- Email: [email protected]
BCL3 regulates RANKL-induced osteoclastogenesis by interacting with TRAF6 in bone marrow-derived macrophages
Accepted Manuscript BCL3 regulates RANKL-induced osteoclastogenesis by interacting with TRAF6 in bone marrow-derived macrophages
Kun Wang, Shuai Li, Yong Gao, Xiaobo Feng, Wei Liu, Rongjin Luo, Yu Song, JiTu, Yingle Liu, Cao Yang PII: DOI: Reference:
S8756-3282(18)30247-3 doi:10.1016/j.bone.2018.06.015 BON 11681
To appear in:
Bone
Received date: Revised date: Accepted date:
22 January 2018 15 June 2018 18 June 2018
Please cite this article as: Kun Wang, Shuai Li, Yong Gao, Xiaobo Feng, Wei Liu, Rongjin Luo, Yu Song, JiTu, Yingle Liu, Cao Yang , BCL3 regulates RANKL-induced osteoclastogenesis by interacting with TRAF6 in bone marrow-derived macrophages. Bon (2018), doi:10.1016/j.bone.2018.06.015
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
ACCEPTED MANUSCRIPT BCL3
Regulates
RANKL-induced
Osteoclastogenesis
by
Interacting with TRAF6 in Bone Marrow–Derived Macrophages Kun Wanga, †, Shuai Lia, †, Yong Gaoa, Xiaobo Fenga, Wei Liub, Rongjin Luoa, Yu Songa, JiTua,
Department of Orthopedics, Union Hospital, Tongji Medical College, Huazhong University
RI
a
PT
Yingle Liuc* and Cao Yanga *
SC
of Science and Technology, Wuhan 430022, China
Department of Orthopedics, First Hospital of Wuhan, Wuhan 430022, China
c
State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan
NU
b
MA
430072, China.
PT E
D
Running head: BCL3 interacts with TRAF6
*To whom correspondence should be addressed:
CE
Prof. Cao Yang, Department of Orthopedics, Union Hospital, Tongji Medical College,
AC
Huazhong University of Science and Technology, Wuhan, 430022, China. Email: [email protected]. Tel: +86-027-85351626; Fax: +86-027-85351626. Prof. Yingle Liu, State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan, 430022, China. Email: [email protected]. Tel: +86-027-68752938; Fax: +86-027-68752938.
†
Equal contribution 1
ACCEPTED MANUSCRIPT Abbreviations：TRAF6, tumor necrosis factor receptor-associated factor 6; BCL3, B-cell chronic lymphatic leukemia protein 3; TAK1, transforming growth factor β-activated kinase 1; RANKL, Receptor activator of nuclear factor-κB ligand; NFATC1, nuclear factor of
PT
activated T-cells 1; BMDM, bone marrow derived macrophage; IKK, I-κB kinase
RI
Abstract
SC
Objective: Tumor necrosis factor receptor-associated factor 6 (TRAF6) is an essential component of the signaling complex that mediates osteoclastogenesis. As an adaptor protein
NU
of E3 ligase function, TRAF6 regulates NF-κB signaling via TAK1 and I-κB kinase (IKK)
MA
activation. Here, we investigated novel mechanisms by which TRAF6 signaling is regulated under receptor activator of nuclear factor-κB ligand (RANKL)-induced osteoclastogenesis.
interactions
were
confirmed
PT E
The
D
Design: A yeast two-hybrid screen system identified cellular factors that interact with TRAF6. by
glutathione
S-transferase
pull-down
and
co-immunoprecipitation assays, followed by immuno-blotting. The role of TRAF6 in bone
CE
growth and remodeling was determined by osteoclast differentiation and bone-resorption pit
AC
assays. Regulatory mechanisms were examined by co-immunoprecipitation, immuno-blotting, real-time polymerase chain reaction, and luciferase reporter assays. Results: We show that B-cell chronic lymphatic leukemia protein 3 (BCL3) interacts with TRAF6 through its ankyrin-repeat domain and inhibits osteoclastogenesis in bone marrow derived macrophages (BMDMs). Further, TRAF6 interacts with CYLD to mediate BCL3 deubiquitination, which facilitates the cytoplasmic accumulation of BCL3 and represses BCL3 and p50 complex-mediated cyclin D1 transcription. 2
ACCEPTED MANUSCRIPT Conclusions: TRAF6 promotes RANKL-induced osteoclastogenesis by regulating novel non-canonical NF-κB signaling via BCL3 deubiquitination, indicating that BCL3 provides valuable insights into bone loss-associated diseases.
PT
Keywords: osteoclastogenesis; tumor necrosis factor receptor-associated factor 6; B-cell
SC
RI
chronic lymphatic leukemia protein 3
1. Introduction
NU
The human bone is remodeled at a high rate; approximately 10% of the total bone content is
MA
replaced every year in adult humans. Osteoclasts periodically resorb old bone and osteoblasts deposit new bone in the resulting cavities, a process known as remodeling[1, 2]. Bone
D
remodeling is disrupted in a variety of pathological conditions, including osteoporosis,
PT E
rheumatoid arthritis, and osteolysis from cancer, where bone resorption is not balanced by bone formation[3-5]. Remodeling involves both the destruction and formation of bones and
CE
the two processes are tightly coupled and controlled by signaling molecules. Resorption of
AC
cartilage and bone is essential for the development and regeneration of the skeleton[6]. Bone resorption involves osteoclast-mediated degradation and removal of the mineralized bone matrix[7]. Osteoclasts, derived from myeloid bone-marrow precursor cells, play a crucial role in both physiological and pathological bone resorption[8]. Therefore, elucidating the regulatory mechanisms involved in osteoclastogenesis is imperative for a deeper understanding of the skeletal system in healthy as well as diseased condition. Receptor activator of nuclear factor-κB ligand (RANKL) is the key cytokine that 3
ACCEPTED MANUSCRIPT induces osteoclast differentiation and is essential for their maturation, function, and survival[9-11]. RANKL is expressed by osteoclastogenic cells, such as osteoblasts and bone marrow stromal cells, or is released in a soluble form in the bone microenvironment. Its receptor, RANK (receptor activator of nuclear factor κB), is a type I trans-membrane protein
PT
similar to other members of the TNF receptor superfamily and is expressed on osteoclast
RI
progenitors and mature osteoclasts[12, 13]. The binding of RANKL to RANK results in the
SC
recruitment of the TNF receptor-associated factors (TRAFs) [14, 15]. TRAF-mediated RANK signal transduction activates a series of downstream signaling transcription factors including
NU
activator protein-1 (AP-1), NF-κB, and NFATC1 to initiate the expression of genes for
MA
osteoclastogenesis and to coordinate osteoclast functions[16, 17]. Among the TRAFs family, TRAF6 plays a principal role in osteoclast activation as the main adaptor molecule that links
D
to RANK[18] and is well documented by genetic disruption methods[19, 20]. TRAF6
PT E
interacts with transforming growth factor β-activated kinase 1 (TAK1) via TRAF6-mediated Lys 63-linked polyubiquitination. This K63 polyubiquitination activates the TAK1 kinase
CE
complex, which phosphorylates I-κB kinase (IKK) at key serine residues in the activation
AC
loop, resulting in IKK activation[21, 22]. TAK1 binding protein 2 (TAB2) is the regulatory subunit for TAK1. When the TAK1 kinase complex is recruited to the TRAF6 complex and activated, it stimulates NF-κB activation through IKK as well as AP-1 activation through JNK. Thus, TAK1 and TAB2 function at the same point in the RANK signaling pathway as TRAF6[23-25]. TRAF6, TAB2, and TAK1 assemble into the RANK complex upon ligand engagement, and this complex formation is important for RANK signaling in regulating the development and function of osteoclasts[26]. 4
ACCEPTED MANUSCRIPT To discover other mechanisms by which the signaling cascades from TRAF6 are regulated under RANKL, a yeast two-hybrid screen system was employed to search for cellular factors that interact with TRAF6. This approach identified B-cell chronic lymphatic leukemia protein 3 (BCL3) as an interacting partner of TRAF6, which regulates
PT
non-canonical I-κB signaling independent of IKK. The function of BCL3 in
RI
osteoclastogenesis remains unknown. Here, we showed that bone marrow derived
SC
macrophages (BMDMs) lacking BCL3 were prone to differentiation to osteoclasts. Under RANKL stimulation, cylindromatosis (CYLD) was assembled to the TRAF6 complex. The
NU
K63-linked polyubiquitin chain of BCL3 was then removed by CYLD, which resulted in the
MA
retention of BCL3 in the cytoplasm, inhibiting the transcription of NF-κB target genes such as the cyclin D1 gene. Our data indicated that TRAF6 influences the development and
D
function of osteoclasts by regulating novel non-canonical NF-κB signaling via BCL3
PT E
deubiquitination.
2. Materials and methods
CE
2.1 Two-hybrid and galactosidase assays
AC
Two-hybrid interaction analyses were conducted using the Matchmaker Two-Hybrid System (Clontech) according to the manufacturer’s instructions. In brief, after the selection of co-transformants, the interactions of fusion proteins were detected on high-stringency plates (SD/Ade/His/Leu/Trp) and verified by β-galactosidase filter assays. 2.2 Plasmids The full-length human TRAF6 cDNA was synthesized by Bio-Transduction Lab Co., Ltd (China). The product was verified as TRAF6 cDNA by sequencing. Full-length TRAF6 5
ACCEPTED MANUSCRIPT cDNA was subcloned into the EcoRI-BamHI site of pcDNA3.1/His mammalian expression vector (Invitrogen, Carlsbad, CA, USA). The expression vectors for the mutants of TRAF6 described previously were obtained [27] and the TRAF6 mutant sequences were subcloned into pcDNA3.1/His vector. The expression plasmid for human BCL3 was pCMV/3Flag,
PT
provided by GENECHEM (Shanghai, China). The different regions of the BCL3 protein
RI
(N-terminal truncated or C-terminal truncated BCL3 and ANK BCL) were amplified from
SC
full-length 3Flag-BCL3 cDNA by PCR and subcloned into the pCMV/3Flag vector. sh-RNA against TRAF6 (sh-TRAF6), CYLD (sh-CYLD), BCL3 (sh-BCL3) were synthesized by
NU
GENECHEM (Shanghai, China) and subcloned into GV102 (Genechem Co., Ltd, Shanghai,
MA
China). The pcDNA3.1 and scramble shRNA were applied as controls. 2.3 Cell culture and transfection
D
HEK293T was maintained in DMEM supplemented with 10% heat-inactivated FBS (Life
PT E
Technologies, Inc.), penicillin (100 units/mL), and streptomycin (100 μg/mL) at 37 °C under 5% CO2 atmosphere. BMDMs were prepared from femurs and tibias of C57BL/6 mice (6
CE
weeks of age, which is a time of rapid growth) in the presence of macrophage
AC
colony-stimulating factor (M-CSF) (5 ng/mL, R&D, Minneapolis, MN), as previously described[28]. After 7 days, cultures were treated with RANKL (100 ng/mL, R&D, Minneapolis, MN). The growth media were changed every 2 days until the macrophages grew to confluence. For the transfection studies, HEK293T cells and BMDMs were transfected with various expression vectors using Lipofectamine 2000 reagent (Thermo, Waltham, MA, USA) according to the manufacturer’s instructions. The study was performed in adherence to the National Institutes of Health guidelines for the use of experimental 6
ACCEPTED MANUSCRIPT animals. The protocol was approved by the Animal Care and Ethics Committee of Huazhong University of Science and Technology. 2.4 Cell MTT assay After overexpression and knockdown of BCL3, 2×104 cells were seeded into 96-well plates.
PT
Then, the cells were treated with RANKL (100 ng/ml). After treatment for 0, 2, 4, 6 days.
RI
Cell proliferation was monitored using the 2-(4, 5-dimethyltriazol-2-yl)-2, 5-diphenyl
SC
tetrazolium bromide (MTT, Sigma) colorimetric assay. Three independent experiments were performed for each experimental condition.
NU
2.5 Luciferase reporter gene assay
MA
BMDMs transfected with luciferase reporter constructs controlled by either NF-κB binding promoter elements or human cyclin D1 promoter were plated in 24-well plates. Cells were
D
pre-treated with RANKL or the NF-κB inhibitor, BAY11-7082. Luciferase activity was
PT E
measured 24h after transfection using Dual-Luciferase assay system according to the manufacturer's instructions (Promega, Madison, WI, USA). The luciferase activity was
CE
normalized against Renilla luciferase activity and all experiments were carried out in
AC
triplicate. The pNF-κB-luc plasmid (Beyotime Institute of Biotechnology, China) containing four NF-κB binding motifs (GGGAATTTCC). The Cyclin D1 promoter region was constructed from –1000 to +100 bp relative to the TSS as described previously[29]. 2.6 GST-pull down assay BCL3 expressed in HEK293T cells were lysed with GST-FISH buffer, then incubated with purified GST-TRAF6 or GST proteins for 4 h, and subsequently incubated with Glutathione Sepharose beads for 2 h at 4°C. The beads were washed with cell lysis buffer. After 7
ACCEPTED MANUSCRIPT separation by 12% SDS-PAGE, the precipitate was analyzed by western blotting. 2.7 Real-time PCR analysis Total RNA was isolated from cells using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Reverse transcription reactions were conducted with Transcriptor First Strand cDNA
PT
Synthesis Kit (TaKaRa Biotechnology, Otsu, Japan). Real-time PCR was performed using
RI
SYBR® Green kit Master Mix (Applied Biosystems, Foster City, CA) and the results were
SC
detected using an ABI 7500 Sequencing Detection System. The primers for the genes are listed in Table 1. Data were analyzed with the 2−ΔΔCt method and all values were normalized
NU
to the level of the housekeeping gene, GAPDH.
