- Email: [email protected]
Balloon catheterization induces arterial expression of new Tenascin-C isoform
Atherosclerosis 161 (2002) 75 – 83 www.elsevier.com/locate/atherosclerosis
Balloon catheterization induces arterial expression of new Tenascin-C isoform Kurt Wallner, Prediman K. Shah, Behrooz G. Sharifi * Atherosclerosis Research Center, Di6ision of Cardiology, Burns and Allen Research Institute, Cedars-Sinai Medical Center, UCLA School of Medicine, Los Angeles, CA 90048, USA Received 20 November 2000; received in revised form 30 April 2001; accepted 9 May 2001
Abstract Migration of smooth muscle cells (SMCs) across the internal elastic lamina is a key step in the development of atherosclerotic or restenotic plaques. Cell movement is a complex and highly dynamic phenomenon, involving the continuous formation and breakage of attachments with the underlying substratum. Tenascin-C (Tn-C), a counter-adhesive extracellular matrix protein, is comprised of several isoforms with distinct biological activities. Neither the structure nor function of these isoforms in SMCs has been defined. We have used primers and RT-PCR to fully identify Tn-C isoforms expressed by SMCs. Cloning and sequence analysis of the PCR product indicated that SMCs express a Tn-C isoform with only repeats A1 and A2 of fibronectin type III repeats. Using A1A2-specific antibodies, cDNA probes and RNase mapping, we observed that the A1A2 isoform is predominantly expressed by cultured SMCs derived from aorta of newborn rats, and its expression is up-regulated by PDGF-BB. In contrast, the expression of this isoform is markedly down-regulated in the SMCs derived from adult rat aorta. Western and Northern blots of injured rat carotid arteries revealed that the A1A2-isoform is expressed in response to injury. Using cultured SMCs, we found that the recombinant A1A2 protein that was found in the newly discovered Tn-C isoform promotes SMC chemotaxis. We conclude that Tn-C isoforms are expressed in a regulated fashion in vascular system. Our findings suggest a new role of Tn-C isoforms in the remodeling of vascular wall. © 2002 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Extracellular matrix; Restenosis; Smooth muscle cell; Tenascin-C; Chemotaxis; Arterial injury
1. Introduction The extracellular matrix (ECM) is both a regulator and a target of the tissue remodeling that accompanies embryogenesis and adult tissue repair. One ECM protein, Tn-C is expressed in a rigidly controlled temporospatial pattern in a developing fetus, yet becomes virtually undetectable in the corresponding regions of the intact adult organ. Injury re-induces Tn-C expression within 1–24 h in almost all tissues, including skin [1 – 4], muscle [5], arteries [6,7], brain or nerves [8,9]. In these regenerating tissues, Tn-C has been found to play a role in cell growth [10 – 12], movement [13], endothe
This paper was supported by the National Institute of Health grant HL50566, Established Investigator Award 0040201N from the American Heart Association, and the EISNER Foundation. * Corresponding author. Tel.: + 1-310-423-7621; fax: + 1-310-4230299.
lial cell sprouting [14], and matrix metalloproteinase gene expression [15]. The role of Tn-C in diseased blood vessels, however, is incompletely defined. We have previously shown that although Tn-C is not expressed in the control normal adult human mammary artery or saphenous veins, it is uniformly and strongly expressed in the adventitia and media of patent human vein grafts [16] and in human atherosclerotic plaques [17]. The potential role of Tn-C in cell migration and proliferation is suggested by studies of cultured SMCs. We have demonstrated that Tn-C blocks adhesion of SMCs to fibronectin [18], and promote SMC migration [19]. Cell detachment and chemotaxis are the principle steps in cell migration. Others have reported that Tn-C stimulates SMC proliferation [11]. Thus Tn-C is involved in migration and proliferation, the two principal action of SMC’s after vascular injury.
0021-9150/02/$ - see front matter © 2002 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0 0 2 1 - 9 1 5 0 ( 0 1 ) 0 0 6 2 7 - X
76
K. Wallner et al. / Atherosclerosis 161 (2002) 75–83
Tn-C is expressed in several isoforms, which are generated by differential splicing of fibronectin type III repeats [20]. These alternatively spliced repeats have been named A1, A2, A3, A4, B, C, and D. The structural diversity of these isoforms results in distinct functional activity [21,22]. The isoforms have distinct tissue distributions and cellular origins [21,23– 26]. The nature of isoform produced by arterial SMCs is unknown. In the present study, we have cloned and identified a new isoform of Tn-C which contains two alternativelyspliced A1A2 units. Using isoform-specific antibodies and probes, we have shown that the A1A2 isoform of Tn-C is primarily expressed in injured arteries. Cell culture studies revealed that newborn and fetal human and rat SMCs prominently express this isoform. In addition, we found that this isoform promotes SMC chemotaxis but not adhesion or proliferation. This is the first evidence that a specific domain of the Tn-C molecule has chemotactic activity. Taken together with previous studies, these new results suggest that the Tn-C molecule contains separate domains which promote cell detachment, chemotaxis, and proliferation that are the essential elements in the SMC response to injury.
2. Material and methods
2.1. Materials Dulbecco’s modified Eagles medium (DME/F12) and trypsin/EDTA were from Irvine Scientific, Irvine, CA. Fetal calf serum (FCS) was from Gibco, Gaithersburg, MD. Guanidine thiocyanate was obtained from Boehringer Mannheim Biochemicals, Indianapolis, IN. Prestained protein standards were from Bio-Rad, Richmond, CA.
2.2. PCR and cloning Cloning of the A1A2 was performed essentially as described before [18]. Briefly, total RNA was extracted from rat aortic SMC treated for 2 h with angiotensin II. First-strand cDNA synthesis was performed on 2 mg of total RNA, followed by revers transcription using Vent polymerase (New England Biolabs). The primers: 5%GGAATTCAGAAAGGCAGACACAAGAGCAAG3% and, 5%-GGAATTCTGAGTCNGTGATGTTGGCTNTCA-3% (Operon Technologies, Alameda CA), were designed with EcoRI sites at the 5% end. After PCR, the products were size fractionated and ligated into the pBluescript II SK+ (Strategene). Transformation of HB101 competent cells (Gibco BRL) was followed by ampicillin selection. White colonies were grown for restriction enzyme analysis, and positive clones were
sequenced using Sequenase (United States Biochemical, Cleveland, OH). Sequence analysis was done using the Wisconsin Sequence Analysis Package (Genetics Computer Group, Madison, WI).
2.3. Expression of A1A2 recombinant protein We used E. coli PET expression system to express the recombinant FN units [27]. The primers were targeted to the exact boundaries of the A1A2 repeat with no extraneous amino acids. In the forward primer, a NdeI site was positioned immediately before the A1-specific sequences such that the ATG of the restriction site would become the start codon of the recombinant peptide. A stop codon (TAA) was designed into the reverse primer, and positioned immediately after the last codon of the A2 repeat. This was followed by a BamHI site which, together with the NdeI site, provided for unidirectional ligation downstream from the T7 promoter in the expression vector pET11a (Novagen, Madison, WI). The cloned isoform was resequenced to ensure that no errors were introduced during the cloning process. The resultant construct was transformed into the E. coli expression host BL21 (DE3) (Novagen), which contains a chromosomal copy of T7 RNA polymerase under the control of the lac operator. Clonal cultures were grown in LB media, containing 50 mg/ml carbenicillin to a density of approximately 0.6 at A 600, whereupon expression was induced with various concentration of IPTG for 3 h. The induced bacteria synthesized abundant 18 kDa soluble A1A2 protein. The recombinant protein was recognized by polyclonal antibodies to Tn-C using a Western blot (not shown).
2.4. Purification of recombinant A1A2 and production of antibodies After induction, E. coli were collected, lysed, centrifuged, and total supernatant protein was precipitated with 50% ammonium sulfate. The ammonium sulfate pellet was resuspended in PBS and passed through gel filtration column (Sephacryl S200, Pharmacia). Eluted fractions were tested for the presence of the 18 kDa protein by SDS-PAGE. Peak fractions were pooled and dialyzed against 20 mM Tris, pH 8.0. Thereafter, the dialysate was loaded onto a Q-Sepharose FPLC column (Pharmacia). The column was eluted with a gradient of 20–1000 mM NaCl in the Tris buffer. Peak fractions were pooled, and further purified by hydroxylapatite HPLC column (BioRad) using 20 –450 mM phosphate buffer containing 0.01 CaCl2, pH 6.8. The peak fractions containing only one single 18 kDa band were pooled and concentrated with an Amicon YM10 membrane. After desalting, this sample was used for N-ter-
K. Wallner et al. / Atherosclerosis 161 (2002) 75–83
77
minal sequencing (UCLA Microsequencing Core Facility). The sequence of the N-terminal 25 amino acid residues was identical to the expected A1A2 sequence, confirming the veracity of the recombinant protein. No heterogeneity was detected in the N-terminal sequence or amino acid composition. The elution profile of the purified A1A2 protein on G125 gel filtration HPLC (BioRad) was consistent with its purity and its monomeric structure. The purified A1A2 protein was used to immunize two chickens (BAbCo). The titer of the antibodies was determined by ELISA, the eggs from chickens with the highest titer were pooled, and the IgY antibodies were purified with Promega chicken antibody purification kit as suggested by the manufacturer. The antiserum was further purified by affinity chromatography, using A1A2 recombinant protein coupled to CNBr-activated Sepharose (Sigma). The bound antibodies were eluted using 0.1 M glycine/HCl (pH 2.6) and the eluate was immediately neutralized. The specificity of the antibodies was established by Western blot. The A1A2-specific antibodies recognized the A1A2 protein, but not other recombinant domains of Tn-C such as repeat D of the fibronectin type III repeat or the fibrinogen-like domain. In addition, the antibodies recognized intact large isoform of Tn-C, but not other matrix proteins such as fibronectin and laminin (not shown).
with PDGF-BB for 4 and 24 h. Total RNA (20 mg) was hybridized with the A1A2-specific rat riboprobe essentially as described [18]. Yeast tRNA was used as a negative control. Hybrids were digested with RNase One (Promega, Madison WI) and resolved on 6% polyacrylamide gel. Hpa II-digested pBR322 plasmid was used as a molecular weight marker.
