Beclin 1-mediated macroautophagy involves regulation of caspase-9 expression in cervical cancer HeLa cells

Gynecologic Oncology 107 (2007) 107 – 113 www.elsevier.com/locate/ygyno

Beclin 1-mediated macroautophagy involves regulation of caspase-9 expression in cervical cancer HeLa cells Zan-hong Wang a,b,1 , Li Xu c,1 , Zhen-ling Duan a , Li-qin Zeng a , Nai-hong Yan d , Zhi-lan Peng a,⁎ a

c

Department of Obstetrics and Gynecoligy, West China Second Hospital, Sichuan University, Chendu, Sichuan, 610041, China b Department of Gynecology, The First Hospital, Shanxi Medical University, 610041, China Laboratory of Molecular Oncology, State Key Laboratory of Biotherapy, West China Hospital, West China Medical School, Sichuan University, Chengdu, Sichuan, 610041, China d Department of Ophthalmology, West China Hospital, Sichuan University, Chengdu, 610041, China Received 19 March 2007 Available online 6 July 2007

Abstract Objective. To investigate the role of Beclin 1 in HeLa cells and to obtain further insight into the relationship between autophagy and apoptosis. Methods. Beclin 1 silencing was achieved using RNA interference. The expression of gene was measured using quantitative real time RT-PCR and Western blotting. The percentage of apoptotic cells and cell cycle analysis and cell proliferation were assessed by flow cytometry and MTT assay. The ultrastructural analysis was under the electron microscope. Results. In pSUPER-Bec transfectants (Beclin 1 gene partially silenced) the expression of mRNA and protein of Beclin 1 were significantly suppressed in comparison to pSUPER-non (scramble RNA control) or untreated cells in HeLa cells. The growth of transfected cells was promoted, and less apoptosis cells were identified in pSUPER-Bec transfectants compared with pSUPER-non transfectants. Meanwhile pcDNA3.1-Bec transfectants (Beclin 1 gene overexpressed) showed reduction of cell proliferation but augmentation of cell programmed death compared with vector vehicle. The autophagy-promoting activity of beclin 1 in HeLa cells is associated with inhibition of HeLa cellular proliferation, in vivo tumorigenesis in nude mice. The expression pattern of caspase-9 was extraordinarily similar to that of Beclin 1in siRNA against Beclin 1 transfectants and constructive expression of Beclin 1transfectants. Conclusion. siRNA against Beclin 1 transfectants promoted the cell proliferation but overexpression of Beclin 1 promoted the autophagy cell death, and in the process of autophagy triggered by Beclin 1 expression followed accordingly the regulation of the expression of caspase-9. We conjecture that the autophagy gene Beclin 1 may be the critical molecular switch that plays an important role in fine tuning the autophagy and apoptosis through caspase-9, and defection of autophagy or apoptosis may be an important mechanism in tumorigenesis. © 2007 Elsevier Inc. All rights reserved. Keywords: Autophagy; Apoptosis; Beclin 1; Caspase-9; HeLa cells

Introduction Programmed cell death (PCD) is an essential and highly orchestrated process that plays a major role in morphogenesis and tissue homeostasis during development. Two major types of PCD have been distinguished: the caspase-mediated process of apoptosis (type 1 cell death) and the caspase-independent process involving autophagy (type 2 cell death) [1,2]. The ⁎ Corresponding author. E-mail address: [email protected] (Z. Peng). 1 Co-first authors. 0090-8258/$ - see front matter © 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.ygyno.2007.05.034

recent progress made in characterization of the molecular mechanism controlling autophagy has brought a renewal of interest for the difference between autophagy and apoptosis (reviewed in Ref. [3]). In classical apoptosis, or type I programmed cell death, there is early collapse of cytoskeletal elements but preservation of organelles until late in the process. In contrast, in autophagic, or type II, programmed cell death, there is early degradation of organelles but preservation of cytoskeletal elements until late stages. The discovery of a family of genes conserved from yeast to humans, and involved in the formation of autophagosomes, has unraveled new protein-conjugation systems and has shed light on the im-