MA
2.8 Immuno-precipitation and western blotting
Immuno-precipitation and western blotting were performed as previously described[30, 31].
D
The cells were washed with ice-cold PBS and lysed in lysis buffer containing protease and
PT E
phosphatase inhibitors. The cell debris was cleared by centrifugation, and the lysates were immunoprecipitated. The antibodies were collected on protein A/G beads (Santa Cruz
CE
Biotechnology, Santa Cruz, CA) for 2 h at 4 °C. The beads were washed with ice-cold lysis
AC
buffer and resuspended in SDS sample buffer for blotting analysis. Protein lysates were resolved by SDS–PAGE and transferred onto polyvinylidene fluoride membranes (Amersham Biosciences, USA). The membranes were incubated with primary antibodies at 4 °C overnight and secondary antibodies at room temperature for 1 h. Antibodies were specific for BCL3, TRAP, NFATC1, Cathepsin K, Ubiquitin, p100 and cyclin D1 (Abcam Inc, Cambridge, MA) and TRAF6, CYLD, MMP-9, p52, p65, β-actin and Lamin B (Santa Cruz Biotechnology, Santa Cruz, CA). The protein signals were quantified by scanning 8
ACCEPTED MANUSCRIPT densitometry using a FluorChem Q System (Alpha Innotech, CA, USA). 2.9 Chromatin immuno-precipitation (ChIP) ChIP was performed with EZ-ChIP kit (Upstate Biotechnology, Temecula, CA) according to manufacturer's instructions using p52 antibodies and rabbit IgG. DNA was sonicated into
PT
fragments (average size, 200 bp). qRT-PCR was performed with SYBR Green PCR Master
RI
Mix (Applied Biosystems, Foster City, CA, USA). The amount of immuno-precipitated DNA
SC
was calculated in reference to a standard curve and normalised to input DNA. 2.10 Osteoclast differentiation assay and bone resorption pit assays
NU
BMDMs were cultured in DMEM supplemented with 10% FBS and treated with RANKL
MA
(100 ng/mL) for 7 days. TRAP staining was performed and the number of TRAP-positive multinucleated cells (MNCs: three or more nuclei per cell) was determined. The cells were
D
incubated at 37°C in 5% CO2 for 7 days in osteo slice surface, and the medium was changed
PT E
every 3 days. After removing the cells, the resorption pits on the plates were visualized with toluidine blue, imaged and quantified using the Image J software. The results were expressed
CE
as percentages of the total plate area.
AC
2.11 Statistical analysis
All data were analyzed using GraphPad Prism 5.0 software (San Diego, CA, USA) and expressed as the mean with 95% confidence intervals (CI). The results are representative of three independent experiments consisting of three replicates per experiment. Two-tailed, unpaired Student’s t-tests were used to compare two groups, one-way ANOVAs were used to compare three or more groups, and two-way ANOVAs were used to compare multi-factor treatments between three or more groups to test significant differences. In all cases, P < 0.05 9
ACCEPTED MANUSCRIPT was considered statistically significant. 3. Results 3.1. Identification of BCL3 as a factor interacting with TRAF6 We obtained 10 clones from 2.0 × 106 yeast transformants that exhibited a positive phenotype.
PT
One of these clones encoded an ANK portion of BCL3. To confirm the interaction of BCL3
RI
with TRAF6, we performed a GST pull-down assay using bacterially expressed GST-TRAF6.
SC
In vitro translated BCL3 did not bind to GST-bound Sepharose beads alone, but did bind to Sepharose beads conjugated to recombinant GST-TRAF6 (Figure 1A). This result suggested
NU
that BCL3 interacted specifically with TRAF6 in vitro. Next, we performed
MA
co-immunoprecipitation experiments to analyze the interaction of BCL3 with TRAF6 in cells under RANKL stimulation. The results demonstrated that BCL3 was precipitated with
D
TRAF6 in BMDMs, and conversely, TRAF6 was also precipitated with BCL3 (Figure 1B).
PT E
We also found that the interactions between TRAF6 and BCL3 were enhanced by RANKL stimulation as compared to without RANKL stimulation (Figure 1C).
CE
To define the domains within BCL3 and TRAF6 responsible for this interaction, we
AC
performed immuno-precipitation assays using TRAF6 truncated mutants (Figure 1D) and BCL3 truncated mutants (Figure 1E). 3Flag-tagged ANK motifs of BCL3 and 3Flag-tagged BCL3 with truncated N-terminal or C-terminal could be detected in the immuno-complexes isolated from cell lysates. Co-immunoprecipitation assays indicated that ankyrin repeats of BCL3 were sufficient for binding with RING domain of TRAF6 (Figure 1F, G). Taken together, these results suggested that TRAF6 interacts with BCL3. 3.2 BCL3 is an inhibiting factor in osteoclastogenesis 10
ACCEPTED MANUSCRIPT The TRAF6 interaction with BCL3 led us to examine the role of BCL3 in regulating osteoclast differentiation. BMDMs were cultured in M-CSF growth media in either the absence or presence of RANKL. BCL3 overexpression alone did not significantly increase TRAP positive osteoclasts (OCs). As expected, treatment with RANKL at a concentration of
PT
100 ng/mL induced the generation of TRAP positive OCs (Figure 2A, B. P < 0.05).
RI
Remarkably, this result indicated that there were fewer OCs in BMDMs after BCL3
SC
overexpression without RANKL stimulation (Figure 2A, B. P<0.05). Consistent with these results, the induction of osteoclastogenic markers, including Cathepsin K, MMP-9, TRAP,
NU
and NFATC1, were significantly increased after RANKL treatment (P < 0.05). However,
MA
BCL3 suppressed RANKL-induced osteoclast-associated gene expression (Figure 2C, D. P < 0.05). In addition, treatment with RANKL was shown to increase the area of osteoclast bone
D
resorption pits (Figure 2E). We also found that osteoclastic bone resorption was significantly
PT E
decreased in BMDMs overexpressing BCL3 following RANKL stimulation (Figure 2F. P < 0.05). In the case of just BCL3 overexpression, there was no significant difference in
CE
osteoclastic bone resorption (Figure 2F. P ＞ 0.05). This result suggests that BCL3
AC
attenuates the RANKL-induced bone resorptive activity of osteoclasts in vitro. 3.3. BCL3 affects RANKL-induced NF-κB signaling via p52 We next tested the effect of BCL3 on the activation of NF-κB induced by RANKL. An inhibitory effect of BCL3 on the activation of NF-κB was revealed in experiments using luciferase activity assays. RANKL significantly induced the transcriptional activity of NF-κB in BMDMs that were transfected with NF-κB-luc (Figure 3A. P < 0.05). In contrast, treatment with BCL3 or the NF-κB inhibitor BAY11-7082 significantly inhibited the 11
ACCEPTED MANUSCRIPT RANKL-induced transcriptional activity of NF-κB (Figure 3A. P < 0.05). The distributions of p52, its precursor p100, and p65 were assessed by western blot analysis using the cytoplasmic and nuclear extracts of BMDMs. Under normal conditions, the distribution of p100 was not significantly different between untreated and RANKL treated
PT
cells, whereas BCL3 increased the level of p100 slightly (Figure 3B lane 1 and Figure 3C).
RI
Furthermore, under BCL3 overexpression conditions, the level of p100 remarkably higher
SC
following RANKL stimulation when compared without RANKL treatment (Figure 3B lane 1 and Figure 3C). The overexpression of BCL3 augmented the levels of p52 and attenuated the
NU
levels of p65 in the nuclear extracts (Figure 3B lane 2, 3 and Figure 3C). It was p65 rather
MA
than p52 nuclear migration increased when stimulated with RANKL alone (Figure 3B lane 2, 3 and Figure 3C). Together, BCL3 and RANKL significantly increased cytoplasmic levels of
D
p100. Our results indicated that increased BCL3 levels contributed to the processing of p100
PT E
to generate p52 and increased the nuclear translocation of p52 regardless of RANKL induction.
AC
BCL3
CE
3.4. RANKL mediates BCL3 deubiquitination and prevents nuclear accumulation of
As an E3 ubiquitin ligase, TRAF6 contains a highly conserved RING domain that is known to be indispensable for the downstream signaling and ubiquitination, including the regulation of
osteoclastogenesis[30,
32].
We
speculated
that
TRAF6
might
affect
BCL3
polyubiquitination in RANKL signaling. To test this hypothesis, we immunoprecipitated endogenous BCL3 in untreated and RANKL-treated BMDMs and subsequently determined the ubiquitination status of BCL3. The results showed a decrease in the ubiquitination levels 12
ACCEPTED MANUSCRIPT of BCL3 in the cells treated with RANKL. The addition of RANKL caused significant deubiquitination of BCL3. In contrast, the deubiquitination of BCL3 in untreated cells was weak. Furthermore, the deubiquitination of BCL3 decreased after TRAF6 knockdown (Figure 4A).
PT
To further confirm this finding, we determined the subcellular localization of BCL3 and
RI
TRAF6 in BMDMs. Endogenous BCL3 exhibited a nuclear distribution and TRAF6 had a
SC
cytoplasmic distribution. After RANKL treatment, BCL3 was mainly distributed in cytoplasmic regions (Figure 4B). BCL3 translocation was assessed by western blot analysis
NU
using the cytosolic and nuclear extracts. Treatment with RANKL decreased the level of
MA
BCL3 in nuclear extracts and increased accumulation of BCL3 in the cytoplasm (Figure 4C). 3.5. BCL3 interaction with TRAF6 involves CYLD
D
BCL3 can be deubiquitinated by CYLD, an enzyme that removes the K63-linked
PT E
polyubiquitin chain, which results in the retention of BCL3 in the cytoplasm and thus its inactivation[33]. Prior studies have indicated that CYLD assembles on the TRAF6 complex
CE
and negatively regulates TRAF6 ubiquitination[34]. The strong interaction between TRAF6
AC
and BCL3 led us to examine if CYLD was involved in the TRAF6-BCL3 interaction. After being cultured, BMDMs were lysed and immunoprecipitated with anti-TRAF6, anti-BCL3, or anti-CYLD. The immunoprecipitates were eluted and immuno-blotted (Figure 5A-C). In order to elucidate the underlying mechanism involved in the deubiquitination of BCL3, we first determined the type of polyubiquitin chain present on BCL3 in BMDMs. We performed ubiquitination assays using specific K48 and K63 point mutants of HA-tagged ubiquitin (K48R and K63R). 3Flag-tagged BCL3 and ubiquitin mutants were overexpressed 13
ACCEPTED MANUSCRIPT in BMDMs. The enhancement of polyubiquitination was more significant in the K48R mutant. The findings showed that the K63 polyubiquitin chain is removed during the deubiquitination of BCL3 in the presence of RANKL (Figure 5D). In BMDMs with stable knock down of CYLD, the K63 polyubiquitination of BCL3 was markedly enhanced (Figure
PT
5D). These findings demonstrated that CYLD catalyzes the disassembly of K63-linked
RI
polyubiquitin chains on BCL3. We also observed the cytoplasmic distribution of CYLD via
SC
confocal microscopy. After treatment with RANKL, BCL3 began to translocate from the nucleus to the cytoplasm (Figure 5E).
NU
3.6. RANKL regulates cyclin D1 expression through BCL3 and NF-κB
MA
The cell cycle is driven by heterodimeric kinases composed of cyclins. Cell cycle exit in osteoclast precursors is important for their differentiation into osteoclasts[35]. Since BCL3 is
D
able to act as a co-activator with p52 homo-dimers to directly activate the cyclin D1
PT E
promoter[33], we investigated the levels of cyclin D1 in BMDMs following RANKL induction. Both the mRNA and protein expression levels of cyclin D1 decreased after
CE
treatment with RANKL (Figure 6A, B). The dual-luciferase assay showed significantly
AC
reduced activity of the cyclin D1 promoter after RANKL treatment (Figure 6C). Under RANKL stimulation, dual-luciferase assay indicated the increased and decreased promoter activity of cyclin D1 in BMDMs stably overexpressing BCL3 or with knock down of BCL3, respectively (Figure 6C). Furthermore, the ChIP assay revealed that the cyclin D1 promoter regions had decreased enrichment of p52 after RANKL stimulation (Figure 6D. P < 0.05). These effects were partially abolished by the overexpression of BCL3, whereas the depletion of BCL3 significantly reduced RANKL-induced cyclin D1 promoter inactivation (Figure 6D. 14
ACCEPTED MANUSCRIPT P < 0.05, respectively). Since BCL3 was involved in cell cycle control, we investigated the effects of BCL3 in BMDMs proliferation treated with RANKL. Stable transfection of BCL3 or sh-BCL3 increased or decreased the proliferation of BMDMs respectively (Figure 6E). Additionally, the data showed BCL3 increased numbers of TRAP-positive mononuclear cells
PT
under RANKL stimulation (Supplementary Figure S1A). The difference between
RI
TRAP-positive small (<3 nuclei) and larger (>3 nuclei) cells was statistically significant
SC
(Supplementary Figure S1B). Based on these data, we concluded that RANKL suppressed the
NU
activation of the cyclin D1 promoter through NF-κB signals that were antagonized by BCL3.
