protein from induced X90/DE3 cells (no plasmid); 3, total protein from induced X90/DE3[pDW390] cells; 4, soluble protein from induced X90/DE3[pDW390] cells; 5, total protein from induced X90/DE3[pDW391] cells; 6, soluble protein from induced X90/DE3[pDW391] cells. The approximate molecular weights (in kDa) of the See-Blue standards and the positions of the a, a*, and b polypeptides are indicated by arrows adjacent to the photographs. The identity of the FTase subunits was confirmed by western blotting (data not shown).

Rather than determine why the a and a* subunits are preferentially expressed at the expense of the b subunit (as there are a number of possible explanations), instead we attempted to balance the production of the subunits by elevating the copy number of the b vector (pDW389), which should have the effect of increasing the ratio of b:a regulons in the cell. The mechanism by which plasmid copy number is regulated is relatively well understood, and mutations that increase copy number incrementally have been described (34,36,37). We took advantage of this information to construct two derivatives of pDW389 with higher copy numbers. All three b expression vectors are illustrated schematically in Fig. 5. One derivative (pDW407) was constructed by replacing the T7/lac promoter with the original T7 promoter and deleting the rop gene. The former alteration increases the apparent promoter strength slightly (unpublished observations), while the latter increases the copy number by approximately twofold (38,39). A second derivative (pDW408) was constructed by changing the identity of a single base pair in the region near the origin of replication in pDW407. In conjunction with the rop deletion, this mutation increases the copy number to nearly 100 per cell in logphase cultures (40). Analysis of plasmid DNA in lysates of bacterial cultures by visual inspection after agarose gel electrophoresis confirmed that, to a rough approximation, these alterations had the desired impact on the plasmid copy number (data not shown). Cells harboring pDW390 or pDW391 and either pDW389, pDW407 or pDW408 were grown in shake-

AID

PEP 0794

/

6q16$$$141

11-05-97 22:12:56

flasks and induced with IPTG as described under Materials and Methods. Samples of the total and soluble intracellular protein were resolved by SDS–PAGE and visualized by staining with Coomassie brilliant blue. The results for the full-length (ab) and truncated (a*b) heterodimers are presented in Figs. 4A and 4B, respectively. In both instances, as the copy number of the b vector was increased, proportionally more b and less a accumulated in the cells. Consequently, about the same amount of recombinant protein (a / b or a* / b) was produced, irrespective of which b vector was present. The yield of a*b was always greater than that of ab, however. The b vector with an intermediate copy number (pDW407) was sufficient to achieve a reasonable balance between the two subunits that comprise the full-length heterodimer (lanes 7 and 8). Coexpression with the high copy number b vector (pDW408) resulted in an excess of b (lane 10). Less a was produced under these circumstances, and so the yield of ab heterodimers in the soluble extract was somewhat less than what was obtained with the intermediate copy number b vector (compare lanes 8 and 11). On the other hand, only the b vector with the highest copy number was effective at balancing the expression of the b and a* subunits (lanes 10 and 11). In the optimally balanced strains (X90/DE3[pDW390 / pDW407] for ab and X90/DE3 [pDW391 / pDW408] for a*b), the ab and a*b FTase heterodimers constitute approximately 15 and 25% of the soluble protein, respectively, which is between 10 and 100 times more than what was obtained with an optimized dicistronic construct (10).

