Beetle immunity: Identification of immune-inducible genes from the model insect Tribolium castaneum

ARTICLE IN PRESS Developmental and Comparative Immunology (2008) 32, 585–595

Available at www.sciencedirect.com

journal homepage: www.elsevier.com/locate/devcompimm

Beetle immunity: Identification of immune-inducible genes from the model insect Tribolium castaneum$ Boran Altincicek, Eileen Knorr, Andreas Vilcinskas Interdisciplinary Research Center, Institute of Phytopathology and Applied Zoology, Justus-Liebig-University of Giessen, Heinrich-Buff-Ring 26-32, D-35392 Giessen, Germany Received 9 August 2007; received in revised form 10 September 2007; accepted 27 September 2007 Available online 16 October 2007

KEYWORDS Tribolium castaneum; Defensin; Thaumatin; Innate immunity; Stress response; Model organism

Abstract The red flour beetle, Tribolium castaneum, is an established genetically tractable model insect for evolutionary and developmental studies. Therefore, it may also represent a valuable model for comparative analysis of insect immunity. Here, we used the suppression subtractive hybridization method to identify Tribolium genes that are transcriptionally induced in response to injection of crude lipopolysaccharide (LPS). Determined genes encode proteins that share sequence similarities with counterparts from other insects known to mediate sensing of infection (e.g. Toll and PGRP) or to represent potential antimicrobial effectors (e.g. ferritin, c-type lysozyme, serine proteinase inhibitors, and defensins). Especially significant is the identification of thaumatin-like peptides, representing ancient antifungal peptides originally reported from plants, that are absent from the genomes of many other insects such as Drosophila, Anopheles, and Apis. We produced recombinant thaumatin-1 in bacteria and we found that it represents an antimicrobial peptide against filamentous fungi in Tribolium. Additionally, septic injury induces expression of genes involved in stress adaptation (e.g. heat-shock proteins) or insecticide resistance (e.g. cytochrome P450s) in Tribolium, suggesting that there may be crosstalk between the immune and stress responses. & 2007 Elsevier Ltd. All rights reserved.

Abbreviations: HIG, hypoxia-inducible gene 1; HIF, hypoxia-inducible factor 1 a; Hsp, heat-shock protein; LPS, lipopolysaccharide; PGRP, peptidoglycan recognition protein; RT-PCR, reverse transcriptase polymerase chain reaction; SSH, suppression subtractive hybridization. $ This is an accompanying paper to our contribution within the Tribolium genome-sequencing consortium that will publish the manuscript entitled ‘‘The first genome sequence of a beetle, Tribolium castaneum, a model for insect development and pest biology’’ in Nature soon. Corresponding author. Tel.: +49 641 99 37603; fax: +49 641 99 37609. E-mail address: [email protected] (B. Altincicek). 0145-305X/$ - see front matter & 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.dci.2007.09.005