2.5. Cell culture and Western blot
2.8. Cell migration assay
Adult rat SMC were isolated by enzymatic digestion of 3-month-old rat (Sprague– Dawley) aorta, and cultured as previously described [18]. Neointimal, medial and pup SMC provided by Dr Schwartz (University of Washington), and cultured as described [19]. The neointimal cells were derived from pooled established rat neointima isolated 2 weeks after balloon injury. Cultured cells (passages 3– 7) were grown to confluency, growth arrested, and treated with agonists for 24 h as described [18]. The media were collected and analyzed by Western blot using A1A2-specific antibodies. For Western blot, we used ECL kit (Amersham).
Cell migration was measured by a modification of the Boyden’s chamber method essentially as described [19]. Briefly, polycarbonate filters were coated with 10 mg/ml of substrates overnight at 4 °C. Newborn rat SMCs were suspended at a concentration of 105 cells per ml in serum-free DMEM supplemented with 1 mg/ml BSA. A volume of 50 ml of cell suspension was placed in the upper chamber, and 30 ml of 0.1 mM (in DMEM) of the full-length recombinant A-D, A1A2, and D repeats were placed in the lower chamber. For negative and positive controls, some of the lower chamber received 30 ml of 1 mg/ml BSA and 1 nM PDGF-BB, respectively. The chamber was incubated at 37 °C under 5% CO2 in air for 4 h. The filter was removed, and the cells on the upper side of the filter were scraped off. The SMCs that had migrated to the lower side of the filter were fixed in methanol, stained with Diff-Quick staining solution (Baxter) and counted under a microscope.
2.6. RNA isolation, Northern blot, and RNase protection assay RNA isolation and Northern blot was performed essentially as described [28]. Briefly, cells were treated with 1 nM PDGF-BB for the indicated times. Thereafter, cells were lysed with guanidine thiocyanate, and RNA was isolated by centrifugation through a cesium chloride cushion. The RNA was quantified and 20 mg per lane was analyzed by electrophoresis followed by blotting. The blots were probed with the A1A2-specific cDNA probe. For the RNase protection assay, SMC subtypes maintained in serum-free media or treated
2.7. Arterial injury Male Sprague–Dawley rats (450–500 g) were anesthetized and acute injury to the left common carotid artery was made with an 2F embolectomy catheter as described [29]. At the indicated times after injury, animals were sacrificed. Arteries were stripped of periadventitial fatty and connective tissues in PBS at 4 °C. After the endothelium of the uninjured carotid artery was stripped, both arteries were snap frozen in liquid nitrogen for subsequent RNA and protein extraction. RNA was extracted by guanidine thiocyanate [30]. Since extraction of Tn-C from tissues is difficult, we used an extraction buffer that has proved to be very effective. This buffer is composed of 100 mM CAPS, 150 mM NaCl, pH 11 [31]. The extracted proteins were measured by the Coomasie blue assay and analyzed by Western blot using 5% SDS-PAGE. The A1A2-specific antibodies were used at 1:5000 dilution.
3. Results We have previously reported the cloning and characterization of a new Tn-C isoform containing only one alternatively spliced fibronectin repeat (FN) in cultured SMC [18]. Our strategy for cloning the alternatively
78
K. Wallner et al. / Atherosclerosis 161 (2002) 75–83
Fig. 1. Comparison of the fibronectin-like domains (FN) of human, mouse and rat Tn-C. The number of FN repeats depends on mRNA splicing variants. The first five and the last three FN domains (black boxes) are constitutively expressed, and the other FN repeats (white boxes) are either included or skipped. The partial sequence of human and mouse Tn-C were taken from the data of Gulcher et al. [43] and Weller et al. [33], respectively.
spliced region of rat Tn-C was based on the known sequence of the human cDNA [32]. The 5%-primer was designed 46 bases upstream from the 5%-splicing junction, whereas 3%-primer was localized 300 bases downstream from the 3%-splicing junction. With these primers, we could detect only one intermediate-size Tn-C isoform, containing a D repeat [18]. To increase the likelihood of detecting other, possibly longer isoforms, we redesigned our primers, emphasizing a reduction in the distance between the 5% and 3% primers. Therefore, primers were designed to target the exact boundaries of the spliced region; the 5% primer comprising the last 20 bases of FN5, whereas the 3% primer consists of the 5%-most bases of FN6. Total RNA extracted from SMC treated with PDGF-BB was used as a template for RT-PCR. The generation of cDNA and its amplification by PCR were essentially as described [18]. In addition to the expected bands corresponding to mRNA of the previously described spliced isoforms, another band of approximately 600 bases was
observed. Since each FN repeat is approximately 270 bp long, we reasoned that this size would represent two FN repeats plus the flanking primers. To identify the PCR product, it was cut out of the gel, purified, ligated into a pBluescript II, and sequenced. To ensure that we did not overlook other potential splicing variants, we designed primers flanking A2 and A4, as well as B and D. We did not detect other splicing variants by PCR. Sequencing of the 600 bp PCR product confirmed that it corresponds to two FN repeats. To assign the FN repeats, the sequences were compared with that of human and mouse Tn-C using the sequence analysis software package of the University of Wisconsin Genetic Computer Group (Fig. 1). The designation of the rat cDNA FN repeats was determined by optimizing the alignment with the mouse and human sequences [32,33]. Searches of the GenBank, EMBL, and PIR databases with the 600 base sequence revealed 83 and 85% homology with human A1 and A2 repeats, respectively. Comparison of the amino acid sequences of the rat fibronectin type III repeats revealed that they are homologues of the human A1and A2 fibronectin type III repeats. We have found the expression of the same isoform in the cultured fetal human SMCs using the above strategy. Thus, we conclude that cultured SMCs express the A1A2-isoform in addition to the previously described D-isoform. In this new isoform, however, the repeats A1 and A2 are linked to the constitutively expressed FN5 and 6 U, respectively, possibly generating a unique conformation. Since the expression of Tn-C isoforms are believed to be regulated during development [33,34], we determined the expression of the A1A2 isoform in cultured SMCs derived from adult and newborn (pup) rat aorta. Cells were treated with PDGF-BB for various times and total RNA was analyzed by Northern blot using the A1A2 cDNA [18]. This probe hybridizes with any Tn-C isoform which contains the A1A2 repeats including the large isoform. As shown in Fig. 2, the cDNA probe
Fig. 2. Effect of PDGF-BB on the expression of Tn-C mRNAs by cultured SMC. Adult and pup SMCs were treated with 1 nM of PDGF-BB for the indicated times (in hours). Control cultured cells (0) were maintained in 1% serum. Total RNA was extracted and analyzed by Northern blot using the 1.7 A1A2 cDNA probe. To evaluate loading uniformity, the blot was rehybridized with glyceraldehyde-phosphate dehydrogenase (GAPDH) cDNA probe.
K. Wallner et al. / Atherosclerosis 161 (2002) 75–83
Fig. 3. Expression pattern of Tn-C isoform mRNAs in SMC subsets by PDGF-BB. The [32P]-labeled riboprobe was hybridized with RNA prepared from SMC subsets treated with PDGF-BB for the indicated time (h), and digested with ribonuclease. Arrows in the left margin indicate the position of the expected fragments protected by Tn-C mRNA variants. The size of the protected bands represents: 440 bp large, 405 bp A1A2, and 130 bp small isoforms. The left lane indicates the undigested probe (probe).
detected two Tn-C mRNA species in adult and pup SMCs. Consistent with our previous data, Tn-C was not detected in the untreated cells. Addition of PDGFBB to the adult cells induced the 8.4 kb and 7.0 kb Tn-C transcripts at 2 and 4 h, respectively. The intensity of the two transcripts was nearly equal at 6 h (Fig. 2). Both transcripts were down-regulated at 24 h. In contrast to the adult cells, pup cells primarily expressed the 7.0 kb transcript (Fig. 2).
79
Since the A1A2 cDNA probe detects all isoforms that contain the A1A2 repeats, to specifically identify and quantify the expression of the A1A2-isoform, we have developed a riboprobe that allows simultaneous detection and quantitation of the relative amount of Tn-C mRNA species. The approximate anticipated protected band sizes are as follows: large, 440 bases; A1A2, 405 bases; small, 130 bases. The sizes of the protected bands were identical to that which we anticipated. In addition to the adult and pup cells, we have examined the expression of the isoforms in cultured SMC subtypes derived from media and neointima of adult rat carotid arteries. At time zero, in all SMC subtypes, Tn-C mRNA was barely detectable (Fig. 3). Addition of PDGF-BB markedly induced the overall expression of the individual isoforms. The pup SMCs express predominantly the A1A2 isoform, whereas adult cells, including medial cells, equally expressed all three isoforms. These results confirm that pup cells primarily express the A1A2-isoform. To determine whether the A1A2-isoform protein is expressed in vitro and in vivo, we raised antibodies to the full-length recombinant A1A2 repeats. We used chicken as a host to get high titer antibodies as these repeats are highly conserved in mammals. The antibodies were purified by A1A2-affinity chromatography and their specificity was established by Western blot. As shown in Fig. 4, this antibody recognized exclusively a faint high molecular weight Tn-C variant in the conditioned media of the control pup cells that migrated at approximately 240 kDa (lane C). Addition of PDGFBB (lane 1) or angiotensin II (lane 2) to pup cells markedly increased the intensity of the 240 kDa band with little effect on the synthesis of the 280 kDa protein. In contrast, in the adult cells, these factors predominantly increased the synthesis of the 280 kDa protein. The 240 kDa band is most likely the A1A2-isoform because of its size and its interaction by the A1A2-specific antibodies. The 280 kDa is the large isoform that contains the A1A2 units. We conclude
Fig. 4. Characterization of anti A1A2 antibodies: Recombinant A1A2 protein was used to make polyclonal antibodies as described in Section 2. After purification, the antibody was characterized by Western blot. (A) Tenascin (Tn) fibronectin (Fn) and laminin (Lm) was run under reducing condition on 5% SDS-PAGE. (B) Recombinant A-D, A1A2, D, and Fbg-C was run under reducing condition on 10% SDS-PAGE. After transfer, the blots were probed by the purified anti-A1A2 antibodies.