pepal

AP: PEP

238

TSAO AND WAUGH

mRNA. Indeed, it was from studies of gene regulation in this organism that the operon paradigm emerged (41). In artificial dicistronic constructs, however, the second reading frame often is not expressed as efficiently as the first. We reasoned that if the two subunits of FTase were produced from compatible plasmid vectors instead, then each coding sequence could be placed in an optimal context for high-level expression—that is adjacent to a strong promoter, and within a monocistronic mRNA that is bracketed by stem–loop structures and which contains a strong ribosome binding site in the appropriate position. Another advantage of this approach, which we discovered in the course of this work, is that it affords an opportunity to balance the production of two polypeptides just by manipulating plasmid copy number, which is faster and easier to do than determining why one polypeptide is not expressed as well as the other. One interesting observation to emerge from these experiments is that, no matter what the copy number of the b plasmid was, there was little or no difference in the total amount of recombinant protein that accumulated. As the amount of b in the cell increased (with increasing plasmid copy number), the amount of a or a* diminished to a corresponding degree. This interdependence indicates that something limits the total amount of recombinant protein that can be produced under these experimental conditions. In this regard, it is noteworthy that the capacity of the two systems is quite different: the yield of the a*b heterodimer is consistently greater than that of the ab heterodimer. The FIG. 4. Overproduction of full-length (ab) and truncated (a*b) FTase heterodimers in E. coli. Samples of the total and soluble intracellular protein from an equivalent number of X90/DE3 cells harboring various combinations of plasmid expression vectors (below) were resolved by SDS–PAGE (12% running gel) and stained with Coomassie brilliant blue. The positions of the FTase subunits (a, a* and b) and the approximate molecular weights (in kDa) of the See-Blue standards are indicated by arrows adjacent to the photographs. The identity of the FTase subunits was confirmed by Western blotting (data not shown). (A) The ab heterodimer. Lanes: 1, See-Blue molecular weight standards (Novex); 2, total protein from induced cells containing no plasmids; 3, total protein from uninduced cells containing pDW390 and pDW389; 4, total protein from induced cells containing pDW390 and pDW389; 5, soluble protein from induced cells containing pDW390 and pDW389; 6, total protein from uninduced cells containing pDW390 and pDW407; 7, total protein from induced cells containing pDW390 and pDW407; 8, soluble protein from induced cells containing pDW390 and pDW407; 9, total protein from uninduced cells containing pDW390 and pDW408; 10, total protein from induced cells containing pDW390 and pDW408; 11, soluble protein from induced cells containing pDW390 and pDW408. (B) The a*b heterodimer. Lanes: same as in (A), except that the cells contained pDW391 instead of pDW390.

DISCUSSION

The standard way of coordinating the production of two polypeptides in E. coli is to utilize a dicistronic

AID

PEP 0794

/

6q16$$$141

11-05-97 22:12:56

FIG. 5. FTase b expression vectors. Schematic illustration of three plasmid vectors designed to express the b subunit of FTase. Plasmids are shown in linear form with end points corresponding to the location of the unique EcoRI site. All three vectors are derivatives of the pMB1 (ColE1) replicon with differing copy numbers. pDW389 has the same copy number control circuitry as the parent vector. pDW407 lacks the rop/rom gene, a negative regulator of copy number. pDW408 also lacks rop/rom and has, in addition, a single nucleotide substitution near the beginning of the RNA I transcript, which results in a further increase in copy number.

pepal

AP: PEP

HIGH-LEVEL EXPRESSION OF Ras FARNESYLTRANSFERASE

total amount of recombinant protein that accumulates in cells producing the truncated heterodimer approaches the maximum that can be achieved in E. coli, at which point ribosomes begin to fall apart and cell viability is compromised (42). Hence, what limits the amount of recombinant protein in this case is probably the inherent capacity of the cells for overproduction of a protein. The yield of ab heterodimer falls well short of this mark, however, and so something else must restrict its accumulation relative to that of a*b. Whatever this is, it must be attributable to the additional 150 bp of DNA that is contained in the a regulon. Why is the full length a gene expressed less efficiently than its truncated counterpart? Since the 5* untranslated regions and the first 14 codons of the two mRNAs are identical, it is not immediately obvious how translation initiation might be affected by this difference. Moreover, there are no codons within this 150-bp interval of the a gene that are infrequently used in E. coli. The only distinguishing feature of this region appears to be its extremely GC-rich nature. Perhaps an unusually stable secondary structure in this part of the mRNA acts as an impediment to translation elongation. Further work will be required to resolve this question. The approach outlined here is only one of several methods that could be used to balance the production of two recombinant polypeptides expressed from compatible plasmid vectors in E. coli. Another possibility would be to take advantage of two different inducible promoters, each of which can be incrementally derepressed. Recently, expression vectors featuring the arabinose-inducible BAD promoter (PBAD) have become generally available (43–45). One of these could be used in conjunction with a lactose (or IPTG) regulated promoter. Alternatively, if the promoters on the two plasmid expression vectors are of the same general type, then it should be possible to balance the production of two polypeptides by manipulating the strength of one or both promoters. Many T7 promoter mutations have been constructed or isolated and the strength of the mutant promoters measured in vitro and in vivo (46,47). A similar database exists for variants of the lac promoter (48–50). Initially, both plasmids would be configured with the strongest possible promoter. Then the promoter that regulates the more efficiently expressed gene could be weakened by mutation, incrementally, until a satisfactory balance is achieved. In conclusion, we have shown that if two recombinant polypeptides are produced from individual plasmid expression vectors rather than from an artificial dicistronic regulon, then their relative proportions can be altered in a predictable fashion by manipulating the copy number of one or both vectors. This approach leads to balanced expression of the two genes, while still maintaining a maximal level of protein synthesis. A further advantage of this method is that it does not