108

Z. Wang et al. / Gynecologic Oncology 107 (2007) 107–113

portance of autophagy in physiology and pathophysiology. The elucidation of the molecular control of autophagy will also lead to a better understanding of the role of autophagy during cell death. Autophagy is a highly regulated process of degradation and recycling of cellular constituents, participating in organelle turnover and in the bioenergetic management of starvation [2]. It permits cells to survive during starvation, to undergo structural remodeling during differentiation, and may be important, together with apoptosis, for tumor suppression [4,5]. Several molecular links between apoptosis and autophagy have been suggested in various cellular models, including: ASP (apoptosis-specific protein), Beclin 1, Ca2+/ calmodulin-regulated death kinases DAPk and DRP-1, PTEN, steroid-inducible gene E93, signaling molecules Akt/PKB and mTOR, and Bcl-2 family proteins [6,7]. Although apoptosis and autophagy are often activated together in response to stress, the molecular mechanisms underlying their interplay remain unclear. Beclin 1 was originally discovered during the course of a yeast two-hybrid screen of a mouse brain cDNA library using human Bcl-2 as the bait [8]. The human beclin1 gene has been mapped to a region of chromosome 17q21 that is monoallelically deleted in many breast, ovarian and prostate cancer [9]. Expression of Beclin in MCF7 mammary carcinoma cells increases their autophagic response to nutrient deprivation [10]. Suppression of Beclin expression in mammalian cells impairs autophagy and sensitizes the cells to starvation-induced apoptosis [11]. One mechanism whereby Beclin 1 haploinsufficiency can promote cancer is impaired autophagy, and increased cell proliferation [10]. However, it is not yet clear how Beclin1modulates cell death in cancer cells. In addition to its specific role in adaptation to nutrient deprivation, accumulating evidence suggests that Beclin 1 might play a more general role in cell survival during embryonic development [12–14]. Caspases play a central role in apoptosis, a well-studied pathway of programmed cell death. Other programs of death potentially involving necrosis and autophagy may exist, but their relation to apoptosis and mechanisms of regulation remains unclear. In some settings, autophagy and apoptosis seem to be interconnected positively or negatively, introducing the concept of ‘molecular switches’ between them. Clinical therapies involving caspase inhibitors may arrest apoptosis but also have the unanticipated effect of promoting autophagic cell death. Thus, biochemical hallmarks of type 1 cell death may be involved in the execution of morphological type 2 cell death, pointing to a major cross talk between the two lethal subroutines. Our previous study suggested that the protein level of Beclin 1 was lower in cervical cancer tissue than that in normal tissue [15]. To obtain a further understanding of the molecular genetics of interaction between autophagy and apoptosis, the present study was undertaken to explore whether Beclin 1 induced autophagy and altered expression of apoptosis-related gene caspase-9. To address this issue, we partially silenced and overexpressed Beclin 1 in HeLa cells to determine if it could revert the tumorigenic phenotype of these cells.

Methods siRNA plasmid construction siRNA plasmid vectors were constructed as previously described. Pairs of annealed DNA oligonucleotides were inserted between the BglII and HindIII restriction site of the pSUPER vector (purchased from oligoengine company) in order to express short hairpin small interfering RNA (siRNA) under the control of the polymerase-III H1-RNA promoter. A 19-nucleotide target sequence derived from human Beclin 1 mRNA (accession NM 003766, 1206–1224 bp) was designed by siRNA Wizard™ software of Invivogen corporation. A set of 64nt oligos containing this sequence are described below: Beclin sense oligo, 5′-GATCCCCGATTGAAGACACAGGAGGCTTCAAGAGAGCCTCCTGTGTCTT CAATCTTTTTGGAAA-3′, antisense oligo,5′-AGCTTTTCCAAAAAGATTGAAGACACAGGAGGCT CTCTTGAAGCCTCCTGTGTCTTCAATCGGG3′. A scrambled sequence control siRNA was also designed: sense oligo, 5′GATCCCCCGCCGAGCAGAAATAGAACTTCAAGAGAGTTCTATTTCTGC TCGGCGTTTTTGGAAA-3′, antisense oligo, 5′-AGCTTTTCCAAAAACGCCGAGCAGAAATAGAA CTCTCTTGAAGTTCTATTTCTGCTCGGCGGGG3′. The target sequences of the Beclin siRNA and scrambled Beclin control siRNA were BLAST searched against the GenBank database. The Beclin targeting sequence matched exactly with partial sequences of the human Beclin 1 gene, but not with any other genes. The scrambled control did not match any known human genes. The constructions were named as pSUPER-Bec and pSUPER-non. The test primers were as follows: pSUPERF 5′-GCGTGAATTCGAACGCTGAC-3′, pSUPERR 5′-ACGCTTACAATTTACGCGTAAGC-3′.