80
K. Wallner et al. / Atherosclerosis 161 (2002) 75–83
Fig. 5. Synthesis of Tn-C isoforms by newborn and adult aortic SMCs. Quiescent cultures of pup (lanes 1 and 2) and adult (lanes 3 and 4) SMCs were treated with 1 nM PDGF-BB for 24 h. The untreated cells (C) were maintained in 1% serum. The media were collected and analyzed by Western blot using 1:5000 dilution of A1A2 isoform-specific antibodies. Arrows indicated the positions of A1A2 isoform (240 kDa) and large isoform (280 kDa).
that the A1A2-isoform is synthesized and secreted by primary cultures of SMCs, and that this isoform is the major fraction of Tn-C variant produced by pup aortic cells. To determine whether the A1A2-isoform is expressed in vivo, proteins extracted from uninjured and ballooninjured rat carotid arteries were analyzed by Western blot using A1A2-specific antibodies. Tn-C was not detected in the control arteries (Fig. 5, lane 0). Small level of Tn-C was detected 1 and 2 days after balloon injury. A strong expression was detected at 3– 4 days after injury followed by down-regulation 5– 6 days after wounding. Tn-C was strongly re-expressed 7 and 14 days after injury (Fig. 5). The overall expression of Tn-C isoforms was generally lower during the first phase of arterial injury (3– 4 days) compared with the second phase (7–14 days). This differential protein expression can not be explained by the variation in protein loading, because reprobing the blot with smooth muscle-specific anti-a-actin antibodies showed nearly uniform loading (Fig. 6). Since the timing of the expression of the A1A2 isoform in the balloon-injured arteries coincides with the active cell proliferation and migration, we reasoned that this isoform may be involved in the modulation of these events. To explore these possibilities, the recombinant A1A2 was added to quiescent culture of SMCs and DNA synthesis was measured at 24 and 48 h. We found no evidence that the A1A2 protein affects cell growth (not shown). We next examined its effect on cell chemotaxis. As shown in Fig. 7, the A1A2 protein promoted SMC chemotaxis on Tn-C substrate. The level of activity was comparable to that of the positive control, PDGF-BB. Other recombinant domains of Tn-
C such as the full-length alternatively spliced A-D, fibronectin type III repeat D, and fibrinogen-like domain had no effect. The effect of the A1A2 protein is specific to Tn-C, because it had no effect on cell migration on collagen substrate. We conclude that the chemotactic activity of A1A2 repeats is specific and that the direct interaction between SMCs and Tn-C is essential for activity of the A1A2-isoform.
4. Discussion In this study, we demonstrate that cultured aortic cells express at least four isoforms of Tn-C. One of these isoforms, which is produced by alternative splicing of A1 and A2 repeats displays chemotactic activity. This action is clearly different from SMC adhesive activity, which is regulated by the fibrinogen-like domain of Tn-C [19]. In contrast, the A1A2 repeat has no effect on SMC adhesion. Previous reports suggested
Fig. 6. Expression of Tn-C isoforms in injured rat carotid arteries. Proteins were extracted from uninjured (0) and injured left carotid arteries at the indicated times (days) after balloon injury (15 vessels pooled per time point). The extract (100 mg per lane) was analyzed by 5% SDS-PAGE followed by immunoblotting using 1:5000 dilution of A1A2-specific antibodies. The blot was stripped and reprobed with smooth muscle-specific a-actin (40 kDa protein) antibodies (Dako).
K. Wallner et al. / Atherosclerosis 161 (2002) 75–83
Fig. 7. The effect of the recombinant A1A2 protein on SMC chemotaxis. Polycarbonate filters were coated with a solution of 10 mg/ml of BSA, collagen, large (Tn-L) or small (Tn-S) isoform of tenascin-C substrates. The chemotactic factors include solutions of 1 mM of the recombinant domains of Tn-C corresponding to the fibronectin repeats A1A2, A-D, D, and the fibrinogen-like domain (Fbg-C). BSA (1 mg/ml) and PDGF-BB (20 ng/ml) were used as negative and positive controls, respectively. Cell migration was measured as described in Section 2 [19]. Migrating cells were fixed and counted under a microscope. Nine high power fields (HPF) were counted for each triplicates. Values shown are from a representative experiment as mean 9S.E.M.
that stimulation of cell migration by Tn-C is mediated by its ability to down-regulate focal adhesions [35,36] and/or its counter-adhesive activity [37]. Our results indicate that Tn-C molecule possesses the capacity to stimulate the three principle activities of SMCs in response to injury, cell detachment, chemotaxis, and proliferation, and each of these activities resides in a different domains and isoforms. We found that the chemotactic activity is quite specific to the isoform that contains only the A1A2 unit. The full-length alternatively spliced A-D segment, which contains the A1A2 unit, does not stimulate SMC chemotaxis. This lack of chemotactic activity within the larger A-D domain may be due to either steric hindrance and/or to differential conformation of the A1A2 units in the A-D segment. Our sequence analysis of the A1 and A2 repeats revealed them to be very hydrophobic, suggesting that they may be located in the interior of molecule. If so, the active site may be covered by other repeats of the A-D domain. It is also possible that the lack of activity of the larger A-D domain may be related to its linkage to other domains. In the A-D units the A2 repeat is linked to the A3 unit, whereas in the A1A2 isoform, the A2 repeat is linked to the constitutively expressed FN repeat 6. A third possibility is that, the presence of the D unit within the A-D domain may affect its overall conformation. The A1 has two strong and one weak N-glycosylation site, and A2 has one strong and one weak site. Both units are strongly hydrophobic. In contrast, the D repeat has no potential N-glycosylation site and is hydrophilic [18]. These differences in hydrophobicity suggest that the A1A2 unit may have a highly folded molecular conformation, whereas the D repeat may have a more relaxed structure. These striking differences in the glycosylation, steric hindrance, and hydrophobic/hydrophylic
81
nature of the two Tn-C isoforms may determine both the tertiary structure of the isoforms and their functions. In addition to differences in the activity of Tn-C domains, we found major distinctions in the ability of SMC subtypes to express the A1A2 isoform. Our specific anti-A1A2 antibodies immunoprecipitated primarily the 240 kDa protein from conditioned media of pup cells, whereas it primarily recognized the large (280 kDa) isoform in the media of adult cells. These results are consistent with our Northern blot data and RNase protection data. Pup cells predominantly express the 7.0 kb mRNA transcript that corresponds to the A1A2 isoform. In the RNase protection assay, the pup cells predominantly expressed A1A2 isoform. This isoform is markedly up-regulated after 4 and 24 h treatment with PDGF-BB, whereas the large isoform is not detectable. In contrast, the A1A2 isoform was not detected under basal conditions in adult cells, and the major isoform found after 24 h of treatment with PDGF-BB was the large isoform. Cells derived from established neointima also predominantly expressed the A1A2 isoform, but not the large isoform. The similarity in the expression of A1A2 isoform between pup and neointimal cells also suggests that they are closely related and that the A1A2 isoform may be a useful marker to differentiate neointimal cells from other SMC subsets. In addition, this similarity appears to be a stable property of these cells, as it remained consistent throughout multiple isolates and passages. We found that expression of the A1A2 isoform occurs in a biphasic manner after vascular injury. In the first phase, the expression of 7.0 kb message and the 240 kDa isoform peak 3–4 days after injury. This timing corresponds to peak of cell migration in the rat balloon injury model [38]. The in vivo kinetic of the A1A2 isoform expression coupled with our cell culture studies suggest that this isoform may mediate chemotactic activity in injured arteries. The reason for the fall in the level of the 240 kDa protein and its mRNA level 5–6 days after injury remains unclear. It is possible that the down-regulation may reflect reduction of medial cell migration and/or absence of factors responsible for the induction of Tn-C. The second peak occurs 7–14 days after balloon injury when neointima is being established. Previous studies on the expression of Tn-C in injured rat arteries did not identify the nature of the Tn-C isoform expressed in response to injury [6,7]. Our data confirm and expand these previous observations by identifying that the A1A2 isoform as one that is expressed in specific response to arterial injury. We have previously reported that only the small isoform of Tn-C was detected in human atheroma [17]. In the present study, however, we found primarily the A1A2 isoform in the injured rat artery. These differences in the expression pattern of isoforms may reflect
82
K. Wallner et al. / Atherosclerosis 161 (2002) 75–83
significant mechanistic differences in the evolution of atheromatous versus restenotic plaques. Although formation of both atherosclerotic and restenotic plaques requires SMC migration [39], these two events may have different pathogenesis. The intimal SMCs of human atheroma may derive from a small population of SMCs that remain in the embryonic state. These cells may undergo clonal expansion during formation of neointima. Alternatively, they may represent mutation of intimal SMCs [39]. In contrast, cell migration in injured rat arteries occurs in response to the serum factors. In these models, serum, specifically PDGF-BB, released by platelets at the site of injury is considered important for SMC migration [40– 42]. Therefore, it is possible that the expression of the A1A2 isoform may be used to differentiate between cell migrations in these two events. In summary, we have identified a new Tn-C isoform that contains only two alternatively spliced fibronectin repeats, the A1 and A2 units. This isoform is primarily expressed by cultured newborn and neointimal SMCs, and in response to arterial injury. Cell culture studies revealed that the A1A2 unit promotes SMC chemotaxis. The timing of expression of this isoform shortly after balloon injury is consistent with the notion that it may behave as a chemotactic factor in vivo. The expression of this isoform both in embryonic development and in the vascular response to balloon injury further advances the hypothesis that adult tissue remodeling recapitulates cellular behavior during development. Establishment of the precise expression pattern of Tn-C isoform expression after vascular injury provides a potential framework for designing targeted interventions to interfere with neointimal hyperplasia. References [1] Mackie EJ, Thesleff I, Chiquet-Ehrismann R. Tenascin is associated with chondrogenic and osteogenic differentiation in vivo and promotes chondrogenesis in vitro. Differentiation 1988;37:104 – 14. [2] Whitby DJ, Longaker MT, Harrison MR, Adzick NS, Ferguson MW. Rapid epithelialisation of fetal wounds is associated with the early deposition of tenascin. J Cell Sci 1991;99:583 –6. [3] Mackie EJ, Halfter W, Liverani D. Induction of tenascin in healing wounds. J Cell Biol 1988;107:2757 –67. [4] Luomanen M, Virtanen I. Distribution of tenascin in healing incision, excision and laser wounds. J Oral Pathol Med 1993;22:41 – 5. [5] Daniloff JK, Crossin KL, Pincon-Raymond M, Murawsky M, Rieger F, Edelman GM. Expression of cytotactin in the normal and regenerating neuromuscular system. J Cell Biol 1989;108:625 – 35. [6] Hedin U, Holm J, Hansson GK. Induction of tenascin in rat arterial injury. Relationship to altered smooth muscle cell phenotype. Am J Pathol 1991;139:649 –56. [7] Majesky MW. Neointima formation after acute vascular injury. Role of counteradhesive extracellular matrix proteins. Tex Heart Inst J 1994;21:78 – 85.