MA
4. Discussion
In this study, we identified a new protein, encoded by the oncogene BCL3, to be involved in
D
RANKL-induced osteoclastogenesis. To our knowledge, our study is the first to report the
PT E
interaction between BCL3 and TRAF6. Once TRAF6 activity was enhanced by RANKL stimulation, CYLD was assembled onto the TRAF6 complex. The K63-linked polyubiquitin
CE
chain of BCL3 was then removed by CYLD and the translocation of BCL3 to the nucleus
AC
decreased, where its target gene cyclin D1 is under the control of NF-κB. We showed that the enhancement of TRAF6 regulated novel, non-canonical NF-κB signaling via the atypical I-κB inhibitor BCL3 in the RANKL signaling pathway and resulted in OC differentiation and maturation (Figure 7). The NF-κB activation pathways are broadly classified as canonical and non-canonical pathways. The ubiquitin-proteasome pathway plays a crucial role in both pathways of NF-κB activation.
Phosphorylation
of
I-κB
proteins
or
I-κB-like
domains
results
in 15
ACCEPTED MANUSCRIPT phosphorylation-induced polyubiquitination via Lys48 of ubiquitins. This polyubiquitination is a signal for the degradation of the I-κB inhibitor, or the processing of p100 and p105, by the proteasome[36, 37]. It is known that the p50 and p52 subunits of NF-κB, derived from the larger precursors p105 and p100, lack DNA trans-activating domains[33, 38, 39]. However,
PT
in a non-canonical pathway, transcriptional activity can be acquired by engaging the partner
RI
protein BCL3, an atypical member of the I-κB family[40]. BCL3 is known to associate with
SC
nuclear p50 or p52 homo-dimers and can function as a transcriptional co-activator[41-43]. In BMDMs, we found that BCL3 inhibited the RANKL-induced transcriptional activity of
MA
generate p52 and its nuclear translocation.
NU
NF-κB. Furthermore, we conclusively showed that increased BCL3 levels contributed to
BCL3 itself is critically regulated via post-translational modifications, especially via
D
phosphorylation and ubiquitination. Polyubiquitin chains that are linked through K48 of
PT E
ubiquitin target proteins are sent to the 26S proteasome for degradation, while chains linked through K63 usually result in non-proteolytic outcomes, such as serving as docking sites for
CE
other proteins[44]. The proteasomal degradation of BCL3 in the cytoplasm is regulated by an
AC
E3-ligase complex containing TBLR1[45]. TRAF6 is activated upon interaction with the ubiquitin-conjugating E2 enzyme Ubc13, which stimulates the formation of the signal-promoting K63-linked polyubiquitination[46]. Lys-63-polyubiquitinated TRAF6 then mediates downstream signaling activations. Consequently, we originally hypothesized that K63 polyubiquitin chains can be added to BCL3 by TRAF6, but our experiments produced opposite results. Our data showed that the polyubiquitination of BCL3 decreased under the stimulation of RANKL, as well as the over-expression of TRAF6. We further discovered that 16
ACCEPTED MANUSCRIPT TRAF6 facilitated the K63 deubiquitination of BCL3 in RANKL-induced BMDMs and this is mediated by CYLD. These findings were consistent with those of previous studies[33, 34]. RANKL stimulation also induced the activation of endogenous CYLD in BMDMs, suggesting that CYLD and BCL3 are involved in the RANKL signaling pathway in
PT
osteoclasts. Taken together, these results suggest a model in which RANKL stimulation
RI
facilitates the formation of a TRAF6-CYLD-BCL3 complex, leading to the activation of a
SC
novel non-canonical NF-κB signaling pathway in osteoclastogenesis induced by RANKL. In RANKL-induced osteoclastogenesis, we found that the BCL3-deubiquitination induces the
NU
BMDMs to develop into OCs with significantly larger and more numerous nuclei than those
MA
of the control group.
The BCL3 has been associated with the capacity to increase cell proliferation by
D
activating the cyclin D1 promoter, and an anti-apoptotic role by mediating the inhibition of
PT E
p53 activity[47, 48]. The regulatory role of BCL3 was investigated by detecting cyclin D1, a target gene of the p52 and BCL3 complex. Luciferase reporter gene assays and western blot
CE
analyses showed that treatment with RANKL reduced cyclin D1 activation and expression,
AC
which could be partly rescued by the overexpression of BCL3. Cyclin D1 is a specific downstream gene that plays a key role in regulating proliferation. Cell proliferation and differentiation are coordinated processes in the development of specialized cells. Previous research showed co-expression of cyclin D1 and Cdk4 in suppressed osteoclast formation, and that cell cycle arrest in osteoclast precursors is a prerequisite step for their differentiation into osteoclasts[35]. BCL3 also regulates TLR-mediated macrophage responses[43]. In conclusion, in this model, TRAF6 interacts with BCL3, and CYLD is an adapter that 17
ACCEPTED MANUSCRIPT links BCL3 and TRAF6. We provided evidence that CYLD is assembled to TRAF6 after RANKL stimulation. CYLD then removes the K63-linked polyubiquitin chain of BCL3 and the deubiquitinated BCL3 is transported out of the nucleus, leading to the transcriptional downregulation of the BCL3-dependent gene, cyclin D1. Finally, the resultant cell cycle
PT
arrest promotes precursors to differentiate into osteoclasts in response to bone
RI
resorption-inducing stimuli. This strongly suggests that the novel non-canonical NF-κB
SC
signaling pathway via BCL3 also plays a general role in osteoclastogenesis. Further studies will elucidate the role of TRAF6 in cycle-arrested quiescent osteoclast precursors. Since
NU
abnormal osteoclastogenesis has been reported in many metabolic bone diseases such as
MA
rheumatoid arthritis, osteoporosis, and Paget’s disease, our study on the role of BCL3
PT E
Acknowledgements
D
provides valuable insights into bone loss-associated diseases.
We thank Wen Zhou for help with Two-hybrid assays and Li Dan for his assistance in Co-IP
AC
CE
assays.
Funding source
This work was supported by the National Natural Science Foundation of China (grant no. 81072187, 81541056).
Competing interests No competing interests declared. 18
ACCEPTED MANUSCRIPT References [1] M. Asagiri, H. Takayanagi, The molecular understanding of osteoclast differentiation, Bone 40(2) (2007) 251-64. [2] A.M. Parfitt, Targeted and nontargeted bone remodeling: relationship to basic multicellular unit origination and progression, Bone 30(1) (2002) 5-7. [3] S.C. Manolagas, Birth and death of bone cells: basic regulatory mechanisms and implications for the pathogenesis and treatment of osteoporosis, Endocr Rev 21(2) (2000) 115-37. [4] B. Dankbar, M. Fennen, D. Brunert, S. Hayer, S. Frank, C. Wehmeyer, D. Beckmann, P. Paruzel, J. Bertrand, K.
PT
Redlich, C. Koers-Wunrau, A. Stratis, A. Korb-Pap, T. Pap, Myostatin is a direct regulator of osteoclast differentiation and its inhibition reduces inflammatory joint destruction in mice, Nat Med 21(9) (2015)
RI
1085-90.
[5] S. Rafiei, K. Tiedemann, S. Tabaries, P.M. Siegel, S.V. Komarova, Peroxiredoxin 4: a novel secreted mediator
SC
of cancer induced osteoclastogenesis, Cancer Lett 361(2) (2015) 262-70.
[6] J. Xiong, M. Onal, R.L. Jilka, R.S. Weinstein, S.C. Manolagas, C.A. O'Brien, Matrix-embedded cells control osteoclast formation, Nat Med 17(10) (2011) 1235-41.
NU
[7] L.B. Ivashkiv, Metabolic-epigenetic coupling in osteoclast differentiation, Nat Med 21(3) (2015) 212-3. [8] T. Nakashima, M. Hayashi, H. Takayanagi, New insights into osteoclastogenic signaling mechanisms, Trends In Endocrinology And Metabolism 23(11) (2012) 582-590.
MA
[9] L.E. Theill, W.J. Boyle, J.M. Penninger, RANK-L and RANK: T cells, bone loss, and mammalian evolution, Annu Rev Immunol 20 (2002) 795-823.
[10] C. Criscitiello, G. Viale, L. Gelao, A. Esposito, M. De Laurentiis, S. De Placido, M. Santangelo, A. Goldhirsch, G. Curigliano, Crosstalk between bone niche and immune system: Osteoimmunology signaling as a potential
D
target for cancer treatment, Cancer Treatment Reviews 41(2) (2015) 61-68. [11] H. Takayanagi, S. Kim, T. Taniguchi, Signaling crosstalk between RANKL and interferons in osteoclast
PT E
differentiation, Arthritis Research 4(Suppl 3) (2002) S227. [12] E. Tsuda, M. Goto, S. Mochizuki, K. Yano, F. Kobayashi, T. Morinaga, K. Higashio, Isolation of a novel cytokine from human fibroblasts that specifically inhibits osteoclastogenesis, Biochemical And Biophysical Research Communications 234(1) (1997) 137-142.
CE
[13] A.P. Trouvin, V. Goeb, Receptor activator of nuclear factor-kappaB ligand and osteoprotegerin: maintaining the balance to prevent bone loss, Clin Interv Aging 5 (2010) 345-54. [14] N. Kobayashi, Y. Kadono, A. Naito, K. Matsumoto, T. Yamamoto, S. Tanaka, J. Inoue, Segregation of
AC
TRAF6-mediated signaling pathways clarifies its role in osteoclastogenesis, EMBO J 20(6) (2001) 1271-80. [15] M.C. Walsh, Y. Choi, Biology of the TRANCE axis, Cytokine Growth Factor Rev 14(3-4) (2003) 251-63. [16] W.J. Boyle, W.S. Simonet, D.L. Lacey, Osteoclast differentiation and activation, Nature 423(6937) (2003) 337-42.
[17] G.R. Crabtree, E.N. Olson, NFAT signaling: choreographing the social lives of cells, Cell 109 Suppl (2002) S67-79. [18] B.G. Darnay, A. Besse, A.T. Poblenz, B. Lamothe, J.J. Jacoby, TRAFs in RANK signaling, Adv Exp Med Biol 597 (2007) 152-9. [19] M.A. Lomaga, W.C. Yeh, I. Sarosi, G.S. Duncan, C. Furlonger, A. Ho, S. Morony, C. Capparelli, G. Van, S. Kaufman, A. van der Heiden, A. Itie, A. Wakeham, W. Khoo, T. Sasaki, Z. Cao, J.M. Penninger, C.J. Paige, D.L. Lacey, C.R. Dunstan, W.J. Boyle, D.V. Goeddel, T.W. Mak, TRAF6 deficiency results in osteopetrosis and defective interleukin-1, CD40, and LPS signaling, Genes Dev 13(8) (1999) 1015-24. 19
ACCEPTED MANUSCRIPT [20] A. Naito, S. Azuma, S. Tanaka, T. Miyazaki, S. Takaki, K. Takatsu, K. Nakao, K. Nakamura, M. Katsuki, T. Yamamoto, J. Inoue, Severe osteopetrosis, defective interleukin-1 signalling and lymph node organogenesis in TRAF6-deficient mice, Genes Cells 4(6) (1999) 353-62. [21] L. Deng, C. Wang, E. Spencer, L. Yang, A. Braun, J. You, C. Slaughter, C. Pickart, Z.J. Chen, Activation of the IkappaB kinase complex by TRAF6 requires a dimeric ubiquitin-conjugating enzyme complex and a unique polyubiquitin chain, Cell 103(2) (2000) 351-61. [22] C. Wang, L. Deng, M. Hong, G.R. Akkaraju, J. Inoue, Z.J.J. Chen, TAK1 is a ubiquitin-dependent kinase of MKK and IKK, Nature 412(6844) (2001) 346-351. [23] G. Takaesu, S. Kishida, A. Hiyama, K. Yamaguchi, H. Shibuya, K. Irie, J. Ninomiya-Tsuji, K. Matsumoto, TAB2,
PT
a novel adaptor protein, mediates activation of TAK1 MAPKKK by linking TAK1 to TRAF6 in the IL-1 signal transduction pathway, Mol Cell 5(4) (2000) 649-58.
RI
[24] A. Kanayama, R.B. Seth, L. Sun, C.K. Ea, M. Hong, A. Shaito, Y.H. Chiu, L. Deng, Z.J. Chen, TAB2 and TAB3 activate the NF-kappaB pathway through binding to polyubiquitin chains, Mol Cell 15(4) (2004) 535-48.
SC
[25] M. Landstrom, The TAK1-TRAF6 signalling pathway, Int J Biochem Cell Biol 42(5) (2010) 585-9. [26] J. Mizukami, G. Takaesu, H. Akatsuka, H. Sakurai, J. Ninomiya-Tsuji, K. Matsumoto, N. Sakurai, Receptor Activator of NF- B Ligand (RANKL) Activates TAK1 Mitogen-Activated Protein Kinase Kinase Kinase through a
NU
Signaling Complex Containing RANK, TAB2, and TRAF6, Molecular and Cellular Biology 22(4) (2002) 992-1000. [27] S.M. Jung, J.H. Lee, J. Park, Y.S. Oh, S.K. Lee, J.S. Park, Y.S. Lee, J.H. Kim, J.Y. Lee, Y.S. Bae, S.H. Koo, S.J. Kim, S.H. Park, Smad6 inhibits non-canonical TGF-beta1 signalling by recruiting the deubiquitinase A20 to TRAF6,
MA
Nat Commun 4 (2013) 2562.