AID

PEP 0794

/

6q16$$$141

11-05-97 22:12:56

239

require that the cause of the imbalance be determined in order to correct it. ACKNOWLEDGMENTS We gratefully acknowledge J. Duker and D. Larigan for assistance with automated DNA sequencing, M. Brown and J. Goldstein for their gift of anti-FTase antisera and pure rat FTase, D. Weber and R. Palermo for purifying the human ab and a*b FTase heterodimers and demonstrating that they are enzymatically active, and E. RiosFredrickson for assistance with the preparation of the manuscript.

REFERENCES 1. Denhardt, D. T. (1996) Signal-transducing protein phosphorylation cascades mediated by Ras/Rho proteins in the mammalian cell: The potential for multiplex signalling. Biochem. J. 318, 729–747. 2. McCormick, F. (1995) Ras-related proteins in signal transduction and growth control. Mol. Reprod. Dev. 42, 500–506. 3. Maruta, H., and Burgess, A. W. (1994) Regulation of the Ras signalling network. Bioessays 16, 489–496. 4. Spaargaren, M., Bischoff, J. R., and McCormick, F. (1995) Signal transduction by Ras-like GTPases: A potential target for anticancer drugs. Gene Expression 4, 345–356. 5. Prendergast, G. C., and Gibbs, J. B. (1994) Ras regulatory interactions: Novel targets for anti-cancer intervention? Bioessays 16, 187–191. 6. Gibbs, J. B., Kohl, N. E., Koblan, K. S., Omer, C. A., Sepp-Lorensino, L., Rosen, N., Anthony, N. J., Conner, M. W., deSolms, S. J., Williams, T. M., Graham, S. L., Hartman, G. D., and Oliff, A. (1996) Farnesyltransferase inhibitors and anti-Ras therapy. Breast Cancer Res. Treat. 38, 75–83. 7. Gibbs, J. B., Oliff, A., and Kohl, N. E. (1994) Farnesyltransferase inhibitors: Ras research yields a potential cancer therapeutic. Cell 77, 175–178. 8. Seabra, M. C., Reiss, Y., Casey, P. J., Brown, M. S., and Goldstein, J. L. (1991) Protein farnesyltransferase and geranylgeranyltransferase share a common a subunit. Cell 65, 429– 434. 9. Reiss, Y., Seabra, M. C., Armstrong, S. A., Slaughter, C. A., Goldstein, J. L., and Brown, M. S. (1991) Nonidentical subunits of p21H-ras farnesyltransferase. Peptide binding and farnesyl pyrophosphate carrier functions. J. Biol. Chem. 266, 10672– 10677. 10. Omer, C. A., Kral, A. M., Diehl, R. E., Prendergast, G. C., Powers, S., Allen, C. M., Gibbs, J. B., and Kohl, N. E. (1993) Characterization of recombinant human farnesyl-protein transferase: Cloning, expression, farnesyl diphosphate binding, and functional homology with yeast prenyl-protein transferases. Biochemistry 32, 5167–5176. 11. Ying, W., Sepp-Lorenzino, L., Cai, K., Aloise, P., and Coleman, P. S. (1994) Photoaffinity-labeling peptide substrates for farnesyl-protein transferase and the intersubunit location of the active site. J. Biol. Chem. 269, 470–477. 12. Yokoyama, K., McGeady, P., and Gelb, M. H. (1995) Mammalian protein geranylgeranyltransferase. I. substrate specificity, kinetic mechanism, metal requirements, and affinity labeling. Biochemistry 34, 1344–1354. 13. Pompliano, D. L., Schaber, M. D., Mosser, S. D., Omer, C. A., Shafer, J. A., and Gibbs, J. B. (1993) Isoprenoid diphosphate utilization by recombinant human farnesyl:protein transferase: Interactive binding between substrates and a preferred kinetic pathway. Biochemistry 32, 8341–8347. 14. Furfine, E. S., Leban, J. J., Landavazo, A., Moomaw, J. F., and