[8] Martini R, Schachner M, Faissner A. Enhanced expression of the extracellular matrix molecule J1/tenascin in the regenerating adult mouse sciatic nerve. J Neurocytol 1990;19:601 – 16. [9] Daniloff JK, Levi G, Grumet M, Rieger F, Edelman GM. Altered expression of neuronal cell adhesion molecules induced by nerve injury and repair. Cell 1986;47:131 – 9. [10] Kanno S, Fukuda Y. Fibronectin and tenascin in rat tracheal wound healing and their relation to cell proliferation. Pathol Int 1994;44:96 – 106. [11] Jones PL, Rabinovitch M. Tenascin-C is induced with progressive pulmonary vascular disease in rats and is functionally related to increased smooth muscle cell proliferation. Circ Res 1996;79:1131 – 42. [12] Jones PL, Cowan KN, Rabinovitch M. Tenascin-C, proliferation and subendothelial fibronectin in progressive pulmonary vascular disease. Am J Pathol 1997;150:1349 – 60. [13] Whitby DJ, Ferguson MW. The extracellular matrix of lip wounds in fetal, neonatal and adult mice. Development 1991;112:651 – 68. [14] Canfield AE, Schor AM. Evidence that tenascin and thrombospondin-1 modulate sprouting of endothelial cells. J Cell Sci 1995;108:797 – 809. [15] Tremble P, Chiquet-Ehrismann R, Werb Z. The extracellular matrix ligands fibronectin and tenascin collaborate in regulating collagenase gene expression in fibroblasts. Mol Biol Cell 1994;5:439 – 53. [16] Wallner K, Li C, Fishbein MC, Shah PK, Sharifi BG. Arterialization of human vein grafts is associated with tenascin-C expression. J Am Coll Cardiol 1999;34:871 – 5. [17] Wallner K, Li C, Shah PK, Fishbein MC, Forrester JS, Kaul S, Sharifi BG. Tenascin-C is expressed in macrophage-rich human coronary atherosclerotic plaque. Circulation 1999;99:1284 –9. [18] LaFleur DW, Fagin JA, Forrester JS, Rubin SA, Sharifi BG. Cloning and characterization of alternatively spliced isoforms of rat tenascin. Platelet-derived growth factor-BB markedly stimulates expression of spliced variants of tenascin mRNA in arterial SMCs. J Biol Chem 1994;269:20757 – 63. [19] LaFleur DW, Chiang J, Fagin JA, Schwartz SM, Shah PK, Wallner K, Forrester JS, Sharifi BG. Aortic smooth muscle cells interact with Tenascin-C through its fibrinogen-like domain. J Biol Chem 1997;272:32798 – 803. [20] Erickson HP, Bourdon MA. Tenascin: an extracellular matrix protein prominent in specialized embryonic tissues and tumors. Annu Rev Cell Biol 1989;5:71 – 92. [21] Chiquet-Ehrismann R, Matsuoka Y, Hofer U, Spring J, Bernasconi C, Chiquet M. Tenascin variants: differential binding to fibronectin and distinct distribution in cell cultures and tissues. Cell Regul 1991;2:927 – 38. [22] Zisch AH, Alessandri DL, Amrein K, Ranscht B, Winterhalter KH, Vaughan L. The glypiated neuronal cell adhesion molecule contactin/F11 complexes with src-family protein tyrosine kinase. Fyn Mol Cell Neurosci 1995;6:263 – 79. [23] Kaplony A, Zimmermann DR, Fischer RW, Imhof BA, Odermatt BF, Winterhalter KH, Vaughan L. Tenascin Mr 220 000 isoform expression correlates with corneal cell migration. Development 1991;112:605 – 14. [24] Prieto AL, Jones FS, Cunningham BA, Crossin KL, Edelman GM. Localization during development of alternatively spliced forms of cytotactin mRNA by in situ hybridization. J Cell Biol 1990;111:685 – 98. [25] Mackie EJ, Tucker RP. Tenascin in bone morphogenesis: expression by osteoblasts and cell type-specific expression of splice variants. J Cell Sci 1992;103:765 – 71. [26] Tucker RP. The in situ localization of tenascin splice variants and thrombospondin 2 mRNA in the avian embryo. Development 1993;117:347 – 58.
K. Wallner et al. / Atherosclerosis 161 (2002) 75–83 [27] Aukhil I, Joshi P, Yan Y, Erickson HP. Cell- and heparin-binding domains of the hexabrachion arm identified by tenascin expression proteins. J Biol Chem 1993;268:2542 –53. [28] Sharifi BG, LaFleur DW, Pirola CJ, Forrester JS, Fagin JA. Angiotensin II regulates tenascin gene expression in vascular smooth muscle cells. J Biol Chem 1992;267:23910 – 5. [29] Dubin D, Peters JH, Brown LF, Logan B, Kent KC, Berse B, Berven S, Cercek B, Sharifi BG, Pratt RE, et al. Balloon catheterization induced arterial expression of embryonic fibronectins. Arterioscler Thromb Vasc Biol 1995;15:1958 – 67. [30] Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate – phenol –chloroform extraction. Anal Biochem 1987;162:156 –9. [31] Lightner VA, Gumkowski F, Bigner DD, Erickson HP. Tenascin/hexabrachion in human skin: biochemical identification and localization by light and electron microscopy. J Cell Biol 1989;108:2483 – 93. [32] Nies DE, Hemesath TJ, Kim JH, Gulcher JR, Stefansson K. The complete cDNA sequence of human hexabrachion (Tenascin). A multidomain protein containing unique epidermal growth factor repeats. J Biol Chem 1991;266:2818 –23. [33] Weller A, Beck S, Ekblom P. Amino acid sequence of mouse tenascin and differential expression of two tenascin isoforms during embryogenesis. J Cell Biol 1991;112:355 –62. [34] Aufderheide E, Ekblom P. Tenascin during gut development: appearance in the mesenchyme, shift in molecular forms, and dependence on epithelial –mesenchymal interactions. J Cell Biol 1988;107:2341 – 9 Published erratum appears in J. Cell. Biol. 1989 Mar;108(3):following 1175. [35] Murphy-Ullrich JE, Lightner VA, Aukhil I, Yan YZ, Erickson HP, Hook M. Focal adhesion integrity is downregulated by the
[36]
[37]
[38]
[39] [40]
[41]
[42]
[43]
83
alternatively spliced domain of human tenascin. J Cell Biol 1991;115:1127 – 36 Published erratum appears in J. Cell. Biol. 1992 Feb;116(3):833. Hahn AW, Kern F, Jonas U, John M, Buhler FR, Resink TJ. Functional aspects of vascular Tenascin-C expression. J Vasc Res 1995;32:162 – 74. Chiquet-Ehrismann R, Kalla P, Pearson CA, Beck K, Chiquet M. Tenascin interferes with fibronectin action. Cell 1988;53:383 – 90. Reidy MA, Schwartz SM. Endothelial regeneration. III. Time course of intimal changes after small defined injury to rat aortic endothelium. Lab Invest 1981;44:301 – 8. Schwartz SM. Smooth muscle migration in atherosclerosis and restenosis. J Clin Invest 1997;100:S87 – 9. Fingerle J, Johnson R, Clowes AW, Majesky MW, Reidy MA. Role of platelets in smooth muscle cell proliferation and migration after vascular injury in rat carotid artery. Proc Natl Acad Sci USA 1989;86:8412 – 6. Fingerle J, Faulmuller A, Muller G, Bowen-Pope DF, Clowes MM, Reidy MA, Clowes AW. Pituitary factors in blood plasma are necessary for smooth muscle cell proliferation in response to injury in vivo. Arterioscler Thromb 1992;12:1488 – 95. Ferns GA, Raines EW, Sprugel KH, Motani AS, Reidy MA, Ross R. Inhibition of neointimal smooth muscle accumulation after angioplasty by an antibody to PDGF. Science 1991;253:1129 – 32. Gulcher JR, Nies DE, Marton LS, Stefansson K. An alternatively spliced region of the human hexabrachion contains a repeat of potential N-glycosylation sites. Proc Natl Acad Sci USA 1989;86:1588 – 92.