[28] Y. Wang, B. Viollet, R. Terkeltaub, R. Liu-Bryan, AMP-activated protein kinase suppresses urate crystal-induced inflammation and transduces colchicine effects in macrophages, Ann Rheum Dis 75(1) (2016) 286-94.
D
[29] K. Wang, Y. Song, W. Liu, X. Wu, Y. Zhang, S. Li, L. Kang, J. Tu, K. Zhao, W. Hua, C. Yang, The noncoding RNA linc-ADAMTS5 cooperates with RREB1 to protect from intervertebral disc degeneration through inhibiting
PT E
ADAMTS5 expression, Clin Sci (Lond) 131(10) (2017) 965-979. [30] H. Zhang, C. Wu, L.E. Matesic, X. Li, Z. Wang, B.F. Boyce, L. Xing, Ubiquitin E3 Ligase Itch Negatively Regulates Osteoclast Formation by Promoting Deubiquitination of Tumor Necrosis Factor (TNF) Receptor-associated Factor 6, Journal of Biological Chemistry 288(31) (2013) 22359-22368.
CE
[31] T. Mukai, S. Ishida, R. Ishikawa, T. Yoshitaka, M. Kittaka, R. Gallant, Y.L. Lin, R. Rottapel, M. Brotto, E.J. Reichenberger, Y. Ueki, SH3BP2 cherubism mutation potentiates TNF-alpha-induced osteoclastogenesis via NFATc1 and TNF-alpha-mediated inflammatory bone loss, J Bone Miner Res 29(12) (2014) 2618-35.
AC
[32] Q. Yin, S.C. Lin, B. Lamothe, M. Lu, Y.C. Lo, G. Hura, L.X. Zheng, R.L. Rich, A.D. Campos, D.G. Myszka, M.J. Lenardo, B.G. Darnay, H. Wu, E2 interaction and dimerization in the crystal structure of TRAF6, Nature Structural & Molecular Biology 16(6) (2009) 658-U97. [33] R. Massoumi, K. Chmielarska, K. Hennecke, A. Pfeifer, R. Fassler, Cyld inhibits tumor cell proliferation by blocking Bcl-3-dependent NF-kappaB signaling, Cell 125(4) (2006) 665-77. [34] W. Jin, M. Chang, E.M. Paul, G. Babu, A.J. Lee, W. Reiley, A. Wright, M. Zhang, J. You, S.C. Sun, Deubiquitinating enzyme CYLD negatively regulates RANK signaling and osteoclastogenesis in mice, J Clin Invest 118(5) (2008) 1858-66. [35] T. Mizoguchi, A. Muto, N. Udagawa, A. Arai, T. Yamashita, A. Hosoya, T. Ninomiya, H. Nakamura, Y. Yamamoto, S. Kinugawa, M. Nakamura, Y. Nakamichi, Y. Kobayashi, S. Nagasawa, K. Oda, H. Tanaka, M. Tagaya, J.M. Penninger, M. Ito, N. Takahashi, Identification of cell cycle-arrested quiescent osteoclast precursors in vivo, J Cell Biol 184(4) (2009) 541-54. 20
ACCEPTED MANUSCRIPT [36] Z.J. Chen, Ubiquitin signalling in the NF-kappaB pathway, Nat Cell Biol 7(8) (2005) 758-65. [37] T.D. Gilmore, Introduction to NF-kappaB: players, pathways, perspectives, Oncogene 25(51) (2006) 6680-4. [38] C. Zheng, Q. Yin, H. Wu, Structural studies of NF-kappaB signaling, Cell Res 21(1) (2011) 183-95. [39] M.S. Hayden, S. Ghosh, NF-kappaB, the first quarter-century: remarkable progress and outstanding questions, Genes Dev 26(3) (2012) 203-34. [40] S.C. Chaudhary, X. Tang, A. Arumugam, C. Li, R.K. Srivastava, Z. Weng, J. Xu, X. Zhang, A.L. Kim, K. McKay, C.A. Elmets, L. Kopelovich, D.R. Bickers, M. Athar, Shh and p50/Bcl3 signaling crosstalk drives pathogenesis of BCCs in Gorlin syndrome, Oncotarget 6(34) (2015) 36789-814. [41] G.P. Nolan, T. Fujita, K. Bhatia, C. Huppi, H.C. Liou, M.L. Scott, D. Baltimore, The bcl-3 proto-oncogene
PT
encodes a nuclear I kappa B-like molecule that preferentially interacts with NF-kappa B p50 and p52 in a phosphorylation-dependent manner, Molecular and Cellular Biology 13(6) (1993) 3557-3566.
RI
[42] N. Watanabe, T. Iwamura, T. Shinoda, T. Fujita, Regulation of NFKB1 proteins by the candidate oncoprotein BCL-3: generation of NF-kappaB homodimers from the cytoplasmic pool of p50-p105 and nuclear translocation,
SC
EMBO J 16(12) (1997) 3609-20.
[43] D.L. Bundy, T.W. McKeithan, Diverse Effects of BCL3 Phosphorylation on Its Modulation of NF- B p52 Homodimer Binding to DNA, Journal of Biological Chemistry 272(52) (1997) 33132-33139.
NU
[44] S.M. Plafker, K.S. Plafker, A.M. Weissman, I.G. Macara, Ubiquitin charging of human class III ubiquitin-conjugating enzymes triggers their nuclear import, J Cell Biol 167(4) (2004) 649-59. [45] A. Keutgens, K. Shostak, P. Close, X. Zhang, B. Hennuy, M. Aussems, J.P. Chapelle, P. Viatour, A. Gothot, M.
MA
Fillet, A. Chariot, The repressing function of the oncoprotein BCL-3 requires CtBP, while its polyubiquitination and degradation involve the E3 ligase TBLR1, Mol Cell Biol 30(16) (2010) 4006-21. [46] H. Zhang, H. Hu, N. Greeley, J. Jin, A.J. Matthews, E. Ohashi, M.S. Caetano, H.S. Li, X. Wu, P.K. Mandal, J.S. McMurray, S.J. Moghaddam, S.C. Sun, S.S. Watowich, STAT3 restrains RANK- and TLR4-mediated signalling by
D
suppressing expression of the E2 ubiquitin-conjugating enzyme Ubc13, Nat Commun 5 (2014) 5798. [47] S.D. Westerheide, M.W. Mayo, V. Anest, J.L. Hanson, A.S. Baldwin, Jr., The putative oncoprotein Bcl-3
PT E
induces cyclin D1 to stimulate G(1) transition, Mol Cell Biol 21(24) (2001) 8428-36. [48] D. Kashatus, P. Cogswell, A.S. Baldwin, Expression of the Bcl-3 proto-oncogene suppresses p53 activation,
AC
CE
Genes Dev 20(2) (2006) 225-35.
21
ACCEPTED MANUSCRIPT Figure legends Figure 1. Interaction between BCL3 and TRAF6 (A) BCL3 binds specifically to GST-TRAF6 in a GST pull-down assay. (B)BCL3 was immuno-precipitated by TRAF6 and TRAF6 was immuno-precipitated by BCL3 after
PT
RANKL treatment. (C) The interaction between BCL3 and TRAF6 was detected after
RI
RANKL stimulation by immuno-blotting. (D-E) TRAF6 and BCL3 mutants were constructed
SC
and verified by immuno-blotting. (F) Full-length 3Flag-BCL3 and five His-TRAF6 mutants co-transfected 293T cells. Interaction was confirmed by immuno-blotting. (G) Full length
NU
His-TRAF6 and four 3Flag-BCL3 mutants co-transfected 293T cells. Interaction was
MA
confirmed by immuno-blotting.
D
Figure 2. BCL3 negatively regulates osteoclastogenesis
PT E
(A-B) In control group and BCL3 experimental group, BMDMs were cultured in M-CSF media either in the absence or presence of 100 ng/mL of RANKL for 7 days and then
CE
subjected to TRAP staining. (C-D) The levels of BCL3 and osteoclast osteoclastogenic
AC
markers Cathepsin K, Mmp9, TRAP, and NFATC1 were determined by Western blot and RT-qPCR，*P < 0.05 versus RANKL(-) . (E-F) The effect of BCL3 on RANKL-induced osteoclastic function is examined by bone resorption assay.
Figure 3. BCL3 affected RANKL-induced NF-κB signalling via p52 (A) BMDMs stably expressing BCL3 that were transfected with a NF-κB luciferase reporter construct were pre-treated with RANKL (100 ng/mL) and then treated with the NF-κB 22
ACCEPTED MANUSCRIPT inhibitor BAY11-7082. (B) BMDMs were stably transfected with BCL3 prior to RANKL (100 ng/mL) stimulation. The expression levels of p100, p52, and p65 in the cytoplasmic and the nuclear extracts were determined using western blot analysis. Subcellular fraction purity and the equality of sample loading were evaluated by analysing the levels of β-actin and
SC
RI
BCL3 in the cytoplasmic and the nuclear detected in BMDMs.
PT
Lamin B1. (C) Densitometric analysis shows the relative amount of p100, p52, p65 and
Figure 4. RANKL mediates BCL3 deubiquitination and prevents nuclear accumulation
NU
of BCL3
MA
(A) Endogenous ubiquitination of BCL3 was detected in the presence or absence of RANKL in BMDMs regardless of TRAF6 depletion. (B) Confocal plane of TRAF6 (green), BCL3
D
(red), and DAPI (blue) in untreated and RANKL-treated BMDMs. (C)The expression of
CE
presence of RANKL.
PT E
BCL3 in cytosolic and nuclear extracts were investigated by Western blot in the absence or
AC
Figure 5. BCL3 interaction with TRAF6 involves CYLD (A) TRAF6 and BCL3 were immuno-precipitated by CYLD. (B) BCL3 and CYLD were immuno-precipitated by and TRAF6. (C) TRAF6 and CYLD were immuno-precipitated by BCL3. (D) BMDMs were transfected with K48R or K63R HA-tagged ubiquitin and 3Flag-tagged BCL3 before or after transfection with CYLD shRNA. BCL3 was immuno-precipitated and ubiquitination was detected in the presence or absence of RANKL. (E) BCL3 (red) and CYLD (green) localization in the absence or presence of RANKL (100 23
ACCEPTED MANUSCRIPT ng/mL) was detected by confocal microscopy.
Figure 6. RANKL regulates cyclin D1 expression through BCL3 and NF-κB (A-B) Western blot and RT-qPCR assays shows the expression of cyclin D1 in BMDMs
PT
pre-treated with varying concentrations of RANKL, *P < 0.05 versus 0 ng/ml. (C) Activation
RI
of the cyclin D1 promoter luciferase reporter in BMDMs co-transfected with control or BCL3
SC
vector and control or BCL3-specific shRNA (100 nmol/L) in the absence or presence of RANKL (100 ng/mL). (D) ChIP assay and RT-qPCR shows the binding of cyclin D1
NU
promoter in BMDMs stably transfected with control or BCL3 vector and control or
MA
BCL3-specific shRNA (100 nmol/L) in the absence or presence of RANKL (100 ng/mL). (E) The proliferation of BMDMs transfected with BCL3 or sh-BCL3 were detected under
PT E
D
RANKL condition for 0, 2, 4, 6 days respectively.
Figure 7. Schematic a novel non-canonical NF-κB signalling in osteoclastogenesis.
CE
TRAF6 acts as a mediator to interact with BCL3 in involving CYLD. CYLD is assembled to
AC
TRAF6 after RANKL stimulation and removes the polyubiquitin chain from BCL3. The retention of deubiquitinated BCL3 in the cytoplasm leading to the transcriptional downregulation of the BCL3-dependent cyclin D1. Cell cycle arrest promptly promotes osteoclastogenic markers expression.
24
ACCEPTED MANUSCRIPT Table. 1 RT-PCR primer sequence Sequence（Forward）
Sequence（Reverse）
BCL3 CathK MMP-9 TRAP NFATC1 Cyclin D1 GAPDH
AACCTGCCTACACCCCTATAC GCAGAAGAACCGGGGTATTGA AGACCTGGGCAGATTCCAAAC AGGACGACTGTTCAGCACG CACCGCATCACAGGGAAGAC GCTGCGAAGTGGAAACCATC GGTGGACCTCATGGCCTACA
CACCACAGCAATATGGAGAGG GAAGGAGGTCAGGCTTGCAT CGGCAAGTCTTCCGAGTAGT CCGGGCAACAATGTCCAAAAG GCACAGTCAATGACGGCTC CCTCCTTCTGCACACATTTGAA CTCTCTTGCTCTCAGTATCCTTGCT
AC
CE
PT E
D
MA
NU
SC
RI
PT
Primer Name
25
ACCEPTED MANUSCRIPT
AC
CE
PT E
D
MA
NU
SC
RI
PT
Highlights： Osteoclasts play a crucial role in understanding of the skeletal system in health as well as disease. BCL3 arrest cell cycle in osteoclast precursors that is a prerequisite step for their differentiation into osteoclasts via its’ deubiquitination. TRAF6 mediate a novel non-canonical NF-κB signalling via BCL3 to play a general role in RANKL-induced osteoclastogenesis.