ARTICLE IN PRESS 586

1. Introduction The red flour beetle Tribolium castaneum (Coleoptera, Tenebrionidae) represents an important model organism of insect development, evolution, comparative genomics, and pest science. Therefore, its complete genome sequence has now been determined by the Human Genome Sequencing Center, Baylor College of Medicine, USA [1]. Tribolium has previously been investigated on host–parasite interactions with a wide array of pathogenic bacteria, sporozoa, cestoda, nematoda, mites, and hymenopterous parasites [2]. In addition, Tribolium is amenable to systemic RNAimediated gene silencing and other genetic tools for functional gene analyses [3–9]. Consequently, it is an excellent model to study insect immunity. A bioinformatic analysis using the Tribolium genome sequence and known genes from other insects that are involved in cellular and humoral immune responses [10–13] is described elsewhere [1]. Complementarily, we present here the experimental identification of genes that are induced in response to septic injury in Tribolium using subtractive suppression hybridization (SSH). This PCR-based method selectively amplifies differentially expressed cDNAs and simultaneously suppresses amplification of common cDNAs. It has been proven as a suitable tool for identification of immune-inducible genes in the dipterans Anopheles gambiae [14] and Eristalis tenax [15], the lepidopterans Galleria mellonella [16] and Manduca sexta [17], the hemipteran Rhodnius prolixus [18], the apterygote insect Thermobia domestica [19], and other invertebrate and vertebrate species [20–26]. Among genes that are up-regulated in T. castaneum in response to septic injury, we identified transcripts sharing sequence similarities with many known insect genes. Besides predicted immunity-related genes including defensins and plant-like thaumatins, we also determined numerous immune-responsive transcripts encoding proteins potentially involved in detoxification and stress responses in Tribolium. Recombinant Tribolium thaumatin-1 was produced in Escherichia coli and after purification to apparent homogeneity it exhibited antifungal activities. In addition, transcriptional up-regulation of selected genes in response to either septic versus sterile injury or heat shock was confirmed and precisely determined by quantitative realtime reverse transcriptase polymerase chain reaction (RT-PCR) analysis. Finally, we performed a phylogenetic analysis of three identified Tribolium defensins along with known defensins from insects, plants, and a fungus.

2. Materials and methods 2.1. Immune challenge of T. castaneum and isolation of RNA T. castaneum strain San Bernardino beetles were reared on whole-grain flour with 5% yeast powder at 31 1C in darkness. Sterile or septic injury was performed by ventrolaterally wounding of the imagoes abdomen using a dissecting needle dipped in sterile saline or 10 mg/ml lipopolysaccharide (LPS) (purified E. coli endotoxin 0111:B4, Cat. No.: L2630, Sigma, Taufkirchen, Germany) solution. Eight hours post-immune

B. Altincicek et al. challenge animals were homogenized in liquid N2 and total RNA was extracted using the TriReagent isolation reagent (Molecular Research Centre, Cincinnati, OH, USA) according to the instructions of the manufacturer. RNA integrity was confirmed by ethidium bromide gel staining and quantities were determined spectrophotometrically. In order to induce heat-shock responses in Tribolium beetles, we incubated them 20 min at 42 1C followed by incubation for 16 h at 37 1C.

2.2. Construction of a subtracted cDNA library In order to identify genes that are differentially expressed in response to septic injury, we performed the SSH method using RNAs from 40 immune challenged and 40 untreated imagoes of T. castaneum, the SMART PCR cDNA Synthesis Kit (Clontech, Mountain View, CA, USA), and the PCR-Select cDNA Subtraction Kit (Clontech), according to the protocols of the manufacturer.

2.3. Colony PCR, blot hybridization, and DNA sequencing Colony PCR was performed on 288 randomly picked colonies with vector-specific primers T7-promotor: 50 -TAATACGACTCACTATAGGG-30 and SP6: 50 -ATTTAGGTGACACTATAG-30 (purchased from Thermo electron, Waltham, MA, USA) using a Biometra PCR cycler and the Red Taq PCR system (Sigma). Used PCR conditions were denaturation at 95 1C for 3 min followed by 30 cycles of denaturation at 95 1C for 15 s, annealing at 43 1C for 15 s, and extension at 72 1C for 60 s. One microliter of resulting PCR products were identically spotted onto two sheets of positively charged nylon membranes (Roche, Lewes, UK). Membranes were dried and UV cross-linked using a BioRad UV cross-linker (BioRad, Mu ¨nchen, Germany), according to the instructions of the manufacturer. Digoxigenin-labeled probes for hybridization were generated using secondary PCR products of subtracted and non-subtracted cDNAs and the Dig-High Prime Labelling Kit (Roche). Hybridization, washing, and detection of digoxigenin-labeled DNA was performed in accordance with the user guide instructions of the Dig Easy Hyb Granules, Dig-Wash and Block Buffer Set, Anti-Digoxigenin-AP and NBT/BCIP ready-to-use tablets (Roche).