Balloon catheterization induces arterial expression of new Tenascin-C isoform Kurt Wallner, Prediman K. Shah, Behrooz G. Sharifi * Atherosclerosis Research Center, Di6ision of Cardiology, Burns and Allen Research Institute, Cedars-Sinai Medical Center, UCLA School of Medicine, Los Angeles, CA 90048, USA Received 20 November 2000; received in revised form 30 April 2001; accepted 9 May 2001
Abstract Migration of smooth muscle cells (SMCs) across the internal elastic lamina is a key step in the development of atherosclerotic or restenotic plaques. Cell movement is a complex and highly dynamic phenomenon, involving the continuous formation and breakage of attachments with the underlying substratum. Tenascin-C (Tn-C), a counter-adhesive extracellular matrix protein, is comprised of several isoforms with distinct biological activities. Neither the structure nor function of these isoforms in SMCs has been defined. We have used primers and RT-PCR to fully identify Tn-C isoforms expressed by SMCs. Cloning and sequence analysis of the PCR product indicated that SMCs express a Tn-C isoform with only repeats A1 and A2 of fibronectin type III repeats. Using A1A2-specific antibodies, cDNA probes and RNase mapping, we observed that the A1A2 isoform is predominantly expressed by cultured SMCs derived from aorta of newborn rats, and its expression is up-regulated by PDGF-BB. In contrast, the expression of this isoform is markedly down-regulated in the SMCs derived from adult rat aorta. Western and Northern blots of injured rat carotid arteries revealed that the A1A2-isoform is expressed in response to injury. Using cultured SMCs, we found that the recombinant A1A2 protein that was found in the newly discovered Tn-C isoform promotes SMC chemotaxis. We conclude that Tn-C isoforms are expressed in a regulated fashion in vascular system. Our findings suggest a new role of Tn-C isoforms in the remodeling of vascular wall. © 2002 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Extracellular matrix; Restenosis; Smooth muscle cell; Tenascin-C; Chemotaxis; Arterial injury
1. Introduction The extracellular matrix (ECM) is both a regulator and a target of the tissue remodeling that accompanies embryogenesis and adult tissue repair. One ECM protein, Tn-C is expressed in a rigidly controlled temporospatial pattern in a developing fetus, yet becomes virtually undetectable in the corresponding regions of the intact adult organ. Injury re-induces Tn-C expression within 1–24 h in almost all tissues, including skin [1 – 4], muscle [5], arteries [6,7], brain or nerves [8,9]. In these regenerating tissues, Tn-C has been found to play a role in cell growth [10 – 12], movement [13], endothe
This paper was supported by the National Institute of Health grant HL50566, Established Investigator Award 0040201N from the American Heart Association, and the EISNER Foundation. * Corresponding author. Tel.: + 1-310-423-7621; fax: + 1-310-4230299.
lial cell sprouting [14], and matrix metalloproteinase gene expression [15]. The role of Tn-C in diseased blood vessels, however, is incompletely defined. We have previously shown that although Tn-C is not expressed in the control normal adult human mammary artery or saphenous veins, it is uniformly and strongly expressed in the adventitia and media of patent human vein grafts [16] and in human atherosclerotic plaques [17]. The potential role of Tn-C in cell migration and proliferation is suggested by studies of cultured SMCs. We have demonstrated that Tn-C blocks adhesion of SMCs to fibronectin [18], and promote SMC migration [19]. Cell detachment and chemotaxis are the principle steps in cell migration. Others have reported that Tn-C stimulates SMC proliferation [11]. Thus Tn-C is involved in migration and proliferation, the two principal action of SMC’s after vascular injury.
0021-9150/02/$ - see front matter © 2002 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0 0 2 1 - 9 1 5 0 ( 0 1 ) 0 0 6 2 7 - X
76
K. Wallner et al. / Atherosclerosis 161 (2002) 75–83
Tn-C is expressed in several isoforms, which are generated by differential splicing of fibronectin type III repeats [20]. These alternatively spliced repeats have been named A1, A2, A3, A4, B, C, and D. The structural diversity of these isoforms results in distinct functional activity [21,22]. The isoforms have distinct tissue distributions and cellular origins [21,23– 26]. The nature of isoform produced by arterial SMCs is unknown. In the present study, we have cloned and identified a new isoform of Tn-C which contains two alternativelyspliced A1A2 units. Using isoform-specific antibodies and probes, we have shown that the A1A2 isoform of Tn-C is primarily expressed in injured arteries. Cell culture studies revealed that newborn and fetal human and rat SMCs prominently express this isoform. In addition, we found that this isoform promotes SMC chemotaxis but not adhesion or proliferation. This is the first evidence that a specific domain of the Tn-C molecule has chemotactic activity. Taken together with previous studies, these new results suggest that the Tn-C molecule contains separate domains which promote cell detachment, chemotaxis, and proliferation that are the essential elements in the SMC response to injury.
2. Material and methods
2.1. Materials Dulbecco’s modified Eagles medium (DME/F12) and trypsin/EDTA were from Irvine Scientific, Irvine, CA. Fetal calf serum (FCS) was from Gibco, Gaithersburg, MD. Guanidine thiocyanate was obtained from Boehringer Mannheim Biochemicals, Indianapolis, IN. Prestained protein standards were from Bio-Rad, Richmond, CA.
2.2. PCR and cloning Cloning of the A1A2 was performed essentially as described before [18]. Briefly, total RNA was extracted from rat aortic SMC treated for 2 h with angiotensin II. First-strand cDNA synthesis was performed on 2 mg of total RNA, followed by revers transcription using Vent polymerase (New England Biolabs). The primers: 5%GGAATTCAGAAAGGCAGACACAAGAGCAAG3% and, 5%-GGAATTCTGAGTCNGTGATGTTGGCTNTCA-3% (Operon Technologies, Alameda CA), were designed with EcoRI sites at the 5% end. After PCR, the products were size fractionated and ligated into the pBluescript II SK+ (Strategene). Transformation of HB101 competent cells (Gibco BRL) was followed by ampicillin selection. White colonies were grown for restriction enzyme analysis, and positive clones were
sequenced using Sequenase (United States Biochemical, Cleveland, OH). Sequence analysis was done using the Wisconsin Sequence Analysis Package (Genetics Computer Group, Madison, WI).
2.3. Expression of A1A2 recombinant protein We used E. coli PET expression system to express the recombinant FN units [27]. The primers were targeted to the exact boundaries of the A1A2 repeat with no extraneous amino acids. In the forward primer, a NdeI site was positioned immediately before the A1-specific sequences such that the ATG of the restriction site would become the start codon of the recombinant peptide. A stop codon (TAA) was designed into the reverse primer, and positioned immediately after the last codon of the A2 repeat. This was followed by a BamHI site which, together with the NdeI site, provided for unidirectional ligation downstream from the T7 promoter in the expression vector pET11a (Novagen, Madison, WI). The cloned isoform was resequenced to ensure that no errors were introduced during the cloning process. The resultant construct was transformed into the E. coli expression host BL21 (DE3) (Novagen), which contains a chromosomal copy of T7 RNA polymerase under the control of the lac operator. Clonal cultures were grown in LB media, containing 50 mg/ml carbenicillin to a density of approximately 0.6 at A 600, whereupon expression was induced with various concentration of IPTG for 3 h. The induced bacteria synthesized abundant 18 kDa soluble A1A2 protein. The recombinant protein was recognized by polyclonal antibodies to Tn-C using a Western blot (not shown).
2.4. Purification of recombinant A1A2 and production of antibodies After induction, E. coli were collected, lysed, centrifuged, and total supernatant protein was precipitated with 50% ammonium sulfate. The ammonium sulfate pellet was resuspended in PBS and passed through gel filtration column (Sephacryl S200, Pharmacia). Eluted fractions were tested for the presence of the 18 kDa protein by SDS-PAGE. Peak fractions were pooled and dialyzed against 20 mM Tris, pH 8.0. Thereafter, the dialysate was loaded onto a Q-Sepharose FPLC column (Pharmacia). The column was eluted with a gradient of 20–1000 mM NaCl in the Tris buffer. Peak fractions were pooled, and further purified by hydroxylapatite HPLC column (BioRad) using 20 –450 mM phosphate buffer containing 0.01 CaCl2, pH 6.8. The peak fractions containing only one single 18 kDa band were pooled and concentrated with an Amicon YM10 membrane. After desalting, this sample was used for N-ter-
K. Wallner et al. / Atherosclerosis 161 (2002) 75–83
77
minal sequencing (UCLA Microsequencing Core Facility). The sequence of the N-terminal 25 amino acid residues was identical to the expected A1A2 sequence, confirming the veracity of the recombinant protein. No heterogeneity was detected in the N-terminal sequence or amino acid composition. The elution profile of the purified A1A2 protein on G125 gel filtration HPLC (BioRad) was consistent with its purity and its monomeric structure. The purified A1A2 protein was used to immunize two chickens (BAbCo). The titer of the antibodies was determined by ELISA, the eggs from chickens with the highest titer were pooled, and the IgY antibodies were purified with Promega chicken antibody purification kit as suggested by the manufacturer. The antiserum was further purified by affinity chromatography, using A1A2 recombinant protein coupled to CNBr-activated Sepharose (Sigma). The bound antibodies were eluted using 0.1 M glycine/HCl (pH 2.6) and the eluate was immediately neutralized. The specificity of the antibodies was established by Western blot. The A1A2-specific antibodies recognized the A1A2 protein, but not other recombinant domains of Tn-C such as repeat D of the fibronectin type III repeat or the fibrinogen-like domain. In addition, the antibodies recognized intact large isoform of Tn-C, but not other matrix proteins such as fibronectin and laminin (not shown).
with PDGF-BB for 4 and 24 h. Total RNA (20 mg) was hybridized with the A1A2-specific rat riboprobe essentially as described [18]. Yeast tRNA was used as a negative control. Hybrids were digested with RNase One (Promega, Madison WI) and resolved on 6% polyacrylamide gel. Hpa II-digested pBR322 plasmid was used as a molecular weight marker.