26
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Kun Wang, Shuai Li, Yong Gao, Xiaobo Feng, Wei Liu, Rongjin Luo, Yu Song, JiTu, Yingle Liu, Cao Yang PII: DOI: Reference:
S8756-3282(18)30247-3 doi:10.1016/j.bone.2018.06.015 BON 11681
To appear in:
Bone
Received date: Revised date: Accepted date:
22 January 2018 15 June 2018 18 June 2018
Please cite this article as: Kun Wang, Shuai Li, Yong Gao, Xiaobo Feng, Wei Liu, Rongjin Luo, Yu Song, JiTu, Yingle Liu, Cao Yang , BCL3 regulates RANKL-induced osteoclastogenesis by interacting with TRAF6 in bone marrow-derived macrophages. Bon (2018), doi:10.1016/j.bone.2018.06.015
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
ACCEPTED MANUSCRIPT BCL3
Regulates
RANKL-induced
Osteoclastogenesis
by
Interacting with TRAF6 in Bone Marrow–Derived Macrophages Kun Wanga, †, Shuai Lia, †, Yong Gaoa, Xiaobo Fenga, Wei Liub, Rongjin Luoa, Yu Songa, JiTua,
Department of Orthopedics, Union Hospital, Tongji Medical College, Huazhong University
RI
a
PT
Yingle Liuc* and Cao Yanga *
SC
of Science and Technology, Wuhan 430022, China
Department of Orthopedics, First Hospital of Wuhan, Wuhan 430022, China
c
State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan
NU
b
MA
430072, China.
PT E
D
Running head: BCL3 interacts with TRAF6
*To whom correspondence should be addressed:
CE
Prof. Cao Yang, Department of Orthopedics, Union Hospital, Tongji Medical College,
AC
Huazhong University of Science and Technology, Wuhan, 430022, China. Email: [email protected]. Tel: +86-027-85351626; Fax: +86-027-85351626. Prof. Yingle Liu, State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan, 430022, China. Email: [email protected]. Tel: +86-027-68752938; Fax: +86-027-68752938.
†
Equal contribution 1
ACCEPTED MANUSCRIPT Abbreviations：TRAF6, tumor necrosis factor receptor-associated factor 6; BCL3, B-cell chronic lymphatic leukemia protein 3; TAK1, transforming growth factor β-activated kinase 1; RANKL, Receptor activator of nuclear factor-κB ligand; NFATC1, nuclear factor of
PT
activated T-cells 1; BMDM, bone marrow derived macrophage; IKK, I-κB kinase
RI
Abstract
SC
Objective: Tumor necrosis factor receptor-associated factor 6 (TRAF6) is an essential component of the signaling complex that mediates osteoclastogenesis. As an adaptor protein
NU
of E3 ligase function, TRAF6 regulates NF-κB signaling via TAK1 and I-κB kinase (IKK)
MA
activation. Here, we investigated novel mechanisms by which TRAF6 signaling is regulated under receptor activator of nuclear factor-κB ligand (RANKL)-induced osteoclastogenesis.
interactions
were
confirmed
PT E
The
D
Design: A yeast two-hybrid screen system identified cellular factors that interact with TRAF6. by
glutathione
S-transferase
pull-down
and
co-immunoprecipitation assays, followed by immuno-blotting. The role of TRAF6 in bone
CE
growth and remodeling was determined by osteoclast differentiation and bone-resorption pit
AC
assays. Regulatory mechanisms were examined by co-immunoprecipitation, immuno-blotting, real-time polymerase chain reaction, and luciferase reporter assays. Results: We show that B-cell chronic lymphatic leukemia protein 3 (BCL3) interacts with TRAF6 through its ankyrin-repeat domain and inhibits osteoclastogenesis in bone marrow derived macrophages (BMDMs). Further, TRAF6 interacts with CYLD to mediate BCL3 deubiquitination, which facilitates the cytoplasmic accumulation of BCL3 and represses BCL3 and p50 complex-mediated cyclin D1 transcription. 2
ACCEPTED MANUSCRIPT Conclusions: TRAF6 promotes RANKL-induced osteoclastogenesis by regulating novel non-canonical NF-κB signaling via BCL3 deubiquitination, indicating that BCL3 provides valuable insights into bone loss-associated diseases.
PT
Keywords: osteoclastogenesis; tumor necrosis factor receptor-associated factor 6; B-cell
SC
RI
chronic lymphatic leukemia protein 3
1. Introduction
NU
The human bone is remodeled at a high rate; approximately 10% of the total bone content is
MA
replaced every year in adult humans. Osteoclasts periodically resorb old bone and osteoblasts deposit new bone in the resulting cavities, a process known as remodeling[1, 2]. Bone
D
remodeling is disrupted in a variety of pathological conditions, including osteoporosis,
PT E
rheumatoid arthritis, and osteolysis from cancer, where bone resorption is not balanced by bone formation[3-5]. Remodeling involves both the destruction and formation of bones and
CE
the two processes are tightly coupled and controlled by signaling molecules. Resorption of
AC
cartilage and bone is essential for the development and regeneration of the skeleton[6]. Bone resorption involves osteoclast-mediated degradation and removal of the mineralized bone matrix[7]. Osteoclasts, derived from myeloid bone-marrow precursor cells, play a crucial role in both physiological and pathological bone resorption[8]. Therefore, elucidating the regulatory mechanisms involved in osteoclastogenesis is imperative for a deeper understanding of the skeletal system in healthy as well as diseased condition. Receptor activator of nuclear factor-κB ligand (RANKL) is the key cytokine that 3
ACCEPTED MANUSCRIPT induces osteoclast differentiation and is essential for their maturation, function, and survival[9-11]. RANKL is expressed by osteoclastogenic cells, such as osteoblasts and bone marrow stromal cells, or is released in a soluble form in the bone microenvironment. Its receptor, RANK (receptor activator of nuclear factor κB), is a type I trans-membrane protein
PT
similar to other members of the TNF receptor superfamily and is expressed on osteoclast
RI
progenitors and mature osteoclasts[12, 13]. The binding of RANKL to RANK results in the
SC
recruitment of the TNF receptor-associated factors (TRAFs) [14, 15]. TRAF-mediated RANK signal transduction activates a series of downstream signaling transcription factors including
NU
activator protein-1 (AP-1), NF-κB, and NFATC1 to initiate the expression of genes for
MA
osteoclastogenesis and to coordinate osteoclast functions[16, 17]. Among the TRAFs family, TRAF6 plays a principal role in osteoclast activation as the main adaptor molecule that links
D
to RANK[18] and is well documented by genetic disruption methods[19, 20]. TRAF6
PT E
interacts with transforming growth factor β-activated kinase 1 (TAK1) via TRAF6-mediated Lys 63-linked polyubiquitination. This K63 polyubiquitination activates the TAK1 kinase
CE
complex, which phosphorylates I-κB kinase (IKK) at key serine residues in the activation
AC
loop, resulting in IKK activation[21, 22]. TAK1 binding protein 2 (TAB2) is the regulatory subunit for TAK1. When the TAK1 kinase complex is recruited to the TRAF6 complex and activated, it stimulates NF-κB activation through IKK as well as AP-1 activation through JNK. Thus, TAK1 and TAB2 function at the same point in the RANK signaling pathway as TRAF6[23-25]. TRAF6, TAB2, and TAK1 assemble into the RANK complex upon ligand engagement, and this complex formation is important for RANK signaling in regulating the development and function of osteoclasts[26]. 4
ACCEPTED MANUSCRIPT To discover other mechanisms by which the signaling cascades from TRAF6 are regulated under RANKL, a yeast two-hybrid screen system was employed to search for cellular factors that interact with TRAF6. This approach identified B-cell chronic lymphatic leukemia protein 3 (BCL3) as an interacting partner of TRAF6, which regulates
PT
non-canonical I-κB signaling independent of IKK. The function of BCL3 in
RI
osteoclastogenesis remains unknown. Here, we showed that bone marrow derived
SC
macrophages (BMDMs) lacking BCL3 were prone to differentiation to osteoclasts. Under RANKL stimulation, cylindromatosis (CYLD) was assembled to the TRAF6 complex. The
NU
K63-linked polyubiquitin chain of BCL3 was then removed by CYLD, which resulted in the
MA
retention of BCL3 in the cytoplasm, inhibiting the transcription of NF-κB target genes such as the cyclin D1 gene. Our data indicated that TRAF6 influences the development and
D
function of osteoclasts by regulating novel non-canonical NF-κB signaling via BCL3
PT E
deubiquitination.
2. Materials and methods
CE
2.1 Two-hybrid and galactosidase assays
AC
Two-hybrid interaction analyses were conducted using the Matchmaker Two-Hybrid System (Clontech) according to the manufacturer’s instructions. In brief, after the selection of co-transformants, the interactions of fusion proteins were detected on high-stringency plates (SD/Ade/His/Leu/Trp) and verified by β-galactosidase filter assays. 2.2 Plasmids The full-length human TRAF6 cDNA was synthesized by Bio-Transduction Lab Co., Ltd (China). The product was verified as TRAF6 cDNA by sequencing. Full-length TRAF6 5
ACCEPTED MANUSCRIPT cDNA was subcloned into the EcoRI-BamHI site of pcDNA3.1/His mammalian expression vector (Invitrogen, Carlsbad, CA, USA). The expression vectors for the mutants of TRAF6 described previously were obtained [27] and the TRAF6 mutant sequences were subcloned into pcDNA3.1/His vector. The expression plasmid for human BCL3 was pCMV/3Flag,
PT
provided by GENECHEM (Shanghai, China). The different regions of the BCL3 protein
RI
(N-terminal truncated or C-terminal truncated BCL3 and ANK BCL) were amplified from
SC
full-length 3Flag-BCL3 cDNA by PCR and subcloned into the pCMV/3Flag vector. sh-RNA against TRAF6 (sh-TRAF6), CYLD (sh-CYLD), BCL3 (sh-BCL3) were synthesized by
NU
GENECHEM (Shanghai, China) and subcloned into GV102 (Genechem Co., Ltd, Shanghai,
MA
China). The pcDNA3.1 and scramble shRNA were applied as controls. 2.3 Cell culture and transfection
D
HEK293T was maintained in DMEM supplemented with 10% heat-inactivated FBS (Life
PT E
Technologies, Inc.), penicillin (100 units/mL), and streptomycin (100 μg/mL) at 37 °C under 5% CO2 atmosphere. BMDMs were prepared from femurs and tibias of C57BL/6 mice (6
CE
weeks of age, which is a time of rapid growth) in the presence of macrophage
AC
colony-stimulating factor (M-CSF) (5 ng/mL, R&D, Minneapolis, MN), as previously described[28]. After 7 days, cultures were treated with RANKL (100 ng/mL, R&D, Minneapolis, MN). The growth media were changed every 2 days until the macrophages grew to confluence. For the transfection studies, HEK293T cells and BMDMs were transfected with various expression vectors using Lipofectamine 2000 reagent (Thermo, Waltham, MA, USA) according to the manufacturer’s instructions. The study was performed in adherence to the National Institutes of Health guidelines for the use of experimental 6
ACCEPTED MANUSCRIPT animals. The protocol was approved by the Animal Care and Ethics Committee of Huazhong University of Science and Technology. 2.4 Cell MTT assay After overexpression and knockdown of BCL3, 2×104 cells were seeded into 96-well plates.
PT
Then, the cells were treated with RANKL (100 ng/ml). After treatment for 0, 2, 4, 6 days.
RI
Cell proliferation was monitored using the 2-(4, 5-dimethyltriazol-2-yl)-2, 5-diphenyl
SC
tetrazolium bromide (MTT, Sigma) colorimetric assay. Three independent experiments were performed for each experimental condition.
NU
2.5 Luciferase reporter gene assay
MA
BMDMs transfected with luciferase reporter constructs controlled by either NF-κB binding promoter elements or human cyclin D1 promoter were plated in 24-well plates. Cells were
D
pre-treated with RANKL or the NF-κB inhibitor, BAY11-7082. Luciferase activity was
PT E
measured 24h after transfection using Dual-Luciferase assay system according to the manufacturer's instructions (Promega, Madison, WI, USA). The luciferase activity was
CE
normalized against Renilla luciferase activity and all experiments were carried out in
AC
triplicate. The pNF-κB-luc plasmid (Beyotime Institute of Biotechnology, China) containing four NF-κB binding motifs (GGGAATTTCC). The Cyclin D1 promoter region was constructed from –1000 to +100 bp relative to the TSS as described previously[29]. 2.6 GST-pull down assay BCL3 expressed in HEK293T cells were lysed with GST-FISH buffer, then incubated with purified GST-TRAF6 or GST proteins for 4 h, and subsequently incubated with Glutathione Sepharose beads for 2 h at 4°C. The beads were washed with cell lysis buffer. After 7
ACCEPTED MANUSCRIPT separation by 12% SDS-PAGE, the precipitate was analyzed by western blotting. 2.7 Real-time PCR analysis Total RNA was isolated from cells using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Reverse transcription reactions were conducted with Transcriptor First Strand cDNA
PT
Synthesis Kit (TaKaRa Biotechnology, Otsu, Japan). Real-time PCR was performed using
RI
SYBR® Green kit Master Mix (Applied Biosystems, Foster City, CA) and the results were
SC
detected using an ABI 7500 Sequencing Detection System. The primers for the genes are listed in Table 1. Data were analyzed with the 2−ΔΔCt method and all values were normalized
NU
to the level of the housekeeping gene, GAPDH.