Cell line and transfection HeLa cells were cultured in DMEM medium that contained 10% fetal bovine serum (Gibco, Grand Island, NY), penicillin (10 U/mL; Sigma, St. Louis, MO), and streptomycin (0.1 mg/ml; Sigma, St. Louis, MO). These cells were seeded into 6 cm petri dishes (5 × 105cells per well) and stably transfected at 80% confluence with either pSUPER-Bec or pSUPER-non using lipofectamine 2000 reagent as described by the manufacturer. After 2 days, the cells were transferred to media containing 500 ug/ml G418 (Gibco, Grand Island, NY). The surviving cells were grown under continuous selection with using G418. Two weeks later, the surviving clones were analyzed by quantitative real time RT-PCR and Western blot analysis to detect the expression of Beclin 1. Several clones that were created by transfection in a similar fashion with the empty vector (pcDNA3.1) and pcDNA3.1-Bec and the parental HeLa cells were used as controls.

RNA extraction and real-time RT-PCR RNA isolation and real-time PCR were performed as previously described [16]. Briefly, total cellular RNA was extracted using an acid guanidinium– phenol–chlorogorm method (trizol, Invitrogen). RNA integrity was confirmed by electrophoresis on ethidium bromide-stained 1% agarose gel. Total cellular RNA, 1 ug, was reverse transcribed at 37 °C for 70 min in 20 uL containing 2.5U reverse transcriptase (Fermentas Inc. Unit A, Hanover, MD, USA), 10 mM dithiothreitol, 1 mM each of deoxyadenosne triphosphate (dATP), deoxythymidine triphosphate (dTTP), deoxycytidine triphosphate (dCTP), dexoguanidine triphosphate (dGTP), and 5 ug/ml oligodT primer(Fermentas Inc.). Reactions were stopped by heat inactivation for 10 min at 85 °C. Primers were synthesized and HPLC purified (Takara, Dalian, China). Primer sequences used for amplification were as fellows: Beclin 1 upstream primer, 5′-AGGAACTCACAGCTCCATTAC-3′, downstream primer, 5′-AATGGCTCCTCTCCTGAGTT-3′, caspase-9 upstream primer, 5′-AGGAACTCACAGCTCCATTAC3′, downstream primer, 5′-CAGCATTAGCGACCCTAAGCA-3′. GAPDH upstream primer, 5′-TGGGTGTGAACCACGAGAA-3′, downstream primer, 5′–GGCATGGACTGTGGTCATGA-3′. Real-time PCR was done using poly A+-mRNA-based cDNAs extracted from transfection cells. For the quantitative determination of Beclin, caspase-9 and GAPDH, a PCR mixture containing SYBR-green was used. PCR reactions in a final volume of 25 μl, containing primers targeting a sequence were initiated with a 10 min denaturation at 94 °C. The cycling protocol consisted of denaturation at 94 °C for 20 s, annealing at

Z. Wang et al. / Gynecologic Oncology 107 (2007) 107–113 54 °C for 30 s and extension at 72 °C for 40 s repeated for up to 45 cycles. Realtime PCR amplification products were checked in DNA agarose gels to verify correct, single bands. Negative controls with no templates were carried out concurrently. The expression of GAPDH was used for comparison studies. All the samples were measured in triplicate. Fluorescence was measured at the end of each cycle and after 40 cycles of reaction; a profile of fluorescence vs. cycle number was obtained. An arbitrary threshold of fluorescence was set within the exponential phase of amplification (reference normalized = 0.1). The cycle at which the amplification of the product exceeded this threshold was determined and designated cycle threshold (Ct). The Ct for the gene of interest ranged from 20 to 31 depending on the gene amplified, whereas the Ct for GAPDH was between 14 and 16 cycles. The expression of each gene within each sample was normalized against GAPDH and expressed relative to a calibrator sample using the formula 2−ΔΔCT, as described elsewhere (K. Livak, PE-ABI, Sequence Detector User Bulletin 2). Ct can be defined as follows: [Ctgene of interest (unknown sample) − CtGAPDH (unknown sample)] / [Ctgene of interest (calibrator sample) − CtGAPDH (calibrator sample)]. The calibrator sample was designated to be the most highly expressed time point for each gene of interest and, therefore, has an expression of 1. In view of this, all other data are expressed as the fold expression of this value. Before it was used as an internal control, expression of GAPDH was verified to be constant across all sampling times. To choose and decide the calibrator sample, preliminary experiments were performed to ensure that amplification efficiencies for the target genes and GAPDH were equivalent (see PE-ABI, Sequence Detector User Bulletin 2).

Western blot analysis of Beclin 1 and caspase-9 Attached HeLa cells were washed twice with PBS, harvested in PBS, and pelleted by centrifugation. The pellet was weighed and suspended in 2× Laemmli buffer. Fifty micrograms of protein was loaded on a 15% sodium dodecyl sulfate–polyacrylamide gel and transferred to nitrocellulose. After blocking, membranes were incubated for 1 h with either the anti-Beclin 1 antibody (Santa Cruz Biotechnology, Santa Cruz, CA), or an anti-caspase-9 antibody (NeoMarkers, CA), followed by a horseradish peroxidase-conjugated anti-rabbit IgG antibody (Immunotech, Beckman Coulter). Specific bands were detected by an enhanced chemiluminescence system (Pierce, Rockford, IL). Anti-actin was used to ensure equal loadings.