2.5. Cell culture and Western blot
2.8. Cell migration assay
Adult rat SMC were isolated by enzymatic digestion of 3-month-old rat (Sprague– Dawley) aorta, and cultured as previously described [18]. Neointimal, medial and pup SMC provided by Dr Schwartz (University of Washington), and cultured as described [19]. The neointimal cells were derived from pooled established rat neointima isolated 2 weeks after balloon injury. Cultured cells (passages 3– 7) were grown to confluency, growth arrested, and treated with agonists for 24 h as described [18]. The media were collected and analyzed by Western blot using A1A2-specific antibodies. For Western blot, we used ECL kit (Amersham).
Cell migration was measured by a modification of the Boyden’s chamber method essentially as described [19]. Briefly, polycarbonate filters were coated with 10 mg/ml of substrates overnight at 4 °C. Newborn rat SMCs were suspended at a concentration of 105 cells per ml in serum-free DMEM supplemented with 1 mg/ml BSA. A volume of 50 ml of cell suspension was placed in the upper chamber, and 30 ml of 0.1 mM (in DMEM) of the full-length recombinant A-D, A1A2, and D repeats were placed in the lower chamber. For negative and positive controls, some of the lower chamber received 30 ml of 1 mg/ml BSA and 1 nM PDGF-BB, respectively. The chamber was incubated at 37 °C under 5% CO2 in air for 4 h. The filter was removed, and the cells on the upper side of the filter were scraped off. The SMCs that had migrated to the lower side of the filter were fixed in methanol, stained with Diff-Quick staining solution (Baxter) and counted under a microscope.
2.6. RNA isolation, Northern blot, and RNase protection assay RNA isolation and Northern blot was performed essentially as described [28]. Briefly, cells were treated with 1 nM PDGF-BB for the indicated times. Thereafter, cells were lysed with guanidine thiocyanate, and RNA was isolated by centrifugation through a cesium chloride cushion. The RNA was quantified and 20 mg per lane was analyzed by electrophoresis followed by blotting. The blots were probed with the A1A2-specific cDNA probe. For the RNase protection assay, SMC subtypes maintained in serum-free media or treated
2.7. Arterial injury Male Sprague–Dawley rats (450–500 g) were anesthetized and acute injury to the left common carotid artery was made with an 2F embolectomy catheter as described [29]. At the indicated times after injury, animals were sacrificed. Arteries were stripped of periadventitial fatty and connective tissues in PBS at 4 °C. After the endothelium of the uninjured carotid artery was stripped, both arteries were snap frozen in liquid nitrogen for subsequent RNA and protein extraction. RNA was extracted by guanidine thiocyanate [30]. Since extraction of Tn-C from tissues is difficult, we used an extraction buffer that has proved to be very effective. This buffer is composed of 100 mM CAPS, 150 mM NaCl, pH 11 [31]. The extracted proteins were measured by the Coomasie blue assay and analyzed by Western blot using 5% SDS-PAGE. The A1A2-specific antibodies were used at 1:5000 dilution.
3. Results We have previously reported the cloning and characterization of a new Tn-C isoform containing only one alternatively spliced fibronectin repeat (FN) in cultured SMC [18]. Our strategy for cloning the alternatively
78
K. Wallner et al. / Atherosclerosis 161 (2002) 75–83
Fig. 1. Comparison of the fibronectin-like domains (FN) of human, mouse and rat Tn-C. The number of FN repeats depends on mRNA splicing variants. The first five and the last three FN domains (black boxes) are constitutively expressed, and the other FN repeats (white boxes) are either included or skipped. The partial sequence of human and mouse Tn-C were taken from the data of Gulcher et al. [43] and Weller et al. [33], respectively.
spliced region of rat Tn-C was based on the known sequence of the human cDNA [32]. The 5%-primer was designed 46 bases upstream from the 5%-splicing junction, whereas 3%-primer was localized 300 bases downstream from the 3%-splicing junction. With these primers, we could detect only one intermediate-size Tn-C isoform, containing a D repeat [18]. To increase the likelihood of detecting other, possibly longer isoforms, we redesigned our primers, emphasizing a reduction in the distance between the 5% and 3% primers. Therefore, primers were designed to target the exact boundaries of the spliced region; the 5% primer comprising the last 20 bases of FN5, whereas the 3% primer consists of the 5%-most bases of FN6. Total RNA extracted from SMC treated with PDGF-BB was used as a template for RT-PCR. The generation of cDNA and its amplification by PCR were essentially as described [18]. In addition to the expected bands corresponding to mRNA of the previously described spliced isoforms, another band of approximately 600 bases was
observed. Since each FN repeat is approximately 270 bp long, we reasoned that this size would represent two FN repeats plus the flanking primers. To identify the PCR product, it was cut out of the gel, purified, ligated into a pBluescript II, and sequenced. To ensure that we did not overlook other potential splicing variants, we designed primers flanking A2 and A4, as well as B and D. We did not detect other splicing variants by PCR. Sequencing of the 600 bp PCR product confirmed that it corresponds to two FN repeats. To assign the FN repeats, the sequences were compared with that of human and mouse Tn-C using the sequence analysis software package of the University of Wisconsin Genetic Computer Group (Fig. 1). The designation of the rat cDNA FN repeats was determined by optimizing the alignment with the mouse and human sequences [32,33]. Searches of the GenBank, EMBL, and PIR databases with the 600 base sequence revealed 83 and 85% homology with human A1 and A2 repeats, respectively. Comparison of the amino acid sequences of the rat fibronectin type III repeats revealed that they are homologues of the human A1and A2 fibronectin type III repeats. We have found the expression of the same isoform in the cultured fetal human SMCs using the above strategy. Thus, we conclude that cultured SMCs express the A1A2-isoform in addition to the previously described D-isoform. In this new isoform, however, the repeats A1 and A2 are linked to the constitutively expressed FN5 and 6 U, respectively, possibly generating a unique conformation. Since the expression of Tn-C isoforms are believed to be regulated during development [33,34], we determined the expression of the A1A2 isoform in cultured SMCs derived from adult and newborn (pup) rat aorta. Cells were treated with PDGF-BB for various times and total RNA was analyzed by Northern blot using the A1A2 cDNA [18]. This probe hybridizes with any Tn-C isoform which contains the A1A2 repeats including the large isoform. As shown in Fig. 2, the cDNA probe
Fig. 2. Effect of PDGF-BB on the expression of Tn-C mRNAs by cultured SMC. Adult and pup SMCs were treated with 1 nM of PDGF-BB for the indicated times (in hours). Control cultured cells (0) were maintained in 1% serum. Total RNA was extracted and analyzed by Northern blot using the 1.7 A1A2 cDNA probe. To evaluate loading uniformity, the blot was rehybridized with glyceraldehyde-phosphate dehydrogenase (GAPDH) cDNA probe.
K. Wallner et al. / Atherosclerosis 161 (2002) 75–83
Fig. 3. Expression pattern of Tn-C isoform mRNAs in SMC subsets by PDGF-BB. The [32P]-labeled riboprobe was hybridized with RNA prepared from SMC subsets treated with PDGF-BB for the indicated time (h), and digested with ribonuclease. Arrows in the left margin indicate the position of the expected fragments protected by Tn-C mRNA variants. The size of the protected bands represents: 440 bp large, 405 bp A1A2, and 130 bp small isoforms. The left lane indicates the undigested probe (probe).
detected two Tn-C mRNA species in adult and pup SMCs. Consistent with our previous data, Tn-C was not detected in the untreated cells. Addition of PDGFBB to the adult cells induced the 8.4 kb and 7.0 kb Tn-C transcripts at 2 and 4 h, respectively. The intensity of the two transcripts was nearly equal at 6 h (Fig. 2). Both transcripts were down-regulated at 24 h. In contrast to the adult cells, pup cells primarily expressed the 7.0 kb transcript (Fig. 2).
79
Since the A1A2 cDNA probe detects all isoforms that contain the A1A2 repeats, to specifically identify and quantify the expression of the A1A2-isoform, we have developed a riboprobe that allows simultaneous detection and quantitation of the relative amount of Tn-C mRNA species. The approximate anticipated protected band sizes are as follows: large, 440 bases; A1A2, 405 bases; small, 130 bases. The sizes of the protected bands were identical to that which we anticipated. In addition to the adult and pup cells, we have examined the expression of the isoforms in cultured SMC subtypes derived from media and neointima of adult rat carotid arteries. At time zero, in all SMC subtypes, Tn-C mRNA was barely detectable (Fig. 3). Addition of PDGF-BB markedly induced the overall expression of the individual isoforms. The pup SMCs express predominantly the A1A2 isoform, whereas adult cells, including medial cells, equally expressed all three isoforms. These results confirm that pup cells primarily express the A1A2-isoform. To determine whether the A1A2-isoform protein is expressed in vitro and in vivo, we raised antibodies to the full-length recombinant A1A2 repeats. We used chicken as a host to get high titer antibodies as these repeats are highly conserved in mammals. The antibodies were purified by A1A2-affinity chromatography and their specificity was established by Western blot. As shown in Fig. 4, this antibody recognized exclusively a faint high molecular weight Tn-C variant in the conditioned media of the control pup cells that migrated at approximately 240 kDa (lane C). Addition of PDGFBB (lane 1) or angiotensin II (lane 2) to pup cells markedly increased the intensity of the 240 kDa band with little effect on the synthesis of the 280 kDa protein. In contrast, in the adult cells, these factors predominantly increased the synthesis of the 280 kDa protein. The 240 kDa band is most likely the A1A2-isoform because of its size and its interaction by the A1A2-specific antibodies. The 280 kDa is the large isoform that contains the A1A2 units. We conclude
Fig. 4. Characterization of anti A1A2 antibodies: Recombinant A1A2 protein was used to make polyclonal antibodies as described in Section 2. After purification, the antibody was characterized by Western blot. (A) Tenascin (Tn) fibronectin (Fn) and laminin (Lm) was run under reducing condition on 5% SDS-PAGE. (B) Recombinant A-D, A1A2, D, and Fbg-C was run under reducing condition on 10% SDS-PAGE. After transfer, the blots were probed by the purified anti-A1A2 antibodies.