2.4. Sequencing and computer analysis of cDNA sequence data Plasmid isolation of 135 positively screened colonies was performed with the FastPlasmid Mini Kit (Eppendorf, Hamburg, Germany) and purified plasmids were custom sequenced by Macrogen Inc. (Seoul, South Korea). Blast (http://www.hgsc.bcm.tmc.edu/) and Mega BLAST (http:// www.ncbi.nlm.nih.gov/BLAST/) were used to identify corresponding gene sequences in the Tribolium sequence database. InterProScan (http://www.ebi.ac.uk/InterProScan/) was used for an integrated search in PROSITE, Pfam, and PRINTS databases at EMBL-European Bioinformatics Institute and to predict signal sequences and transmembrane regions.

ARTICLE IN PRESS Identification of immune-inducible genes from the model insect T. castaneum

587

2.5. Expression and purification of recombinant Tribolium thaumatin-1

6 M guanidium hydrochloride (e280 ¼ 47.285 mM1 cm1).

Tribolium thaumatin-1 (excluding the predicted N-terminal signal sequence) was amplified by PCR with oligonucleotides Tcast-Thaumatin-for 50 -ATGGTGGAATTTCAAATCCTCAAT-30 and Tcast-Thaumatin-rev 50 -ACCCCCGAAAGTGATTAAATA-30 . The resulting PCR amplification product was subsequently cloned by use of the TA Expression Kit into the pCRT7/ CT-TOPO expression vector (Invitrogen). This construct allowed the production of Tribolium thaumatin-1 in E. coli with a carboxy-terminal histidine tag. BL21(DE3) E. coli cells (Invitrogen) were used for production of recombinant Tribolium thaumatin-1. Optimal protein production was observed when cultures were grown at 32 1C without IPTG to an optical density of 5–6 at 600 nm. The cells were harvested by centrifugation and cell pellets were stored at 20 1C until use. We purified the recombinant protein under denaturating conditions using 8 M urea and 100 mM sodium phosphate buffer, pH 8, since all Tribolium thaumatin-1 protein was found in insoluble inclusion bodies. All purification steps were monitored by SDS-PAGE analysis using 15%-tris–tricine gels. The bacterial cell pellet was resuspended in saline buffer and disintegrated by ultrasonic treatment at 0 1C. After centrifugation of the cell lysate, proteins from inclusion bodies were solubilized in 8 M urea and 100 mM sodium phosphate buffer, pH 8. After a subsequent centrifugation Tribolium thaumatin-1 was purified from the supernatant using immobilized metal affinity chromatography on Protinos Ni-IDA resin (Macherey Nagel, Du ¨ren, Germany) according to the user guide instructions of the manufacturer. The protein was desalted, refolded, and concentrated using Amicons Ultra-4 centrifugal filter devices (Millipore, Billerica, MA). In brief, the protein solution was concentrated by ultrafiltration to a volume of about 100 ml and diluted in 5 mM sodium phosphate, pH 7, to a volume of 4 ml. This procedure was repeated five times. Protein concentrations were measured using the method of Bradford with bovine serum albumin as standard. The concentration of purified Tribolium thaumatin-1 was determined in 20 mM sodium phosphate buffer (pH 6.5) containing

2.6. Sequence alignments and phylogenetic analysis

Table 1

using

UV

spectroscopy

Multiple sequence alignments were computed using the blosum62 program [27]. For phylogenetic reconstruction, we used the software package MrBayes 3.1.2 [28], which combines Bayesian inference and Markov chain Monte Carlo convergence acceleration techniques known as Metropolis coupling. The average standard deviation of split frequencies at 107 generations was 0.0041 for the defensins and therefore indicated that the two chains that were run converged on similar results. The 50% majority rule tree presented here was constructed from all sampled trees with the first 25% of all trees ignored as burn in. Posterior probabilities plotted at the nodes can be interpreted as the probability that the tree or clade is correct [29].