Assessment of cell cycle and apoptosis by flow cytometry Pooled, free and adherent HeLa cells were centrifuged, washed with PBS and fixed with cold 70% ethanol. The pellet was resuspended in 100 μL RNAse A (180 μg/mL) and incubated at room temperature for 30 min. Propidium iodide (Merck, Darmstadt, Germany; final concentration, 50 μg/mL) was added, and cells were incubated at room temperature in the dark for 15 min. The percentage of cells with different DNA content and cell apoptosis were quantified by flow cytometry. Propidium iodide was excited at 488 nm and fluorescence was analyzed at 630 nm.

Proliferation and cell viability assays HeLa cell clones were seeded in 96-well plates at a density of 5 × 103 cells per well, and cell proliferation was measured at serial time points (every 24 h for 5 days) using the MTT Cell Proliferation Kit (Boehringer Mannheim). At identical time points, triplicate wells were subjected to trypan blue staining to determine cell viability. Cell clones were plated in triplicate at a density of 5 × 104 cells per 35-mm well in semisolid medium (soft agar) as described and colonies were counted at 21 days.

Tumorigenicity assays To better understand the role of Beclin 1 on modulating cancer growth in vivo, we have studied the effects of expression of Beclin 1 on the development and growth of tumors derived from cultured human cervical cancer HeLa cells in the athymic nude mouse (SPF). 5-week-old female nude mice were injected subcutaneously with 5 × 106 HeLa tumor cells with different vectors including HeLa.control (untreated cells), HeLa.beclin1(beclin1overexpressed vector), and

109

HeLa. siRNA beclin1(beclin1 silenced vector) clones. Mice were monitored for the development of tumors and tumor size was measured in two dimensions [length (a) and width (b)]. Tumor volume was calculated according to V = ab. Mice were necropsied after 4 weeks, and mean tumor volumes were determined for the subgroup of mice with tumors present upon necropsy. All animal studies were performed in accordance with Institutional Animal Care and Use Committee guidelines.

Statistical evaluation The results were statistically evaluated by ANOVA and Tukey's multiple range tests using Prism version 2.0 software (GraphPad Software, San Diego, CA); p b 0.05 was regarded as significant and p b 0.01, as highly significant.

Results The identifying of the recombination of pSUPER-siRNA The result of sequencing the plasmid of pSUPER-siRNA was as follows: pSUPER-Bec GTAATCTTATAAGTTCTGTATGAGACCACAGATCCCCGATTGAAGA CACAGGAGGCTTC A A G A G A G C C T C C T G T G T C T T C A AT C T T T T T G GAAAAACTTACGGGTAAATTGTAAGCGTTAATAT, pSUPER-non GTAATCTTATAAGTTCTGTATG AGACCACAGATCCCCCGCCGAGCAGAAATAGAACTTCAAGAGAGTTCTATTTC TGCTCGGCGTTTTTGGAAACTTACGGGTAAATTGTAAGCGTTAATAT (the insert sequence was underlined), and the sequence was verified correct. Down-regulation of partial Beclin 1 silencing on expression of Beclin 1 We used RNA interference to partially silence the Beclin 1 gene in HeLa cells. The mRNA level was evaluated using real time RT-PCR as described in Methods. The Beclin 1 mRNA was significantly decreased by 93.80% (p b 0.05) and 11.25% (p N 0.05)compared with control (untreated cells) after transfection of the Beclin 1 siRNA plasmid and scrambled plasmid, respectively (Fig. 1A), and the results of Western blotting displayed that the levels of Beclin 1 protein in transfectants of Beclin 1 siRNA and scrambled RNA were decreased by 44% and 75%, respectively (Fig. 2). It showed that either the mRNA level or the protein level of Beclin 1 were significantly decreased in HeLa cells after being transfected with Beclin 1 siRNA plasmid. Effects of Beclin 1 siRNA on cell cycle and apoptosis The analysis of flow cytometry showed that in pSUPER-Bec transfectants the percentages of G1 and S were 44.3% and 51.6%, respectively (Fig. 3A). Nevertheless in control cells the percentages of G1 and S were 62.5% and 23%, respectively. The data indicated that the pSUPER-Bec transfected cells in G1 phase were significantly decreased (p b 0.01) but in S phase they were elevated, so the proliferation of cells was promoted. The result was consistent with the assay of MTT at different time intervals after transfection (Fig. 4). In the pSUPER-non transfected cells there was no significant change on cell cycle