80
K. Wallner et al. / Atherosclerosis 161 (2002) 75–83
Fig. 5. Synthesis of Tn-C isoforms by newborn and adult aortic SMCs. Quiescent cultures of pup (lanes 1 and 2) and adult (lanes 3 and 4) SMCs were treated with 1 nM PDGF-BB for 24 h. The untreated cells (C) were maintained in 1% serum. The media were collected and analyzed by Western blot using 1:5000 dilution of A1A2 isoform-specific antibodies. Arrows indicated the positions of A1A2 isoform (240 kDa) and large isoform (280 kDa).
that the A1A2-isoform is synthesized and secreted by primary cultures of SMCs, and that this isoform is the major fraction of Tn-C variant produced by pup aortic cells. To determine whether the A1A2-isoform is expressed in vivo, proteins extracted from uninjured and ballooninjured rat carotid arteries were analyzed by Western blot using A1A2-specific antibodies. Tn-C was not detected in the control arteries (Fig. 5, lane 0). Small level of Tn-C was detected 1 and 2 days after balloon injury. A strong expression was detected at 3– 4 days after injury followed by down-regulation 5– 6 days after wounding. Tn-C was strongly re-expressed 7 and 14 days after injury (Fig. 5). The overall expression of Tn-C isoforms was generally lower during the first phase of arterial injury (3– 4 days) compared with the second phase (7–14 days). This differential protein expression can not be explained by the variation in protein loading, because reprobing the blot with smooth muscle-specific anti-a-actin antibodies showed nearly uniform loading (Fig. 6). Since the timing of the expression of the A1A2 isoform in the balloon-injured arteries coincides with the active cell proliferation and migration, we reasoned that this isoform may be involved in the modulation of these events. To explore these possibilities, the recombinant A1A2 was added to quiescent culture of SMCs and DNA synthesis was measured at 24 and 48 h. We found no evidence that the A1A2 protein affects cell growth (not shown). We next examined its effect on cell chemotaxis. As shown in Fig. 7, the A1A2 protein promoted SMC chemotaxis on Tn-C substrate. The level of activity was comparable to that of the positive control, PDGF-BB. Other recombinant domains of Tn-
C such as the full-length alternatively spliced A-D, fibronectin type III repeat D, and fibrinogen-like domain had no effect. The effect of the A1A2 protein is specific to Tn-C, because it had no effect on cell migration on collagen substrate. We conclude that the chemotactic activity of A1A2 repeats is specific and that the direct interaction between SMCs and Tn-C is essential for activity of the A1A2-isoform.
4. Discussion In this study, we demonstrate that cultured aortic cells express at least four isoforms of Tn-C. One of these isoforms, which is produced by alternative splicing of A1 and A2 repeats displays chemotactic activity. This action is clearly different from SMC adhesive activity, which is regulated by the fibrinogen-like domain of Tn-C [19]. In contrast, the A1A2 repeat has no effect on SMC adhesion. Previous reports suggested
Fig. 6. Expression of Tn-C isoforms in injured rat carotid arteries. Proteins were extracted from uninjured (0) and injured left carotid arteries at the indicated times (days) after balloon injury (15 vessels pooled per time point). The extract (100 mg per lane) was analyzed by 5% SDS-PAGE followed by immunoblotting using 1:5000 dilution of A1A2-specific antibodies. The blot was stripped and reprobed with smooth muscle-specific a-actin (40 kDa protein) antibodies (Dako).
K. Wallner et al. / Atherosclerosis 161 (2002) 75–83
Fig. 7. The effect of the recombinant A1A2 protein on SMC chemotaxis. Polycarbonate filters were coated with a solution of 10 mg/ml of BSA, collagen, large (Tn-L) or small (Tn-S) isoform of tenascin-C substrates. The chemotactic factors include solutions of 1 mM of the recombinant domains of Tn-C corresponding to the fibronectin repeats A1A2, A-D, D, and the fibrinogen-like domain (Fbg-C). BSA (1 mg/ml) and PDGF-BB (20 ng/ml) were used as negative and positive controls, respectively. Cell migration was measured as described in Section 2 [19]. Migrating cells were fixed and counted under a microscope. Nine high power fields (HPF) were counted for each triplicates. Values shown are from a representative experiment as mean 9S.E.M.
that stimulation of cell migration by Tn-C is mediated by its ability to down-regulate focal adhesions [35,36] and/or its counter-adhesive activity [37]. Our results indicate that Tn-C molecule possesses the capacity to stimulate the three principle activities of SMCs in response to injury, cell detachment, chemotaxis, and proliferation, and each of these activities resides in a different domains and isoforms. We found that the chemotactic activity is quite specific to the isoform that contains only the A1A2 unit. The full-length alternatively spliced A-D segment, which contains the A1A2 unit, does not stimulate SMC chemotaxis. This lack of chemotactic activity within the larger A-D domain may be due to either steric hindrance and/or to differential conformation of the A1A2 units in the A-D segment. Our sequence analysis of the A1 and A2 repeats revealed them to be very hydrophobic, suggesting that they may be located in the interior of molecule. If so, the active site may be covered by other repeats of the A-D domain. It is also possible that the lack of activity of the larger A-D domain may be related to its linkage to other domains. In the A-D units the A2 repeat is linked to the A3 unit, whereas in the A1A2 isoform, the A2 repeat is linked to the constitutively expressed FN repeat 6. A third possibility is that, the presence of the D unit within the A-D domain may affect its overall conformation. The A1 has two strong and one weak N-glycosylation site, and A2 has one strong and one weak site. Both units are strongly hydrophobic. In contrast, the D repeat has no potential N-glycosylation site and is hydrophilic [18]. These differences in hydrophobicity suggest that the A1A2 unit may have a highly folded molecular conformation, whereas the D repeat may have a more relaxed structure. These striking differences in the glycosylation, steric hindrance, and hydrophobic/hydrophylic
81
nature of the two Tn-C isoforms may determine both the tertiary structure of the isoforms and their functions. In addition to differences in the activity of Tn-C domains, we found major distinctions in the ability of SMC subtypes to express the A1A2 isoform. Our specific anti-A1A2 antibodies immunoprecipitated primarily the 240 kDa protein from conditioned media of pup cells, whereas it primarily recognized the large (280 kDa) isoform in the media of adult cells. These results are consistent with our Northern blot data and RNase protection data. Pup cells predominantly express the 7.0 kb mRNA transcript that corresponds to the A1A2 isoform. In the RNase protection assay, the pup cells predominantly expressed A1A2 isoform. This isoform is markedly up-regulated after 4 and 24 h treatment with PDGF-BB, whereas the large isoform is not detectable. In contrast, the A1A2 isoform was not detected under basal conditions in adult cells, and the major isoform found after 24 h of treatment with PDGF-BB was the large isoform. Cells derived from established neointima also predominantly expressed the A1A2 isoform, but not the large isoform. The similarity in the expression of A1A2 isoform between pup and neointimal cells also suggests that they are closely related and that the A1A2 isoform may be a useful marker to differentiate neointimal cells from other SMC subsets. In addition, this similarity appears to be a stable property of these cells, as it remained consistent throughout multiple isolates and passages. We found that expression of the A1A2 isoform occurs in a biphasic manner after vascular injury. In the first phase, the expression of 7.0 kb message and the 240 kDa isoform peak 3–4 days after injury. This timing corresponds to peak of cell migration in the rat balloon injury model [38]. The in vivo kinetic of the A1A2 isoform expression coupled with our cell culture studies suggest that this isoform may mediate chemotactic activity in injured arteries. The reason for the fall in the level of the 240 kDa protein and its mRNA level 5–6 days after injury remains unclear. It is possible that the down-regulation may reflect reduction of medial cell migration and/or absence of factors responsible for the induction of Tn-C. The second peak occurs 7–14 days after balloon injury when neointima is being established. Previous studies on the expression of Tn-C in injured rat arteries did not identify the nature of the Tn-C isoform expressed in response to injury [6,7]. Our data confirm and expand these previous observations by identifying that the A1A2 isoform as one that is expressed in specific response to arterial injury. We have previously reported that only the small isoform of Tn-C was detected in human atheroma [17]. In the present study, however, we found primarily the A1A2 isoform in the injured rat artery. These differences in the expression pattern of isoforms may reflect
82
K. Wallner et al. / Atherosclerosis 161 (2002) 75–83
significant mechanistic differences in the evolution of atheromatous versus restenotic plaques. Although formation of both atherosclerotic and restenotic plaques requires SMC migration [39], these two events may have different pathogenesis. The intimal SMCs of human atheroma may derive from a small population of SMCs that remain in the embryonic state. These cells may undergo clonal expansion during formation of neointima. Alternatively, they may represent mutation of intimal SMCs [39]. In contrast, cell migration in injured rat arteries occurs in response to the serum factors. In these models, serum, specifically PDGF-BB, released by platelets at the site of injury is considered important for SMC migration [40– 42]. Therefore, it is possible that the expression of the A1A2 isoform may be used to differentiate between cell migrations in these two events. In summary, we have identified a new Tn-C isoform that contains only two alternatively spliced fibronectin repeats, the A1 and A2 units. This isoform is primarily expressed by cultured newborn and neointimal SMCs, and in response to arterial injury. Cell culture studies revealed that the A1A2 unit promotes SMC chemotaxis. The timing of expression of this isoform shortly after balloon injury is consistent with the notion that it may behave as a chemotactic factor in vivo. The expression of this isoform both in embryonic development and in the vascular response to balloon injury further advances the hypothesis that adult tissue remodeling recapitulates cellular behavior during development. Establishment of the precise expression pattern of Tn-C isoform expression after vascular injury provides a potential framework for designing targeted interventions to interfere with neointimal hyperplasia. References [1] Mackie EJ, Thesleff I, Chiquet-Ehrismann R. Tenascin is associated with chondrogenic and osteogenic differentiation in vivo and promotes chondrogenesis in vitro. Differentiation 1988;37:104 – 14. [2] Whitby DJ, Longaker MT, Harrison MR, Adzick NS, Ferguson MW. Rapid epithelialisation of fetal wounds is associated with the early deposition of tenascin. J Cell Sci 1991;99:583 –6. [3] Mackie EJ, Halfter W, Liverani D. Induction of tenascin in healing wounds. J Cell Biol 1988;107:2757 –67. [4] Luomanen M, Virtanen I. Distribution of tenascin in healing incision, excision and laser wounds. J Oral Pathol Med 1993;22:41 – 5. [5] Daniloff JK, Crossin KL, Pincon-Raymond M, Murawsky M, Rieger F, Edelman GM. Expression of cytotactin in the normal and regenerating neuromuscular system. J Cell Biol 1989;108:625 – 35. [6] Hedin U, Holm J, Hansson GK. Induction of tenascin in rat arterial injury. Relationship to altered smooth muscle cell phenotype. Am J Pathol 1991;139:649 –56. [7] Majesky MW. Neointima formation after acute vascular injury. Role of counteradhesive extracellular matrix proteins. Tex Heart Inst J 1994;21:78 – 85.