MA
2.8 Immuno-precipitation and western blotting
Immuno-precipitation and western blotting were performed as previously described[30, 31].
D
The cells were washed with ice-cold PBS and lysed in lysis buffer containing protease and
PT E
phosphatase inhibitors. The cell debris was cleared by centrifugation, and the lysates were immunoprecipitated. The antibodies were collected on protein A/G beads (Santa Cruz
CE
Biotechnology, Santa Cruz, CA) for 2 h at 4 °C. The beads were washed with ice-cold lysis
AC
buffer and resuspended in SDS sample buffer for blotting analysis. Protein lysates were resolved by SDS–PAGE and transferred onto polyvinylidene fluoride membranes (Amersham Biosciences, USA). The membranes were incubated with primary antibodies at 4 °C overnight and secondary antibodies at room temperature for 1 h. Antibodies were specific for BCL3, TRAP, NFATC1, Cathepsin K, Ubiquitin, p100 and cyclin D1 (Abcam Inc, Cambridge, MA) and TRAF6, CYLD, MMP-9, p52, p65, β-actin and Lamin B (Santa Cruz Biotechnology, Santa Cruz, CA). The protein signals were quantified by scanning 8
ACCEPTED MANUSCRIPT densitometry using a FluorChem Q System (Alpha Innotech, CA, USA). 2.9 Chromatin immuno-precipitation (ChIP) ChIP was performed with EZ-ChIP kit (Upstate Biotechnology, Temecula, CA) according to manufacturer's instructions using p52 antibodies and rabbit IgG. DNA was sonicated into
PT
fragments (average size, 200 bp). qRT-PCR was performed with SYBR Green PCR Master
RI
Mix (Applied Biosystems, Foster City, CA, USA). The amount of immuno-precipitated DNA
SC
was calculated in reference to a standard curve and normalised to input DNA. 2.10 Osteoclast differentiation assay and bone resorption pit assays
NU
BMDMs were cultured in DMEM supplemented with 10% FBS and treated with RANKL
MA
(100 ng/mL) for 7 days. TRAP staining was performed and the number of TRAP-positive multinucleated cells (MNCs: three or more nuclei per cell) was determined. The cells were
D
incubated at 37°C in 5% CO2 for 7 days in osteo slice surface, and the medium was changed
PT E
every 3 days. After removing the cells, the resorption pits on the plates were visualized with toluidine blue, imaged and quantified using the Image J software. The results were expressed
CE
as percentages of the total plate area.
AC
2.11 Statistical analysis
All data were analyzed using GraphPad Prism 5.0 software (San Diego, CA, USA) and expressed as the mean with 95% confidence intervals (CI). The results are representative of three independent experiments consisting of three replicates per experiment. Two-tailed, unpaired Student’s t-tests were used to compare two groups, one-way ANOVAs were used to compare three or more groups, and two-way ANOVAs were used to compare multi-factor treatments between three or more groups to test significant differences. In all cases, P < 0.05 9
ACCEPTED MANUSCRIPT was considered statistically significant. 3. Results 3.1. Identification of BCL3 as a factor interacting with TRAF6 We obtained 10 clones from 2.0 × 106 yeast transformants that exhibited a positive phenotype.
PT
One of these clones encoded an ANK portion of BCL3. To confirm the interaction of BCL3
RI
with TRAF6, we performed a GST pull-down assay using bacterially expressed GST-TRAF6.
SC
In vitro translated BCL3 did not bind to GST-bound Sepharose beads alone, but did bind to Sepharose beads conjugated to recombinant GST-TRAF6 (Figure 1A). This result suggested
NU
that BCL3 interacted specifically with TRAF6 in vitro. Next, we performed
MA
co-immunoprecipitation experiments to analyze the interaction of BCL3 with TRAF6 in cells under RANKL stimulation. The results demonstrated that BCL3 was precipitated with
D
TRAF6 in BMDMs, and conversely, TRAF6 was also precipitated with BCL3 (Figure 1B).
PT E
We also found that the interactions between TRAF6 and BCL3 were enhanced by RANKL stimulation as compared to without RANKL stimulation (Figure 1C).
CE
To define the domains within BCL3 and TRAF6 responsible for this interaction, we
AC
performed immuno-precipitation assays using TRAF6 truncated mutants (Figure 1D) and BCL3 truncated mutants (Figure 1E). 3Flag-tagged ANK motifs of BCL3 and 3Flag-tagged BCL3 with truncated N-terminal or C-terminal could be detected in the immuno-complexes isolated from cell lysates. Co-immunoprecipitation assays indicated that ankyrin repeats of BCL3 were sufficient for binding with RING domain of TRAF6 (Figure 1F, G). Taken together, these results suggested that TRAF6 interacts with BCL3. 3.2 BCL3 is an inhibiting factor in osteoclastogenesis 10
ACCEPTED MANUSCRIPT The TRAF6 interaction with BCL3 led us to examine the role of BCL3 in regulating osteoclast differentiation. BMDMs were cultured in M-CSF growth media in either the absence or presence of RANKL. BCL3 overexpression alone did not significantly increase TRAP positive osteoclasts (OCs). As expected, treatment with RANKL at a concentration of
PT
100 ng/mL induced the generation of TRAP positive OCs (Figure 2A, B. P < 0.05).
RI
Remarkably, this result indicated that there were fewer OCs in BMDMs after BCL3
SC
overexpression without RANKL stimulation (Figure 2A, B. P<0.05). Consistent with these results, the induction of osteoclastogenic markers, including Cathepsin K, MMP-9, TRAP,
NU
and NFATC1, were significantly increased after RANKL treatment (P < 0.05). However,
MA
BCL3 suppressed RANKL-induced osteoclast-associated gene expression (Figure 2C, D. P < 0.05). In addition, treatment with RANKL was shown to increase the area of osteoclast bone
D
resorption pits (Figure 2E). We also found that osteoclastic bone resorption was significantly
PT E
decreased in BMDMs overexpressing BCL3 following RANKL stimulation (Figure 2F. P < 0.05). In the case of just BCL3 overexpression, there was no significant difference in
CE
osteoclastic bone resorption (Figure 2F. P ＞ 0.05). This result suggests that BCL3
AC
attenuates the RANKL-induced bone resorptive activity of osteoclasts in vitro. 3.3. BCL3 affects RANKL-induced NF-κB signaling via p52 We next tested the effect of BCL3 on the activation of NF-κB induced by RANKL. An inhibitory effect of BCL3 on the activation of NF-κB was revealed in experiments using luciferase activity assays. RANKL significantly induced the transcriptional activity of NF-κB in BMDMs that were transfected with NF-κB-luc (Figure 3A. P < 0.05). In contrast, treatment with BCL3 or the NF-κB inhibitor BAY11-7082 significantly inhibited the 11
ACCEPTED MANUSCRIPT RANKL-induced transcriptional activity of NF-κB (Figure 3A. P < 0.05). The distributions of p52, its precursor p100, and p65 were assessed by western blot analysis using the cytoplasmic and nuclear extracts of BMDMs. Under normal conditions, the distribution of p100 was not significantly different between untreated and RANKL treated
PT
cells, whereas BCL3 increased the level of p100 slightly (Figure 3B lane 1 and Figure 3C).
RI
Furthermore, under BCL3 overexpression conditions, the level of p100 remarkably higher
SC
following RANKL stimulation when compared without RANKL treatment (Figure 3B lane 1 and Figure 3C). The overexpression of BCL3 augmented the levels of p52 and attenuated the
NU
levels of p65 in the nuclear extracts (Figure 3B lane 2, 3 and Figure 3C). It was p65 rather
MA
than p52 nuclear migration increased when stimulated with RANKL alone (Figure 3B lane 2, 3 and Figure 3C). Together, BCL3 and RANKL significantly increased cytoplasmic levels of
D
p100. Our results indicated that increased BCL3 levels contributed to the processing of p100
PT E
to generate p52 and increased the nuclear translocation of p52 regardless of RANKL induction.
AC
BCL3
CE
3.4. RANKL mediates BCL3 deubiquitination and prevents nuclear accumulation of
As an E3 ubiquitin ligase, TRAF6 contains a highly conserved RING domain that is known to be indispensable for the downstream signaling and ubiquitination, including the regulation of
osteoclastogenesis[30,
32].
We
speculated
that
TRAF6
might
affect
BCL3
polyubiquitination in RANKL signaling. To test this hypothesis, we immunoprecipitated endogenous BCL3 in untreated and RANKL-treated BMDMs and subsequently determined the ubiquitination status of BCL3. The results showed a decrease in the ubiquitination levels 12
ACCEPTED MANUSCRIPT of BCL3 in the cells treated with RANKL. The addition of RANKL caused significant deubiquitination of BCL3. In contrast, the deubiquitination of BCL3 in untreated cells was weak. Furthermore, the deubiquitination of BCL3 decreased after TRAF6 knockdown (Figure 4A).
PT
To further confirm this finding, we determined the subcellular localization of BCL3 and
RI
TRAF6 in BMDMs. Endogenous BCL3 exhibited a nuclear distribution and TRAF6 had a
SC
cytoplasmic distribution. After RANKL treatment, BCL3 was mainly distributed in cytoplasmic regions (Figure 4B). BCL3 translocation was assessed by western blot analysis
NU
using the cytosolic and nuclear extracts. Treatment with RANKL decreased the level of
MA
BCL3 in nuclear extracts and increased accumulation of BCL3 in the cytoplasm (Figure 4C). 3.5. BCL3 interaction with TRAF6 involves CYLD
D
BCL3 can be deubiquitinated by CYLD, an enzyme that removes the K63-linked
PT E
polyubiquitin chain, which results in the retention of BCL3 in the cytoplasm and thus its inactivation[33]. Prior studies have indicated that CYLD assembles on the TRAF6 complex
CE
and negatively regulates TRAF6 ubiquitination[34]. The strong interaction between TRAF6
AC
and BCL3 led us to examine if CYLD was involved in the TRAF6-BCL3 interaction. After being cultured, BMDMs were lysed and immunoprecipitated with anti-TRAF6, anti-BCL3, or anti-CYLD. The immunoprecipitates were eluted and immuno-blotted (Figure 5A-C). In order to elucidate the underlying mechanism involved in the deubiquitination of BCL3, we first determined the type of polyubiquitin chain present on BCL3 in BMDMs. We performed ubiquitination assays using specific K48 and K63 point mutants of HA-tagged ubiquitin (K48R and K63R). 3Flag-tagged BCL3 and ubiquitin mutants were overexpressed 13
ACCEPTED MANUSCRIPT in BMDMs. The enhancement of polyubiquitination was more significant in the K48R mutant. The findings showed that the K63 polyubiquitin chain is removed during the deubiquitination of BCL3 in the presence of RANKL (Figure 5D). In BMDMs with stable knock down of CYLD, the K63 polyubiquitination of BCL3 was markedly enhanced (Figure
PT
5D). These findings demonstrated that CYLD catalyzes the disassembly of K63-linked
RI
polyubiquitin chains on BCL3. We also observed the cytoplasmic distribution of CYLD via
SC
confocal microscopy. After treatment with RANKL, BCL3 began to translocate from the nucleus to the cytoplasm (Figure 5E).
NU
3.6. RANKL regulates cyclin D1 expression through BCL3 and NF-κB
MA
The cell cycle is driven by heterodimeric kinases composed of cyclins. Cell cycle exit in osteoclast precursors is important for their differentiation into osteoclasts[35]. Since BCL3 is
D
able to act as a co-activator with p52 homo-dimers to directly activate the cyclin D1
PT E
promoter[33], we investigated the levels of cyclin D1 in BMDMs following RANKL induction. Both the mRNA and protein expression levels of cyclin D1 decreased after
CE
treatment with RANKL (Figure 6A, B). The dual-luciferase assay showed significantly
AC
reduced activity of the cyclin D1 promoter after RANKL treatment (Figure 6C). Under RANKL stimulation, dual-luciferase assay indicated the increased and decreased promoter activity of cyclin D1 in BMDMs stably overexpressing BCL3 or with knock down of BCL3, respectively (Figure 6C). Furthermore, the ChIP assay revealed that the cyclin D1 promoter regions had decreased enrichment of p52 after RANKL stimulation (Figure 6D. P < 0.05). These effects were partially abolished by the overexpression of BCL3, whereas the depletion of BCL3 significantly reduced RANKL-induced cyclin D1 promoter inactivation (Figure 6D. 14
ACCEPTED MANUSCRIPT P < 0.05, respectively). Since BCL3 was involved in cell cycle control, we investigated the effects of BCL3 in BMDMs proliferation treated with RANKL. Stable transfection of BCL3 or sh-BCL3 increased or decreased the proliferation of BMDMs respectively (Figure 6E). Additionally, the data showed BCL3 increased numbers of TRAP-positive mononuclear cells
PT
under RANKL stimulation (Supplementary Figure S1A). The difference between
RI
TRAP-positive small (<3 nuclei) and larger (>3 nuclei) cells was statistically significant
SC
(Supplementary Figure S1B). Based on these data, we concluded that RANKL suppressed the
NU
activation of the cyclin D1 promoter through NF-κB signals that were antagonized by BCL3.