110

Z. Wang et al. / Gynecologic Oncology 107 (2007) 107–113

Fig. 1. Beclin 1 and caspase-9 expression after transfection of HeLa cells with a Beclin siRNA (pSUPER-Bec) or a control siRNA (pSUPER-non) and constructive expression vector (pcDNA3-Bec) or vector control. # represents highly significant difference between experimental group and HeLa. Control group (p b 0.01). mRNA expression was measured using quantitative RT-PCR. Expression of this mRNA was quantitated as a ratio to the amount of GAPDH and shown as a percentage to untreated cell. Data represent mean ± S.D. of three independent experiments. Control is the untreated cells. (A) Beclin 1 mRNA expression in scramble RNA transfectants (pSUPER-non) and siRNA against Beclin 1 (Beclin 1-siRNA) transfectants. (B) Capase-9 mRNA expression in scramble RNA (pSUPER-non) transfectants and siRNA against Beclin 1 (Beclin-siRNA) transfectants. (C) Beclin 1 mRNA expression in constructive expression vector (pcDNA3-Bec) transfectants and vector transfectants. (D) Caspase-9 mRNA expression in constructive expression vector (pcDNA-Bee) transfectants and vector control transfectants.

and cell proliferation compared with control (data not shown). Meanwhile, an obviously decreased rate of apoptosis was observed in flow cytometry (FCM) assay in pSUPER-Bec transfectants compared with pSUPER-non transfectants or the untreated cells (Fig. 3B). Beclin 1 expression was up-regulated in overexpressed transfectants of HeLa cells In Beclin 1 siRNA transfectants the expressions of Beclin 1 in mRNA and protein level were suppressed, subsequently the cell proliferation was promoted and the rate of apoptosis was decreased. Then, in Beclin 1 expressed cells the results would be on the contrary. As expected, introduction of pCDNA3.1Bec (Beclin 1 overexpressed) resulted in higher expression of Beclin 1 mRNA and protein after transfection than in cells transfected with scramble RNA or untreated cells (Figs. 1C, 2). Cell proliferation was depressed and rate of apoptosis was increased in Beclin 1 overexpressed transfectants than control (Fig. 4).

Fig. 2. Expression of Beclin 1 protein in Beclin 1-siRNA transfectant and pCDNA3-Becl (Beclin 1 overexpressed) transfectant. Beclin 1 protein expression was analyzed using Western blotting. Cytoplasmic protein was extracted from scramble RNA transfectant, Beclin-siRNA transfectant, pCDNA3-Bec1 (Beclin 1 overexpressed) transfectant, pCDNA3 vector control transfectant and untreated cells.

The autophagy induced by Beclin 1 was testified by microscope Evaluation of autophagy was performed through analysis of Electron microscopy images. Ultrastructural analysis of the Beclin 1 transfected cells revealed typical morphological features of autophagy: autophagic double-membraned giant autophagolysosomes containing cytoplasmic fragments and preserved organelles like RER, mitochondria, dense bodies, lysosomes and ribosomes (Fig. 5A). The cells contain giant autophagosomes (feature of autophagy) distributed throughout the cytoplasm. Engulfed organelles in the autophagosome display degenerative alterations. In the intact control cells or partially silenced Beclin 1 transfected cells, the structure of organelle fragment bubbles was present in the cytoplasm and occasional autolysosomes were seen (Figs. 5B, C). Expression of caspase-9 was regulated by Beclin 1 To further investigate the role of Beclin 1 in autophagy and apoptosis, we detected the expression of caspase-9 which was known as the critical enzyme in apoptosis signaling. Interestingly, the pattern of caspase-9 expression was extraordinarily similar to the pattern of Beclin 1 in either siRNA against Beclin 1 or Beclin 1 overexpression transfectants of HeLa cells (Figs. 1B, D, 2). On the one hand, expression of caspase-9 was higher in Beclin 1 gene transfectants than in vector transfectants control. On the other hand, siRNA-mediated inhibition of Beclin 1 expression in HeLa cells resulted in significant inhibition of expression of caspase-9 compared with scramble RNA transfectants. Overexpression of Beclin 1 resulted in tumor regression in vivo pcDNA3-Bec (Beclin 1overexpressed) and pSUPER-Bec (siRNA against Beclin 1) transfected cancer cells were inoculated into 5-week-old female athymic nude mice. The