pepal

AP: PEP

240

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

TSAO AND WAUGH

Casey, P. J. (1995) Protein farnesyltransferase: Kinetics of farnesyl pyrophosphate binding and product release. Biochemistry 34, 6857–6862. Moomaw, J. F., and Casey, P. J. (1992) Mammalian protein geranylgeranyltransferase: Subunit composition and metal requirements. J. Biol. Chem. 267, 17438–17443. Chen, W.-J., Moomaw, J. F., Overton, L., Kost, T. A., and Casey, P. J. (1993) High level expression of mammalian protein farnesyltransferase in a baculovirus system. J. Biol. Chem. 268, 9675–9680. Huang, C.-C., Casey, P. J., and Fierke, C. A. (1997) Evidence for a catalytic role of zinc in protein farnesyltransferase. Spectroscopy of Co2/-farnesyltransferase indicates metal coordination of the substrate thiolate. J. Biol. Chem. 272, 20–23. Andres, D. A., Goldstein, J. L., Ho, Y. K., and Brown, M. S. (1993) Mutational analysis of a-subunit of protein farnesyltransferase. J. Biol. Chem. 268, 1383–1390. Mitsuzawa, H., Esson, K., and Tamanoi, F. (1995) Mutant farnesyltransferase beta subunit of Saccharomyces cerevisiae that can substitute for geranylgeranyltransferase type I beta subunit. Proc. Natl. Acad. Sci. USA 92, 1704–1708. Pellicena, P., Scholten, J. D., Zimmerman, K., Creswell, M., Huang, C. C., and Miller, W. T. (1996) Involvement of the alpha subunit of farnesyl-protein transferase in substrate recognition. Biochemistry 35, 13494–13500. Fu, H. W., Moomaw, J. F., Moomaw, C. R., and Casey, P. J. (1996) Identification of a cysteine residue essential for activity of protein farnesyltransferase: Cys299 is exposed only upon removal of zinc from the enzyme. J. Biol. Chem. 271, 28541–28548. Del Villar, K., Mitsuzawa, H., Yang, W., Sattler, I., and Tamanoi, F. (1997) Amino acid substitutions that convert the protein substrate specificity of farnesyltransferase to that of geranylgeranyltransferase type I. J. Biol. Chem. 272, 680–687. Park, H.-W., Boduluri, S. B., Moomaw, J. F., Casey, P. J., and Beese, L. S. (1997) Crystal structure of protein farnesyltransferase at 2.25 angstrom resolution. Science 275, 1800–1804. Mayer, M. P., Prestwich, G. D., Dolence, J. M., Bond, P. D., Wu, H., and Poulter, C. D. (1993) Protein farnesyltransferase: Production in Escherichia coli and immunoaffinity purification of the heterodimer from Saccharomyces cerevisiae. Gene 132, 41–47. Amann, E., Brosius, J., and Ptashne, M. (1983) Vectors bearing a hybrid trp-lac promoter useful for regulated expression of cloned genes in E. coli. Gene 25, 167–178. Studier, F. W., Rosenberg, A. H., Dunn, J. J., and Dubendorff, J. W. (1991) Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 186, 60–89. Chen, W.-J., Andres, D. A., Goldstein, J. L., Russell, D. W., and Brown, M. S. (1991) cDNA cloning and expression of the peptidebinding b subunit of rat p21ras farnesyltranferase, the counterpart of yeast DPR1/RAM1. Cell 66, 327–334. Andres, D. A., Milatovich, A., Ozeelik, T., Wenzlau, J. M., Brown, M. S., Goldstein, J. L., and Francke, U. (1993) cDNA cloning of the two subunits of human CAAX farnesyltransferase and chromosomal mapping of FNTA and FNTB loci and related sequences. Genomics 18, 105–112. Chang, A. C. Y., and Cohen, S. N. (1978) Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the p15A cryptic miniplasmid. J. Bacteriol. 134, 1141–1156. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) ‘‘Molecular Cloning: A Laboratory Manual,’’ 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