[8] Martini R, Schachner M, Faissner A. Enhanced expression of the extracellular matrix molecule J1/tenascin in the regenerating adult mouse sciatic nerve. J Neurocytol 1990;19:601 – 16. [9] Daniloff JK, Levi G, Grumet M, Rieger F, Edelman GM. Altered expression of neuronal cell adhesion molecules induced by nerve injury and repair. Cell 1986;47:131 – 9. [10] Kanno S, Fukuda Y. Fibronectin and tenascin in rat tracheal wound healing and their relation to cell proliferation. Pathol Int 1994;44:96 – 106. [11] Jones PL, Rabinovitch M. Tenascin-C is induced with progressive pulmonary vascular disease in rats and is functionally related to increased smooth muscle cell proliferation. Circ Res 1996;79:1131 – 42. [12] Jones PL, Cowan KN, Rabinovitch M. Tenascin-C, proliferation and subendothelial fibronectin in progressive pulmonary vascular disease. Am J Pathol 1997;150:1349 – 60. [13] Whitby DJ, Ferguson MW. The extracellular matrix of lip wounds in fetal, neonatal and adult mice. Development 1991;112:651 – 68. [14] Canfield AE, Schor AM. Evidence that tenascin and thrombospondin-1 modulate sprouting of endothelial cells. J Cell Sci 1995;108:797 – 809. [15] Tremble P, Chiquet-Ehrismann R, Werb Z. The extracellular matrix ligands fibronectin and tenascin collaborate in regulating collagenase gene expression in fibroblasts. Mol Biol Cell 1994;5:439 – 53. [16] Wallner K, Li C, Fishbein MC, Shah PK, Sharifi BG. Arterialization of human vein grafts is associated with tenascin-C expression. J Am Coll Cardiol 1999;34:871 – 5. [17] Wallner K, Li C, Shah PK, Fishbein MC, Forrester JS, Kaul S, Sharifi BG. Tenascin-C is expressed in macrophage-rich human coronary atherosclerotic plaque. Circulation 1999;99:1284 –9. [18] LaFleur DW, Fagin JA, Forrester JS, Rubin SA, Sharifi BG. Cloning and characterization of alternatively spliced isoforms of rat tenascin. Platelet-derived growth factor-BB markedly stimulates expression of spliced variants of tenascin mRNA in arterial SMCs. J Biol Chem 1994;269:20757 – 63. [19] LaFleur DW, Chiang J, Fagin JA, Schwartz SM, Shah PK, Wallner K, Forrester JS, Sharifi BG. Aortic smooth muscle cells interact with Tenascin-C through its fibrinogen-like domain. J Biol Chem 1997;272:32798 – 803. [20] Erickson HP, Bourdon MA. Tenascin: an extracellular matrix protein prominent in specialized embryonic tissues and tumors. Annu Rev Cell Biol 1989;5:71 – 92. [21] Chiquet-Ehrismann R, Matsuoka Y, Hofer U, Spring J, Bernasconi C, Chiquet M. Tenascin variants: differential binding to fibronectin and distinct distribution in cell cultures and tissues. Cell Regul 1991;2:927 – 38. [22] Zisch AH, Alessandri DL, Amrein K, Ranscht B, Winterhalter KH, Vaughan L. The glypiated neuronal cell adhesion molecule contactin/F11 complexes with src-family protein tyrosine kinase. Fyn Mol Cell Neurosci 1995;6:263 – 79. [23] Kaplony A, Zimmermann DR, Fischer RW, Imhof BA, Odermatt BF, Winterhalter KH, Vaughan L. Tenascin Mr 220 000 isoform expression correlates with corneal cell migration. Development 1991;112:605 – 14. [24] Prieto AL, Jones FS, Cunningham BA, Crossin KL, Edelman GM. Localization during development of alternatively spliced forms of cytotactin mRNA by in situ hybridization. J Cell Biol 1990;111:685 – 98. [25] Mackie EJ, Tucker RP. Tenascin in bone morphogenesis: expression by osteoblasts and cell type-specific expression of splice variants. J Cell Sci 1992;103:765 – 71. [26] Tucker RP. The in situ localization of tenascin splice variants and thrombospondin 2 mRNA in the avian embryo. Development 1993;117:347 – 58.
K. Wallner et al. / Atherosclerosis 161 (2002) 75–83 [27] Aukhil I, Joshi P, Yan Y, Erickson HP. Cell- and heparin-binding domains of the hexabrachion arm identified by tenascin expression proteins. J Biol Chem 1993;268:2542 –53. [28] Sharifi BG, LaFleur DW, Pirola CJ, Forrester JS, Fagin JA. Angiotensin II regulates tenascin gene expression in vascular smooth muscle cells. J Biol Chem 1992;267:23910 – 5. [29] Dubin D, Peters JH, Brown LF, Logan B, Kent KC, Berse B, Berven S, Cercek B, Sharifi BG, Pratt RE, et al. Balloon catheterization induced arterial expression of embryonic fibronectins. Arterioscler Thromb Vasc Biol 1995;15:1958 – 67. [30] Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate – phenol –chloroform extraction. Anal Biochem 1987;162:156 –9. [31] Lightner VA, Gumkowski F, Bigner DD, Erickson HP. Tenascin/hexabrachion in human skin: biochemical identification and localization by light and electron microscopy. J Cell Biol 1989;108:2483 – 93. [32] Nies DE, Hemesath TJ, Kim JH, Gulcher JR, Stefansson K. The complete cDNA sequence of human hexabrachion (Tenascin). A multidomain protein containing unique epidermal growth factor repeats. J Biol Chem 1991;266:2818 –23. [33] Weller A, Beck S, Ekblom P. Amino acid sequence of mouse tenascin and differential expression of two tenascin isoforms during embryogenesis. J Cell Biol 1991;112:355 –62. [34] Aufderheide E, Ekblom P. Tenascin during gut development: appearance in the mesenchyme, shift in molecular forms, and dependence on epithelial –mesenchymal interactions. J Cell Biol 1988;107:2341 – 9 Published erratum appears in J. Cell. Biol. 1989 Mar;108(3):following 1175. [35] Murphy-Ullrich JE, Lightner VA, Aukhil I, Yan YZ, Erickson HP, Hook M. Focal adhesion integrity is downregulated by the
[36]
[37]
[38]
[39] [40]
[41]
[42]
[43]
83
alternatively spliced domain of human tenascin. J Cell Biol 1991;115:1127 – 36 Published erratum appears in J. Cell. Biol. 1992 Feb;116(3):833. Hahn AW, Kern F, Jonas U, John M, Buhler FR, Resink TJ. Functional aspects of vascular Tenascin-C expression. J Vasc Res 1995;32:162 – 74. Chiquet-Ehrismann R, Kalla P, Pearson CA, Beck K, Chiquet M. Tenascin interferes with fibronectin action. Cell 1988;53:383 – 90. Reidy MA, Schwartz SM. Endothelial regeneration. III. Time course of intimal changes after small defined injury to rat aortic endothelium. Lab Invest 1981;44:301 – 8. Schwartz SM. Smooth muscle migration in atherosclerosis and restenosis. J Clin Invest 1997;100:S87 – 9. Fingerle J, Johnson R, Clowes AW, Majesky MW, Reidy MA. Role of platelets in smooth muscle cell proliferation and migration after vascular injury in rat carotid artery. Proc Natl Acad Sci USA 1989;86:8412 – 6. Fingerle J, Faulmuller A, Muller G, Bowen-Pope DF, Clowes MM, Reidy MA, Clowes AW. Pituitary factors in blood plasma are necessary for smooth muscle cell proliferation in response to injury in vivo. Arterioscler Thromb 1992;12:1488 – 95. Ferns GA, Raines EW, Sprugel KH, Motani AS, Reidy MA, Ross R. Inhibition of neointimal smooth muscle accumulation after angioplasty by an antibody to PDGF. Science 1991;253:1129 – 32. Gulcher JR, Nies DE, Marton LS, Stefansson K. An alternatively spliced region of the human hexabrachion contains a repeat of potential N-glycosylation sites. Proc Natl Acad Sci USA 1989;86:1588 – 92.