2.7. Quantitative real-time RT-PCR Quantitative real-time RT-PCR was performed with the realtime PCR system Mx3000P (Stratagene, La Jolla, CA, USA) using the FullVelocity SYBRs Green QRT-PCR Master Mix (Stratagene), according to the protocols of the manufacturer. RNA (0.1 ng) per reaction was used to amplify 18S rRNA and 100 ng of RNA per reaction to amplify selected Tribolium genes using appropriate primers (Table 1). Primers were selected using the primer3 software [30] and were purchased from Thermo electron (Waltham, MA, USA).

3. Results and discussion 3.1. Subtracted cDNA library of immune-challenged T. castaneum A subtracted cDNA library enriched in immune-inducible genes was constructed using the SSH method. To induce strong and broad immune responses, we injected a

Genes analyzed by quantitative real time RT-PCR analysis

Gene

Accession number

Forward primer 50 –30

Reverse primer 50 –30

18S rRNA Alpha-Tubulin Defensin 1 Defensin 2 Defensin 3 Thaumatin 1 ApoD Hsp68 Hsp27 Cyto. P450 Thor HIG HIF

AJ878603 XM_970811 XM_962101 XM_963144 XM_968482 XM_963631 XM_965938 XM_969349 XM_969274 XM_966519 XM_969838 XM_967379 XM_962334

ATGGTTGCAAAGCTGAAACT TCAAATGCGACCCACGTCAT GGCACATATCCGGGTCAGACG CAAACGCTTCACTTGTGACGTCCTC GCGTCTTCGAAACCACAGCCTTT GGCAACGGGGTTATTGCTTG CGGAGGGGCGAAGAAAGTCT ATCGCCGGTTTGAACGTCAT CATGACGTGAATCGGGTGGA TACCCCTCGGTGCCGTTCTA TTGATGCGAGGCAAAACGAA AGTCTCGATTGGCGCGAAAG GTCGGATTTGGTGGCGAAAG

TCCCGTGTTGAGTCAAATTA GGCAATAGCCGCGTTGACAT AGACAATGGGCGGCACAAGC ATGGGTCGCACATGCGGAAT GATGGAGACGCCCCGGAAG ACGTGTCAGGTGTGCCGAAA TTCGGCATTCGGGTTAATCG ACGTTTCGTTCGCCCTTCAA TCTCCTGCTCCTTCCCATCG GGTGGATGCCGTAAGCGAAA CTGGTGTTCGTCGTGCGAAT TGCTCATTTTGCCCCGATTT CTTTTCGCTGCTGCTCCACA

ARTICLE IN PRESS 588

Table 2

B. Altincicek et al.

cDNAs from the subtracted T. castaneum library

Genbank accession no. of EST

Genbank accession no. of gene

Description

Predicted function

Transcription and protein biosynthesis EX149741 XM_965040 EX149742 XM_961323 EX149743 XM_970418 EX149744 XM_964679 EX149745 XM_964770

Similar Similar Similar Similar Similar

RNA polymerase subunit 8 eIF5 eIF4A3 eIF4G2 Splicing factor 3B

Signaling EX149746 EX149747

XM_962703 XM_966756

Similar to Toll protein precursor Similar to CG1915

EX149748 EX149749 EX149750 EX149751

XM_962907 XM_965144 XM_967656 AM712901

EX149752 EX149753

XM_961747 XM_965512

EX149754 EX149755 EX149756 EX149757

XM_966756 XM_965923 XM_964747 XM_962580

Similar to CG5195 Similar to otoferlin Similar to CG16721 Similar to other G protein-coupled receptors Similar to CG17061 Similar to CG7207 (Goodpasture antigenbinding protein) Similar to IplI-aurora-like kinase Similar to protein kinase N2 Similar to CG11490 Similar to CG10370