MA
4. Discussion
In this study, we identified a new protein, encoded by the oncogene BCL3, to be involved in
D
RANKL-induced osteoclastogenesis. To our knowledge, our study is the first to report the
PT E
interaction between BCL3 and TRAF6. Once TRAF6 activity was enhanced by RANKL stimulation, CYLD was assembled onto the TRAF6 complex. The K63-linked polyubiquitin
CE
chain of BCL3 was then removed by CYLD and the translocation of BCL3 to the nucleus
AC
decreased, where its target gene cyclin D1 is under the control of NF-κB. We showed that the enhancement of TRAF6 regulated novel, non-canonical NF-κB signaling via the atypical I-κB inhibitor BCL3 in the RANKL signaling pathway and resulted in OC differentiation and maturation (Figure 7). The NF-κB activation pathways are broadly classified as canonical and non-canonical pathways. The ubiquitin-proteasome pathway plays a crucial role in both pathways of NF-κB activation.
Phosphorylation
of
I-κB
proteins
or
I-κB-like
domains
results
in 15
ACCEPTED MANUSCRIPT phosphorylation-induced polyubiquitination via Lys48 of ubiquitins. This polyubiquitination is a signal for the degradation of the I-κB inhibitor, or the processing of p100 and p105, by the proteasome[36, 37]. It is known that the p50 and p52 subunits of NF-κB, derived from the larger precursors p105 and p100, lack DNA trans-activating domains[33, 38, 39]. However,
PT
in a non-canonical pathway, transcriptional activity can be acquired by engaging the partner
RI
protein BCL3, an atypical member of the I-κB family[40]. BCL3 is known to associate with
SC
nuclear p50 or p52 homo-dimers and can function as a transcriptional co-activator[41-43]. In BMDMs, we found that BCL3 inhibited the RANKL-induced transcriptional activity of
MA
generate p52 and its nuclear translocation.
NU
NF-κB. Furthermore, we conclusively showed that increased BCL3 levels contributed to
BCL3 itself is critically regulated via post-translational modifications, especially via
D
phosphorylation and ubiquitination. Polyubiquitin chains that are linked through K48 of
PT E
ubiquitin target proteins are sent to the 26S proteasome for degradation, while chains linked through K63 usually result in non-proteolytic outcomes, such as serving as docking sites for
CE
other proteins[44]. The proteasomal degradation of BCL3 in the cytoplasm is regulated by an
AC
E3-ligase complex containing TBLR1[45]. TRAF6 is activated upon interaction with the ubiquitin-conjugating E2 enzyme Ubc13, which stimulates the formation of the signal-promoting K63-linked polyubiquitination[46]. Lys-63-polyubiquitinated TRAF6 then mediates downstream signaling activations. Consequently, we originally hypothesized that K63 polyubiquitin chains can be added to BCL3 by TRAF6, but our experiments produced opposite results. Our data showed that the polyubiquitination of BCL3 decreased under the stimulation of RANKL, as well as the over-expression of TRAF6. We further discovered that 16
ACCEPTED MANUSCRIPT TRAF6 facilitated the K63 deubiquitination of BCL3 in RANKL-induced BMDMs and this is mediated by CYLD. These findings were consistent with those of previous studies[33, 34]. RANKL stimulation also induced the activation of endogenous CYLD in BMDMs, suggesting that CYLD and BCL3 are involved in the RANKL signaling pathway in
PT
osteoclasts. Taken together, these results suggest a model in which RANKL stimulation
RI
facilitates the formation of a TRAF6-CYLD-BCL3 complex, leading to the activation of a
SC
novel non-canonical NF-κB signaling pathway in osteoclastogenesis induced by RANKL. In RANKL-induced osteoclastogenesis, we found that the BCL3-deubiquitination induces the
NU
BMDMs to develop into OCs with significantly larger and more numerous nuclei than those
MA
of the control group.
The BCL3 has been associated with the capacity to increase cell proliferation by
D
activating the cyclin D1 promoter, and an anti-apoptotic role by mediating the inhibition of
PT E
p53 activity[47, 48]. The regulatory role of BCL3 was investigated by detecting cyclin D1, a target gene of the p52 and BCL3 complex. Luciferase reporter gene assays and western blot
CE
analyses showed that treatment with RANKL reduced cyclin D1 activation and expression,
AC
which could be partly rescued by the overexpression of BCL3. Cyclin D1 is a specific downstream gene that plays a key role in regulating proliferation. Cell proliferation and differentiation are coordinated processes in the development of specialized cells. Previous research showed co-expression of cyclin D1 and Cdk4 in suppressed osteoclast formation, and that cell cycle arrest in osteoclast precursors is a prerequisite step for their differentiation into osteoclasts[35]. BCL3 also regulates TLR-mediated macrophage responses[43]. In conclusion, in this model, TRAF6 interacts with BCL3, and CYLD is an adapter that 17
ACCEPTED MANUSCRIPT links BCL3 and TRAF6. We provided evidence that CYLD is assembled to TRAF6 after RANKL stimulation. CYLD then removes the K63-linked polyubiquitin chain of BCL3 and the deubiquitinated BCL3 is transported out of the nucleus, leading to the transcriptional downregulation of the BCL3-dependent gene, cyclin D1. Finally, the resultant cell cycle
PT
arrest promotes precursors to differentiate into osteoclasts in response to bone
RI
resorption-inducing stimuli. This strongly suggests that the novel non-canonical NF-κB
SC
signaling pathway via BCL3 also plays a general role in osteoclastogenesis. Further studies will elucidate the role of TRAF6 in cycle-arrested quiescent osteoclast precursors. Since
NU
abnormal osteoclastogenesis has been reported in many metabolic bone diseases such as
MA
rheumatoid arthritis, osteoporosis, and Paget’s disease, our study on the role of BCL3
PT E
Acknowledgements
D
provides valuable insights into bone loss-associated diseases.
We thank Wen Zhou for help with Two-hybrid assays and Li Dan for his assistance in Co-IP
AC
CE
assays.
Funding source
This work was supported by the National Natural Science Foundation of China (grant no. 81072187, 81541056).
Competing interests No competing interests declared. 18
ACCEPTED MANUSCRIPT References [1] M. Asagiri, H. Takayanagi, The molecular understanding of osteoclast differentiation, Bone 40(2) (2007) 251-64. [2] A.M. Parfitt, Targeted and nontargeted bone remodeling: relationship to basic multicellular unit origination and progression, Bone 30(1) (2002) 5-7. [3] S.C. Manolagas, Birth and death of bone cells: basic regulatory mechanisms and implications for the pathogenesis and treatment of osteoporosis, Endocr Rev 21(2) (2000) 115-37. [4] B. Dankbar, M. Fennen, D. Brunert, S. Hayer, S. Frank, C. Wehmeyer, D. Beckmann, P. Paruzel, J. Bertrand, K.
PT
Redlich, C. Koers-Wunrau, A. Stratis, A. Korb-Pap, T. Pap, Myostatin is a direct regulator of osteoclast differentiation and its inhibition reduces inflammatory joint destruction in mice, Nat Med 21(9) (2015)
RI
1085-90.
[5] S. Rafiei, K. Tiedemann, S. Tabaries, P.M. Siegel, S.V. Komarova, Peroxiredoxin 4: a novel secreted mediator
SC
of cancer induced osteoclastogenesis, Cancer Lett 361(2) (2015) 262-70.
[6] J. Xiong, M. Onal, R.L. Jilka, R.S. Weinstein, S.C. Manolagas, C.A. O'Brien, Matrix-embedded cells control osteoclast formation, Nat Med 17(10) (2011) 1235-41.
NU
[7] L.B. Ivashkiv, Metabolic-epigenetic coupling in osteoclast differentiation, Nat Med 21(3) (2015) 212-3. [8] T. Nakashima, M. Hayashi, H. Takayanagi, New insights into osteoclastogenic signaling mechanisms, Trends In Endocrinology And Metabolism 23(11) (2012) 582-590.
MA
[9] L.E. Theill, W.J. Boyle, J.M. Penninger, RANK-L and RANK: T cells, bone loss, and mammalian evolution, Annu Rev Immunol 20 (2002) 795-823.
[10] C. Criscitiello, G. Viale, L. Gelao, A. Esposito, M. De Laurentiis, S. De Placido, M. Santangelo, A. Goldhirsch, G. Curigliano, Crosstalk between bone niche and immune system: Osteoimmunology signaling as a potential
D
target for cancer treatment, Cancer Treatment Reviews 41(2) (2015) 61-68. [11] H. Takayanagi, S. Kim, T. Taniguchi, Signaling crosstalk between RANKL and interferons in osteoclast
PT E
differentiation, Arthritis Research 4(Suppl 3) (2002) S227. [12] E. Tsuda, M. Goto, S. Mochizuki, K. Yano, F. Kobayashi, T. Morinaga, K. Higashio, Isolation of a novel cytokine from human fibroblasts that specifically inhibits osteoclastogenesis, Biochemical And Biophysical Research Communications 234(1) (1997) 137-142.
CE
[13] A.P. Trouvin, V. Goeb, Receptor activator of nuclear factor-kappaB ligand and osteoprotegerin: maintaining the balance to prevent bone loss, Clin Interv Aging 5 (2010) 345-54. [14] N. Kobayashi, Y. Kadono, A. Naito, K. Matsumoto, T. Yamamoto, S. Tanaka, J. Inoue, Segregation of
AC
TRAF6-mediated signaling pathways clarifies its role in osteoclastogenesis, EMBO J 20(6) (2001) 1271-80. [15] M.C. Walsh, Y. Choi, Biology of the TRANCE axis, Cytokine Growth Factor Rev 14(3-4) (2003) 251-63. [16] W.J. Boyle, W.S. Simonet, D.L. Lacey, Osteoclast differentiation and activation, Nature 423(6937) (2003) 337-42.
[17] G.R. Crabtree, E.N. Olson, NFAT signaling: choreographing the social lives of cells, Cell 109 Suppl (2002) S67-79. [18] B.G. Darnay, A. Besse, A.T. Poblenz, B. Lamothe, J.J. Jacoby, TRAFs in RANK signaling, Adv Exp Med Biol 597 (2007) 152-9. [19] M.A. Lomaga, W.C. Yeh, I. Sarosi, G.S. Duncan, C. Furlonger, A. Ho, S. Morony, C. Capparelli, G. Van, S. Kaufman, A. van der Heiden, A. Itie, A. Wakeham, W. Khoo, T. Sasaki, Z. Cao, J.M. Penninger, C.J. Paige, D.L. Lacey, C.R. Dunstan, W.J. Boyle, D.V. Goeddel, T.W. Mak, TRAF6 deficiency results in osteopetrosis and defective interleukin-1, CD40, and LPS signaling, Genes Dev 13(8) (1999) 1015-24. 19
ACCEPTED MANUSCRIPT [20] A. Naito, S. Azuma, S. Tanaka, T. Miyazaki, S. Takaki, K. Takatsu, K. Nakao, K. Nakamura, M. Katsuki, T. Yamamoto, J. Inoue, Severe osteopetrosis, defective interleukin-1 signalling and lymph node organogenesis in TRAF6-deficient mice, Genes Cells 4(6) (1999) 353-62. [21] L. Deng, C. Wang, E. Spencer, L. Yang, A. Braun, J. You, C. Slaughter, C. Pickart, Z.J. Chen, Activation of the IkappaB kinase complex by TRAF6 requires a dimeric ubiquitin-conjugating enzyme complex and a unique polyubiquitin chain, Cell 103(2) (2000) 351-61. [22] C. Wang, L. Deng, M. Hong, G.R. Akkaraju, J. Inoue, Z.J.J. Chen, TAK1 is a ubiquitin-dependent kinase of MKK and IKK, Nature 412(6844) (2001) 346-351. [23] G. Takaesu, S. Kishida, A. Hiyama, K. Yamaguchi, H. Shibuya, K. Irie, J. Ninomiya-Tsuji, K. Matsumoto, TAB2,
PT
a novel adaptor protein, mediates activation of TAK1 MAPKKK by linking TAK1 to TRAF6 in the IL-1 signal transduction pathway, Mol Cell 5(4) (2000) 649-58.
RI
[24] A. Kanayama, R.B. Seth, L. Sun, C.K. Ea, M. Hong, A. Shaito, Y.H. Chiu, L. Deng, Z.J. Chen, TAB2 and TAB3 activate the NF-kappaB pathway through binding to polyubiquitin chains, Mol Cell 15(4) (2004) 535-48.
SC
[25] M. Landstrom, The TAK1-TRAF6 signalling pathway, Int J Biochem Cell Biol 42(5) (2010) 585-9. [26] J. Mizukami, G. Takaesu, H. Akatsuka, H. Sakurai, J. Ninomiya-Tsuji, K. Matsumoto, N. Sakurai, Receptor Activator of NF- B Ligand (RANKL) Activates TAK1 Mitogen-Activated Protein Kinase Kinase Kinase through a
NU
Signaling Complex Containing RANK, TAB2, and TRAF6, Molecular and Cellular Biology 22(4) (2002) 992-1000. [27] S.M. Jung, J.H. Lee, J. Park, Y.S. Oh, S.K. Lee, J.S. Park, Y.S. Lee, J.H. Kim, J.Y. Lee, Y.S. Bae, S.H. Koo, S.J. Kim, S.H. Park, Smad6 inhibits non-canonical TGF-beta1 signalling by recruiting the deubiquitinase A20 to TRAF6,
MA
Nat Commun 4 (2013) 2562.