Z. Wang et al. / Gynecologic Oncology 107 (2007) 107–113

111

Fig. 3. Assessment of cell cycle and apoptosis by flow cytometry. The proliferation of cells was promoted and an obviously decreased rate of apoptosis was observed in pSUPER-Bec transfectants compared with pSUPER-non transfectants or the untreated cells. (A) The distribution of cell cycles in HeLa cells. (B) Flow cytometry of apoptosis assay a) siRNA against Beclin 1 (pSUPER-Bec) transfectants b) scramble RNA transfectants (p-SUPER-non) transfectants c) untreated cells.

mice with HeLa cell were as the positive control. Tumor growth did not occur in negative control mice (injected with sodium chloride). The tumor size of pSUPER-Bec transfected mice was bigger than that of positive control. While the tumor size of pcDNA3-Bec transfected mice was dramatically smaller than that of positive control. Therefore overexpression of Beclin 1 resulted in tumor regression in vivo (Fig. 6). Discussion Since the 1950s, the ultrastructural analysis has indicated that there is another type of cell death different from apoptosis, that is autophagy. Autophagy is characterized by autophagic vacuoles accumulating, no apoptosis body forming, and no chromosome condensing and caspase independence. In autophagic cell death, part of the cytoplasm or entire organelles are sequestered into double-membraned vesicles, called AV or

Fig. 4. The cell proliferation was measured using MTT assay. There was no difference among the untreated cells, pSUPER-non and pcDNA3.1 transfectants (p N 0.05). Inhibition of Beclin 1 expression (pSUPER-Bec1) promoted the cell proliferation (compared with pSUPER-non transfectant p = 0.012) while overexpression of Beclin 1 (pcDNA3.1-Beclin 1) reduced the cell proliferation (compared with pcDNA3.1 transfectant p = 0.015).

autophagosomes. Autophagosomes ultimately fuse with lysosomes, thereby generating single-membraned autophagolysosomes and degrading their content [17]. In apoptosis cathepsins are released from lysosomes into the cytoplasm and trigger a cascade of intracellular degradation [18–21]. Many studies demonstrated that autophagic capacity in cancer cells was lower than in their normal counterparts and raised the possibility that the breakdown of autophagy process contributes to the development of cancer [4]. Suppression of apoptosis also is thought to contribute to carcinogenesis [22]. There has been so many studies that investigated the relationship between autophagy and apoptosis and had obtained further insights about it. Takacs-Vellai et al.found that BEC-1 promote autophagy and prevents ectopic apoptosis, and their study indicated that the two processes seemed to be inversely related [23]. In contrast to their results, Furuya et al. instead observed that Beclin 1 over-expression aggravated cis-diamminedichloroplatinum (CDDP) or doxorubicin-induced apoptosis in a gastric cancer cell line, while Beclin 1 silencing had the opposite effects [24]. In the observation of Lamparska-Przybysz et al., microscopic analysis of cell culture performed 6 h after camptothecin (inhibitor of DNA topoisomerase I, shorted for CPT) administration revealed a number of cells with coexistence of apoptosis and autophagy. This manifested with typical morphological features of apoptosis (cell shrinkage, margination and condensation of chromatin) and autophagy (autophagosomes, autophagic vacuoles) in the same cell [25]. Boya et al. argued that biochemical hallmarks of type 1 cell death (apoptosis) may be involved in the execution of morphological type 2 cell death (autophagy), pointing to a major cross talk between the two lethal subroutines [11]. Beclin 1was thought to be the one of critical molecule between apoptosis and autophagy [14]. Beclin 1 is a 60 kDa protein that has been proposed to function as a tumor suppressor by promoting cellular macroautophagy [26]. To the function of Beclin 1, there are many

112

Z. Wang et al. / Gynecologic Oncology 107 (2007) 107–113

Fig. 5. The ultrastructural analysis was under electron microscope amplified 30,000 times. Promotion of autophagy by enforced beclin 1 expression in human HeLa cells. Electron micrographs of Beclin 1 transfected cells (A), control (B) and partially silenced Beclin 1 transfected cells (C). The Beclin 1 transfectant cells revealed typical morphological features of autophagy: autophagic double-membraned giant autophagolysosomes (arrow) containing cytoplasmic fragments and preserved organelles like: RER, mitochondria, dense bodies, lysosomes and ribosomes.