EX149758 EX149759

XM_970928 GLEAN_06389

Similar to CG32171 Similar to CG1647

Potential adaptor proteins EX149760 XM_970116 EX149761 XM_962027

to to to to to

CG11246 CG9177 CG7483 eIF4G2 splicing factor 3B

Toll Immunoglobulin domain cell adhesion molecule Leucine-rich repeats protein Leucine-rich repeats protein T-complex protein 11 G-protein-coupled receptor G-protein coupled receptor Serine/threonine protein kinase Serine/threonine protein kinase Serine/threonine protein kinase GTPase activator 26S proteasome regulatory complex subunit p50 (Tat-binding protein-1) Limpet (LIM domain transcription factor) Putative transcription factor (zinc finger protein)

EX149762 EX149763 EX149764 EX149765

XM_964125 XM_966829 XM_966838 XM_967261

Similar to CG3529 ANK, NACHT, TRP14-domain containing protein Similar to CG9226 Similar to Sel1 Similar to CG30357 Similar to kelch-like 10

Proteinases EX149766 EX149767 EX149768 EX149769

XM_970265 GLEAN_04524 XM_970599 XM_963643

Similar to CG3066 (PPOAE-I) About 70% similar to XP_970945 Similar to CG17572 Similar to CG12004

Trypsin-like serine protease Trypsin-like serine protease Trypsin-like serine protease Aspartyl protease

Similar to CG14745 Similar to CG1469 Similar to CG8492 About 62% similar to ribosomal protein L27 (XP_969072) Similar to CG15168 Hypothetical protein Similar to CG1385 Similar to thaumatin family Pacifastin-related serine protease inhibitor Similar to inter-a-trypsin inhibitor heavy chain H4 precursor About 65% similar to XP_970494

Peptidoglycan-recognition protein-SC2 Ferritin 2 (light chain homolog) C-type lysozyme domains Putative antimicrobial peptide

Immune defense and effector molecules EX149770 XM_964309 EX149771 XM_961219 EX149772 XM_964986 EX149773 AM712902 EX149774 EX149775 EX149776 EX149777 EX149778

XM_964457 XM_971367 XM_963144 XM_963631 XM_966374

EX149779

XM_968536

EX149780

AM712903

GAT and Tom1 domain containing protein ANK, NACHT, TRP14-domain containing protein WD40-domain protein Sel1-like Kelch motif protein Kelch-like 10

Putative antimicrobial peptide Snake toxin disulfide-rich fold-like Defensin Antifungal peptide Serine protease inhibitor Serine protease inhibitor DNA/RNA non-specific endonuclease

ARTICLE IN PRESS Identification of immune-inducible genes from the model insect T. castaneum

589

Table 2 (continued ) Genbank accession no. of EST

Genbank accession no. of gene

Description

Predicted function

Stress-associated proteins EX149781 XM_965938 EX149782 XM_967379 EX149783 XM_969349 EX149784 XM_969274 EX149785 XM_964253

Similar Similar Similar Similar Similar

Apolipoprotein D Hypoxia-inducible gene 1 Heat shock protein 68 Heat shock protein 27 Eukaryotic enzyme that functions in nucleotide-excision repair (XPG)

Cytochrome P450s EX149786 EX149787 EX149788

Similar to CG3466 Similar to CG3466 Similar to CG3466

Cytochrome P450 Cytochrome P450 Cytochrome P450

Membrane transporter proteins EX149789 XM_963468 EX149790 GLEAN_03797

Similar to CG16944 About 78% similar to XP_967244

EX149791 EX149792

XM_968365 XM_965271

Similar to CG2969 Similar to CG10960

Mitochondrial carrier protein MTABC3 (ABCB6) is a mitochondrial ATPbinding cassette protein ABC transporter Sugar transporter