AID

PEP 0794

/

6q16$$$141

11-05-97 22:12:56

31. Sanger, F. S., Nicklen, S., and Coulson, A. R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463–5467. 32. Miller, J. H. (1972) ‘‘Experiments in Molecular Genetics,’’ Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 33. Laemmli, U. K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685. 34. Davison, J. (1984) Mechanism of control of DNA replication and incompatibility in ColE1-type plasmids—A review. Gene 28, 1–15. 35. Hopp, T. P., Prickett, K. S., Prica, V., Libby, R. T., March, C. J., Cerretti, P., Urdal, D. L., and Conien, P. J. (1988) A short polypeptide marker sequence useful for recombinant protein identification and purification. Biotechnology 6, 1205–1210. 36. Polisky, B. (1988) ColE1 replication control circuitry: Sense from antisense. Cell 55, 929–932. 37. Cesareni, G., Helmer-Citterich, M., and Castagnoli, L. (1991) Control of ColE1 plasmid replication by antisense RNA (a review). Trends Genet. 7, 230–235. 38. Twigg, A. J., and Sherratt, D. (1980) Trans-complementable copy number mutants of plasmid ColE1. Nature 283, 216–218. 39. Cesareni, G., Muesing, M. A., and Polisky, B. (1982) Control of ColE1 DNA replication: The Rop gene product negatively affects transcription from the replication primer promoter. Proc. Natl. Acad. Sci. USA 79, 6313–6317. 40. Lin-Chao, S., Chen, W.-T., and Wong, T.-T. (1992) High copy number of the pUC plasmid results from a Rom/Rop-suppressible point mutation in RNA II. Mol. Microbiol. 6, 3385–3393. 41. Jacob, F., and Monod, J. (1961) Genetic regulatory mechanisms in the synthesis of proteins. J. Mol. Biol. 3, 318–356. 42. Dong, H., Nilsson, L., and Kurland, C. G. (1995) Gratuitous overexpression of genes in Escherichia coli leads to growth inhibition and ribosome destruction. J. Bacteriol. 177, 1497–1504. 43. Cagnon, C., Valverde, V., and Masson, J.-M. (1991) A new family of sugar inducible vectors for Escherichia coli. Protein Eng. 4, 843–847. 44. Guzman, L.-M., Belin, D., Carson, M. J., and Beckwith, J. (1995) Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. J. Bacteriol. 177, 4121–4130. 45. Perez-Perez, J., and Gutierrez, J. (1995) An arabinose-inducible expression vector, pAR3, compatible with ColE1-derived plasmids. Gene 158, 141–142. 46. Ikeda, R. A., Warshamana, G. S., and Chang, L.-L. (1992) In vivo and in vitro activities of point mutants of the bacteriophage T7 RNA polymerase promoter. Biochemistry 31, 9073–9080. 47. Ikeda, R. A., Ligman, C. M., and Warshamana, G. S. (1992) T7 promoter contacts essential for promoter activity in vivo. Nucleic Acids Res. 20, 2517–2524. 48. Stefano, J. E., and Gralla, J. D. (1982) Specific and nonspecific interactions at mutant lac promoters in ‘‘Promoters: Structure and Function’’ (Rodriguez, R. L., and Chamberlin, M. J., Eds.), pp. 69–79, Praeger, New York. 49. Reznikoff, W. S., Maquat, L. E., Munson, L. M., Johnson, R. C., and Mandecki, W. (1982) The lac promoter: Analysis of structural signals for transcription, initiation, and identification of a new sequence-specific event in ‘‘Promoters: Structure and Function’’ (Rodriguez, R. L., and Chamberlin, M. J., Eds.), pp. 80–95, Praeger, New York. 50. Kobayashi, M., Nagata, K., and Ishihama, A. (1990) Promoter selectivity of Escherichia coli RNA polymerase: Effect of base substitutions in the promoter 035 region on promoter strength. Nucleic Acids Res. 18, 7367–7372.

pepal

AP: PEP