[28] Y. Wang, B. Viollet, R. Terkeltaub, R. Liu-Bryan, AMP-activated protein kinase suppresses urate crystal-induced inflammation and transduces colchicine effects in macrophages, Ann Rheum Dis 75(1) (2016) 286-94.
D
[29] K. Wang, Y. Song, W. Liu, X. Wu, Y. Zhang, S. Li, L. Kang, J. Tu, K. Zhao, W. Hua, C. Yang, The noncoding RNA linc-ADAMTS5 cooperates with RREB1 to protect from intervertebral disc degeneration through inhibiting
PT E
ADAMTS5 expression, Clin Sci (Lond) 131(10) (2017) 965-979. [30] H. Zhang, C. Wu, L.E. Matesic, X. Li, Z. Wang, B.F. Boyce, L. Xing, Ubiquitin E3 Ligase Itch Negatively Regulates Osteoclast Formation by Promoting Deubiquitination of Tumor Necrosis Factor (TNF) Receptor-associated Factor 6, Journal of Biological Chemistry 288(31) (2013) 22359-22368.
CE
[31] T. Mukai, S. Ishida, R. Ishikawa, T. Yoshitaka, M. Kittaka, R. Gallant, Y.L. Lin, R. Rottapel, M. Brotto, E.J. Reichenberger, Y. Ueki, SH3BP2 cherubism mutation potentiates TNF-alpha-induced osteoclastogenesis via NFATc1 and TNF-alpha-mediated inflammatory bone loss, J Bone Miner Res 29(12) (2014) 2618-35.
AC
[32] Q. Yin, S.C. Lin, B. Lamothe, M. Lu, Y.C. Lo, G. Hura, L.X. Zheng, R.L. Rich, A.D. Campos, D.G. Myszka, M.J. Lenardo, B.G. Darnay, H. Wu, E2 interaction and dimerization in the crystal structure of TRAF6, Nature Structural & Molecular Biology 16(6) (2009) 658-U97. [33] R. Massoumi, K. Chmielarska, K. Hennecke, A. Pfeifer, R. Fassler, Cyld inhibits tumor cell proliferation by blocking Bcl-3-dependent NF-kappaB signaling, Cell 125(4) (2006) 665-77. [34] W. Jin, M. Chang, E.M. Paul, G. Babu, A.J. Lee, W. Reiley, A. Wright, M. Zhang, J. You, S.C. Sun, Deubiquitinating enzyme CYLD negatively regulates RANK signaling and osteoclastogenesis in mice, J Clin Invest 118(5) (2008) 1858-66. [35] T. Mizoguchi, A. Muto, N. Udagawa, A. Arai, T. Yamashita, A. Hosoya, T. Ninomiya, H. Nakamura, Y. Yamamoto, S. Kinugawa, M. Nakamura, Y. Nakamichi, Y. Kobayashi, S. Nagasawa, K. Oda, H. Tanaka, M. Tagaya, J.M. Penninger, M. Ito, N. Takahashi, Identification of cell cycle-arrested quiescent osteoclast precursors in vivo, J Cell Biol 184(4) (2009) 541-54. 20
ACCEPTED MANUSCRIPT [36] Z.J. Chen, Ubiquitin signalling in the NF-kappaB pathway, Nat Cell Biol 7(8) (2005) 758-65. [37] T.D. Gilmore, Introduction to NF-kappaB: players, pathways, perspectives, Oncogene 25(51) (2006) 6680-4. [38] C. Zheng, Q. Yin, H. Wu, Structural studies of NF-kappaB signaling, Cell Res 21(1) (2011) 183-95. [39] M.S. Hayden, S. Ghosh, NF-kappaB, the first quarter-century: remarkable progress and outstanding questions, Genes Dev 26(3) (2012) 203-34. [40] S.C. Chaudhary, X. Tang, A. Arumugam, C. Li, R.K. Srivastava, Z. Weng, J. Xu, X. Zhang, A.L. Kim, K. McKay, C.A. Elmets, L. Kopelovich, D.R. Bickers, M. Athar, Shh and p50/Bcl3 signaling crosstalk drives pathogenesis of BCCs in Gorlin syndrome, Oncotarget 6(34) (2015) 36789-814. [41] G.P. Nolan, T. Fujita, K. Bhatia, C. Huppi, H.C. Liou, M.L. Scott, D. Baltimore, The bcl-3 proto-oncogene
PT
encodes a nuclear I kappa B-like molecule that preferentially interacts with NF-kappa B p50 and p52 in a phosphorylation-dependent manner, Molecular and Cellular Biology 13(6) (1993) 3557-3566.
RI
[42] N. Watanabe, T. Iwamura, T. Shinoda, T. Fujita, Regulation of NFKB1 proteins by the candidate oncoprotein BCL-3: generation of NF-kappaB homodimers from the cytoplasmic pool of p50-p105 and nuclear translocation,
SC
EMBO J 16(12) (1997) 3609-20.
[43] D.L. Bundy, T.W. McKeithan, Diverse Effects of BCL3 Phosphorylation on Its Modulation of NF- B p52 Homodimer Binding to DNA, Journal of Biological Chemistry 272(52) (1997) 33132-33139.
NU
[44] S.M. Plafker, K.S. Plafker, A.M. Weissman, I.G. Macara, Ubiquitin charging of human class III ubiquitin-conjugating enzymes triggers their nuclear import, J Cell Biol 167(4) (2004) 649-59. [45] A. Keutgens, K. Shostak, P. Close, X. Zhang, B. Hennuy, M. Aussems, J.P. Chapelle, P. Viatour, A. Gothot, M.
MA
Fillet, A. Chariot, The repressing function of the oncoprotein BCL-3 requires CtBP, while its polyubiquitination and degradation involve the E3 ligase TBLR1, Mol Cell Biol 30(16) (2010) 4006-21. [46] H. Zhang, H. Hu, N. Greeley, J. Jin, A.J. Matthews, E. Ohashi, M.S. Caetano, H.S. Li, X. Wu, P.K. Mandal, J.S. McMurray, S.J. Moghaddam, S.C. Sun, S.S. Watowich, STAT3 restrains RANK- and TLR4-mediated signalling by
D
suppressing expression of the E2 ubiquitin-conjugating enzyme Ubc13, Nat Commun 5 (2014) 5798. [47] S.D. Westerheide, M.W. Mayo, V. Anest, J.L. Hanson, A.S. Baldwin, Jr., The putative oncoprotein Bcl-3
PT E
induces cyclin D1 to stimulate G(1) transition, Mol Cell Biol 21(24) (2001) 8428-36. [48] D. Kashatus, P. Cogswell, A.S. Baldwin, Expression of the Bcl-3 proto-oncogene suppresses p53 activation,
AC
CE
Genes Dev 20(2) (2006) 225-35.
21
ACCEPTED MANUSCRIPT Figure legends Figure 1. Interaction between BCL3 and TRAF6 (A) BCL3 binds specifically to GST-TRAF6 in a GST pull-down assay. (B)BCL3 was immuno-precipitated by TRAF6 and TRAF6 was immuno-precipitated by BCL3 after
PT
RANKL treatment. (C) The interaction between BCL3 and TRAF6 was detected after
RI
RANKL stimulation by immuno-blotting. (D-E) TRAF6 and BCL3 mutants were constructed
SC
and verified by immuno-blotting. (F) Full-length 3Flag-BCL3 and five His-TRAF6 mutants co-transfected 293T cells. Interaction was confirmed by immuno-blotting. (G) Full length
NU
His-TRAF6 and four 3Flag-BCL3 mutants co-transfected 293T cells. Interaction was
MA
confirmed by immuno-blotting.
D
Figure 2. BCL3 negatively regulates osteoclastogenesis
PT E
(A-B) In control group and BCL3 experimental group, BMDMs were cultured in M-CSF media either in the absence or presence of 100 ng/mL of RANKL for 7 days and then
CE
subjected to TRAP staining. (C-D) The levels of BCL3 and osteoclast osteoclastogenic
AC
markers Cathepsin K, Mmp9, TRAP, and NFATC1 were determined by Western blot and RT-qPCR，*P < 0.05 versus RANKL(-) . (E-F) The effect of BCL3 on RANKL-induced osteoclastic function is examined by bone resorption assay.
Figure 3. BCL3 affected RANKL-induced NF-κB signalling via p52 (A) BMDMs stably expressing BCL3 that were transfected with a NF-κB luciferase reporter construct were pre-treated with RANKL (100 ng/mL) and then treated with the NF-κB 22
ACCEPTED MANUSCRIPT inhibitor BAY11-7082. (B) BMDMs were stably transfected with BCL3 prior to RANKL (100 ng/mL) stimulation. The expression levels of p100, p52, and p65 in the cytoplasmic and the nuclear extracts were determined using western blot analysis. Subcellular fraction purity and the equality of sample loading were evaluated by analysing the levels of β-actin and
SC
RI
BCL3 in the cytoplasmic and the nuclear detected in BMDMs.
PT
Lamin B1. (C) Densitometric analysis shows the relative amount of p100, p52, p65 and
Figure 4. RANKL mediates BCL3 deubiquitination and prevents nuclear accumulation
NU
of BCL3
MA
(A) Endogenous ubiquitination of BCL3 was detected in the presence or absence of RANKL in BMDMs regardless of TRAF6 depletion. (B) Confocal plane of TRAF6 (green), BCL3
D
(red), and DAPI (blue) in untreated and RANKL-treated BMDMs. (C)The expression of
CE
presence of RANKL.
PT E
BCL3 in cytosolic and nuclear extracts were investigated by Western blot in the absence or
AC
Figure 5. BCL3 interaction with TRAF6 involves CYLD (A) TRAF6 and BCL3 were immuno-precipitated by CYLD. (B) BCL3 and CYLD were immuno-precipitated by and TRAF6. (C) TRAF6 and CYLD were immuno-precipitated by BCL3. (D) BMDMs were transfected with K48R or K63R HA-tagged ubiquitin and 3Flag-tagged BCL3 before or after transfection with CYLD shRNA. BCL3 was immuno-precipitated and ubiquitination was detected in the presence or absence of RANKL. (E) BCL3 (red) and CYLD (green) localization in the absence or presence of RANKL (100 23
ACCEPTED MANUSCRIPT ng/mL) was detected by confocal microscopy.
Figure 6. RANKL regulates cyclin D1 expression through BCL3 and NF-κB (A-B) Western blot and RT-qPCR assays shows the expression of cyclin D1 in BMDMs
PT
pre-treated with varying concentrations of RANKL, *P < 0.05 versus 0 ng/ml. (C) Activation
RI
of the cyclin D1 promoter luciferase reporter in BMDMs co-transfected with control or BCL3
SC
vector and control or BCL3-specific shRNA (100 nmol/L) in the absence or presence of RANKL (100 ng/mL). (D) ChIP assay and RT-qPCR shows the binding of cyclin D1
NU
promoter in BMDMs stably transfected with control or BCL3 vector and control or
MA
BCL3-specific shRNA (100 nmol/L) in the absence or presence of RANKL (100 ng/mL). (E) The proliferation of BMDMs transfected with BCL3 or sh-BCL3 were detected under
PT E
D
RANKL condition for 0, 2, 4, 6 days respectively.
Figure 7. Schematic a novel non-canonical NF-κB signalling in osteoclastogenesis.
CE
TRAF6 acts as a mediator to interact with BCL3 in involving CYLD. CYLD is assembled to
AC
TRAF6 after RANKL stimulation and removes the polyubiquitin chain from BCL3. The retention of deubiquitinated BCL3 in the cytoplasm leading to the transcriptional downregulation of the BCL3-dependent cyclin D1. Cell cycle arrest promptly promotes osteoclastogenic markers expression.
24
ACCEPTED MANUSCRIPT Table. 1 RT-PCR primer sequence Sequence（Forward）
Sequence（Reverse）
BCL3 CathK MMP-9 TRAP NFATC1 Cyclin D1 GAPDH
AACCTGCCTACACCCCTATAC GCAGAAGAACCGGGGTATTGA AGACCTGGGCAGATTCCAAAC AGGACGACTGTTCAGCACG CACCGCATCACAGGGAAGAC GCTGCGAAGTGGAAACCATC GGTGGACCTCATGGCCTACA
CACCACAGCAATATGGAGAGG GAAGGAGGTCAGGCTTGCAT CGGCAAGTCTTCCGAGTAGT CCGGGCAACAATGTCCAAAAG GCACAGTCAATGACGGCTC CCTCCTTCTGCACACATTTGAA CTCTCTTGCTCTCAGTATCCTTGCT
AC
CE
PT E
D
MA
NU
SC
RI
PT
Primer Name
25
ACCEPTED MANUSCRIPT
AC
CE
PT E
D
MA
NU
SC
RI
PT
Highlights： Osteoclasts play a crucial role in understanding of the skeletal system in health as well as disease. BCL3 arrest cell cycle in osteoclast precursors that is a prerequisite step for their differentiation into osteoclasts via its’ deubiquitination. TRAF6 mediate a novel non-canonical NF-κB signalling via BCL3 to play a general role in RANKL-induced osteoclastogenesis.
26
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8