paradoxically views. In the foregoing indications Beclin 1functions to promote cell survival, there also is a growing body of evidence that Belin might, paradoxically, also function as a tumor suppressor under specific conditions. For example, augmentation of Beclin 1 expression in MCF7 cells decreases their proliferation, clonigenicity in sofe agar, and tumorgenicity in nude mice [10]. Heterozygous disruption of Beclin 1 in mice results in an increased frequency of spontaneous lymphomas, as well as lung and liver carcinomas [13,14]. The possibility that the tumor-suppressing effects of Beclin 1 might be related to a role in regulating autophagic cell death has been raised by recent studies. In the first, silencing Beclinexpression in L292 cells prevented autophagic death triggered by treatment of the cells with a caspase inhibitor [27]. In the second, interference with Beclin expression blocked non-apoptotic cell death induced by etopopside treatment of Bax/Bak−/− double-knockout mouse cells that are resistant to apoptosis [28]. To evaluate the function of Beclin 1 in autophagy signaling, we altered Beclin 1 expression in cervical cancer HeLa cells by introducing a Beclin 1expression vector or an siRNA targeted to Beclin 1 gene (Beclin 1-siRNA) vector. Our study demonstrated that siRNA against Beclin 1 transfectants dramatically decreased the rate of

Fig. 6. The size of tumor in mice injected with different treatments. Every group was repeated in five samples (n = 5). # represents highly significant difference between experimental group and HeLa. Control group (p b 0.01).

apoptosis but overexpression of Beclin 1 promoted autophagymediated cell death, and in the process of autophagy triggered by Beclin 1 expression followed the accordingly altered expression of caspase-9. Our finding also supported the hypothesis that Beclin 1 may be an important ‘molecular switch’ to adjust autophagy and apoptosis in mammalian cells. The study of Boya et al.showed that autophagy actually prevented the apoptotic default pathway to be activated [11]. Their finding may be incorporated into a more general hypothesis suggesting the existence of a double switch between the two principal lethal signaling pathways. On the one hand, inhibition of apoptosis can lead to a chronic degenerative autophagic cell death [29,30]. On the other hand, prevention of autophagy can precipitate death [11]. Our finding indicated that the lower expression level of Beclin 1 compared with untreated autophagic effectively suppressed autophagy signaling, and this was manifested by the genetic feature of cell proliferation and cell cycle arrest. The accordingly lower expression level of caspase-9 was apparently detected in the same transfectants and the reduction of apoptosis was also detected. It implied that Beclin 1 functioned as an autophagy gene and participated apoptosis signaling through caspase-9, and Beclin 1 may be the critical ‘molecular switch’ and play an important role to fine tune autophagy and apoptosis. Notably, the in vivo assay of injection constructive expression vector of Beclin 1 to the nude mice showed the significant inhibition of the solid tumor, therefore autophagy or apoptosis may be an important mechanism in tumorigenesis. Beclin 1was the first identified mammalian gene with a role in mediating autophagy [10]. More and more implications of tumor suppressors like Beclin 1, DAP-kinase and PTEN in autophagic pathways indicate a causative role for autophagy deficiencies in cancer formation. Our findings, which enforced expression of Beclin 1, not only promoted autophagy in human cervical carcinoma cells but also inhibited their tumor-forming potential, indicated that autophagy may be a fundamental mechanism for preventing the deregulated growth of tumor cells. The detailed mechanisms by which beclin 1 and autophagy contribute to tumor suppression and the potential of this pathway as a new target for cancer therapy are important issues that deserve a great deal of attention.

Z. Wang et al. / Gynecologic Oncology 107 (2007) 107–113

References [1] Guimaraes CA, Linden R. Programmed cell death. Apoptosis and alternative deathstyles. Eur J Biochem 2004;271:1638–50. [2] Levine B, Klionsky DJ. Development by selfdigestion: molecular mechanisms and biological functions of autophagy. Dev Cell 2004; 6:463–77. [3] Klionsky DJ, Emr SD. Autophagy as a regulated pathway of cellular degradation. Science 2000;290:1717. [4] Gozuacik D, Kimchi A. Autophagy as a cell death and tumor suppression mechanism. Oncogene 2004;23:2891–906. [5] Liang XH, Yu J, Brown K, Levine B. Beclin 1 contains a leucine-rich nuclear export signal that is required for its autophagy and tumor suppressor function. Cancer Res 2001;61:3443–9. [6] Ogier DE, Codogno P. Autophagy: a barrier or an adaptive response to cancer. Biochem Biophys Acta 2003;1603:113–28. [7] Gompel A, Somai S, Chaouat M, Kazem A, Kloosterboer HJ, Beusman I, et al. Hormonal regulation of apoptosis in breast cells and tissues. Steroids 2000;65:593–8. [8] Liang XH, Kleeman LK, Jiang HH, Gordon G, Goldman JE, Berry G, et al. Protection against fatal Sindbis virus encephalitis by beclin, a novel Bcl-2interacting protein. J Virol 1998;72:8586–96. [9] Aita VM, Liang XH, Murty VV, Pincus DL, Yu W, Cayanis E, et al. Cloning and genomic organization of beclin 1, a candidate tumor suppressor gene on chromosome 17q21. Genomics 1999;59:59–65. [10] Liang XH, Jackson S, Seaman M, Brown K, Kempkes B, Hibshoosh H, et al. Induction of autophagy and inhibition of tumorigenesis by beclin 1. Nature 1999;402:672–6. [11] Boya P, Gonzalez-Polo RA, Casares N, Perfettini JL, Dessen P, Larochette N, et al. Inhibition of macroautophagy triggers apoptosis. Mol Cell Biol 2005;25:1025–40. [12] Melendez A, Talloczy Z, Seaman M, Eskelinen EL, Hall DH, Levine B. Autophagy genes are essential for dauer development and life-span extension in C. elegans. Science 2003;301:1387–91. [13] Qu X, Yu J, Bhagat G, Furuya N, Hibshoosh H, Troxel A, et al. Promotion of tumorigenesis by heterozygous disruption of the beclin 1 autophagy gene. J Clin Invest 2003;112:1809–20. [14] Yue Z, Jin S, Yang C, Levine AJ, Heintz N. Beclin 1, an autophagy gene essential for early embryonic development, is a haploinsufficient tumor suppressor. Proc Natl Acad Sci U S A 2003;100:15077–82. [15] Wang ZH, Peng ZL, Duan ZL, Liu H. Expression and clinical significant of autophagy gene Beclin 1 in cervical squamous cell carcinoma. J Sichuan Univ Med Sci Edi 2006;37:860–3. [16] Bieche I, Onody P, Laurendeau I, Olivi M, Vidaud D, Lidereau R, et al.