Metabolism EX149793 EX149794 EX149795 EX149796 EX149797

AM712904 XM_964937 XM_96250 XM_968131 XM_966573

About 56% similar to XP_968486 Similar to CG12233 Similar to CG10175 Similar to CG6188 Similar to CG1640

EX149798 EX149799 EX149800 EX149801

XM_962288 XM_969364 XM_961451 XM_964293

Similar Similar Similar Similar

XM_966519 XM_966019 XM_968330

to to to to to

to to to to

ApoD CG11825 heat shock protein 68 heat shock protein 27 CG10670

CG5077 CG4162 CG5157 CG31022

Predicted acyltransferases Isocitrate/isopropylmalate dehydrogenase Esterase_lipase Glycine N-methyltransferase activity Aspartate/tyrosine/aromatic aminotransferase Oxysterol-binding protein Serine palmitoyltransferase subunit II Cytochrome b5-like Heme/steroid binding Prolyl-4-hydroxylase-a

Vesicular transport proteins EX149802 XM_964317 EX149803 XM_963294

Similar to NipSnap protein Similar to CG8385 (Arf1-Arf5-like protein)

Vesicular transport protein Crucial for assembling coat proteins during vesicle formation

Cell motility and migration EX149804 XM_962255 EX149805 XM_969967 EX149806 XM_961952 EX149807 XM_967719

Similar Similar Similar Similar

b-tubulin Myosin VI ZASP, PDZ, and LIM domain protein CLIP-190, spindle-checkpoint activation

Potential matrix proteins EX149808 XM_964607

Similar to CG31004

EX149809

XM_971019

Collagen-like

Unknown proteins EX149810 EX149811

XM_970849 AM712905

EX149812 EX149813 EX149814 EX149815

XM_971061 XM_962169 XM_967065 DT802858

Hypothetical protein 90% similar to C-terminus of cytochrome c oxidase subunit I (102 aa) SAP domain protein Similar to C20orf26 Similar to CG3967 No similarities

to to to to

CG3401 CG5695 CG30084 CG5020

commercially available purified LPS preparation that is known to contain impurities like bacterial nucleic acids, proteins, and peptidoglycans and that is commonly used as an elicitor in vertebrate and invertebrate research. A total

Complement control protein (CCP) module and vWF domain containing protein Collagen-like Protein with unknown function Protein with unknown function Protein Protein Protein Protein

with with with with

unknown unknown unknown unknown

function function function function

of 288 clones were randomly picked and subjected to colony PCR. Plasmids that have been screened positively in blot hybridization indicating induced expression of corresponding genes were isolated and sequenced. Obtained sequences

ARTICLE IN PRESS 590 were compared to Tribolium sequence databases and summarized (Table 2). Five not yet annotated genes were deposited at EMBL-European Bioinformatics Institute. Here, we describe the identification of 75 immune-inducible genes in T. castaneum potentially involved in immune defense, signaling, and other immunity-linked cellular processes (Fig. 1). However, it should be noted that the used method is not a genome-wide analysis, since presently no microarrays are available for Tribolium. Thus, there may be an even richer assembly of immunity-related genes that would not be detected by our SSH approach.

3.2. Proteins involved in transcription and protein biosynthesis The induced expression of proteins involved in the cellular transcription and translation machinery is commonly found in response to immune challenge in insects and in human monocytes [17–19,31–34]. This indicates that regulation of protein biosynthesis during immune responses is an important feature of immunity. In agreement, we observed the immuneinduced expression of the translation initiation factors eIF4A3, eIF4G2, and eIF5, and splicing factor 3B in Tribolium.