[17] [18]

[19]

[20]

[21] [22] [23]

[24]

[25]

[26]

[27]

[28]

[29]

[30]

113

Real-time reverse transcription-PCR assay for future management of ERBB2-based clinical applications. Clin Chem 1999;45:1148–56. Yoshimori T. Autophagy: a regulated bulk degradation process inside cells. Biochem Biophys Res Commun 2004;313:453–8. Klionsky DJ, Gregg JM, Dunn JR, Emr SD, Sakai Y, Sandoval IV. A unified nomenclature for yeast autophagy-related genes. Dev Cell 2003; 5:539–45. Cirman T, Oresic K, Droga-Mazovec G, Turk V, Reed CJ, Myers RM, et al. Selective disruption of lysosomes in HeLa cells triggers apoptosis, mediated by cleavage of Bid by multiple papainlike lysosomal cathepsins. J Biol Chem 2004;279:3578–87. Zhao M, Antunes F, Eaton JW, Brunk UT. Lysosomal enzymes promote mitochondrial oxidant production, cytochrome c release and apoptosis. Eur J Biochem 2003;270:3778–86. Bursh W. The autophagosomal–lysosomal compartment in programmed cell death. Cell Death Differ 2001;8:569–81. Thompson CB. Apoptosis in the pathogenesis and treatment of disease. Science 1995;267:1456–62. Takacs-Vellai K, Vellai T, Puoti A, Passannante M, Wicky C, Streit A, et al. Inactivation of the autophagy gene bec-1 triggers apoptotic cell death in C. elegans. Curr Biol 2005;15:1513–7. Furuya D, Tsuji N, Yagihashi A, Watanabe N. Beclin 1 augmented cisdiamminedichloroplatinum induced apoptosis via enhancing caspase-9 activity. Exp Cell Res 2005;307:26–40. Lamparska-Przybysz M, Gajkowska B, Motyl T. Cathepsins and BID are involved in the molecular switch between apoptosis and autophagy in breast cancer MCF-7 cells exposed to camptothecin. J Phys Phama 2005;56:159–79. Xue HZ, Jean HO, William AM. Functional specificity of the mammalian Beclin–Vps34PI3–kinase complex in macroautophagy versus endocytosis and lysosomal enzyme trafficking. J Cell Sci 2006;119:259–70. Yu L, Alva A, Su H, Dutt P, Freundt E, Welsh S, et al. Regulation of an ATG7-beclin 1 program of autophagic cell death by caspase-8. Science 2004;304:1500–2. Shimizu S, Kanaseki T, Mizushima N, Mizuta T, Arakawa-Kobayashi S, Thompson CB, et al. Role of Bcl-2 family proteins in a nonapoptotic programmed cell death dependent on autophagy genes. Nat Cell Biol 2004;6:1221–8. Fletcher GC, Xue L, Passingham SK, Tolkovsky AM. Death commitment is advanced by axotomy in sympathetic neurons. J Cell Biol 2000; 150:741–54. Xue L, Fletcher GC, Tolkovsky AM. Mitochondria are selectively eliminated from eukaryotic cells after blockade of caspases during apoptosis. Curr Biol 2001;6:361–5.