3.3. Signaling proteins

B. Altincicek et al. tion), but have also been found to be regulated by mitogenactivated protein kinases (MAPK) such as c-jun N-terminal kinase (JNK), extracellular signal-regulated kinase (ERK), and p38 and other intracellular signaling pathways like phosphoinositide 3-kinases (PI3K)/AKT or Ras/Raf, which play essential roles especially in cellular immune responses [10–13]. Here, we found transcripts encoding proteins potentially involved in sensing of infection such as Toll, G-protein-coupled receptors, and serine/threonine protein kinases. In addition, we determined proteins that may be involved in regulatory functions in Tribolium, including a 26S proteasome regulatory complex subunit p50, also known as Tat-binding protein-1. This protein is involved in the ubiquitin-dependent protein degradation that plays important roles in cellular processes including regulation of cell cycle division, development and differentiation, apoptosis, cell trafficking, and modulation of immune responses [35]. Among the analyzed sequences, we found Tribolium proteins possibly representing adaptor proteins containing domains like WD40, Sel-1, Kelch, and ANK that may be necessary for protein–protein interactions [36]. Interestingly, we also noticed a protein that contains a GAT and Tom1 (target of myb1-retroviral oncogene) domain and shares sequence similarities to the human protein, Tom1. This protein was shown to form a complex with Tollip (toll interacting protein) and to regulate endosomal trafficking of ubiquitinated proteins [37].

Drosophila immune responses mainly rely on the signaling pathways Toll, IMD (immune deficiency), and JAK/STAT (janus kinase/signal transduction and activator of transcrip-

3.4. Immune defense and effector molecules

Fig. 1 Distribution of immune-inducible transcripts in T. castaneum. Septic injury results in the induced expression of numerous genes that are here categorized into nine groups for a better overview.

Pathogen recognition is the first step of innate immune responses and mainly depends on host proteins called pattern recognition receptors. In insects, two prominent members, the Gram-negative binding proteins (GNBP) and peptidoglycan recognition proteins (PGRP), are involved in activation of the prophenoloxidase cascade and of Toll/IMD pathways resulting in the massive production of immuneeffector molecules [10–13,38]. Here, we identified transcripts of proteins sharing sequence similarities to PGRP-SC2 from Drosophila, to three serine proteinases, including one proteinase with sequence similarities to prophenoloxidaseactivating enzymes, and to immune-induced peptides known from other organisms. The latter ones include predicted

Fig. 2 Four thaumatin genes exist in Tribolium. We identified four thaumatin-like proteins (1, XP_968724; 2, XP_975175; 3, XP_975166; 4, XP_969010) in the Tribolium genome. The alignment with thaumatin sequences from Arabidopsis thaliana (NP_177641) and Caenorhabditis elegans (NP_500748) reveals that thaumatins are evolutionarily highly conserved.

ARTICLE IN PRESS Identification of immune-inducible genes from the model insect T. castaneum ferritin, c-type lysozyme, serine proteinase inhibitors, thaumatins, and defensins. Thaumatin-like proteins are disulfide-bridged polypeptides of about 200 residues. Many thaumatins have been purified from plants and shown to possess antifungal activity [39]. They belong to pathogenesis-related group 5 (PR5) plant proteins, are synthesized in response to fungal infection, and, recently, have also been found in Caenorhabditis nematodes and several insects [39]. Here, we found one thaumatin-like gene in the subtracted cDNA library and three additional isoforms in the Tribolium genome (Fig. 2). Interestingly, thaumatin-like genes are obviously absent from the genomes of Drosophila, Apis, and Anopheles. Recombinant Tribolium thaumatin-1 was overproduced in E. coli cells and purified to apparent homogeneity (Fig. 3A). It was found to inhibit spore germination (IC50 value 1.5–2 mM) of the filamentous fungi Beauveria bassiana and Fusarium culmorum (Fig. 3B). B. bassiana belongs to the entomopathogenic fungi that are worldwide used as biological insecticides to control a number of insect pests, whereas F. culmorum is the causal agent of important plant diseases of cereals and grasses. In contrast, at the same concentrations we found no growth inhibition of E. coli, Micrococcus luteus, or the yeast Saccharomyces cerevisiae (data not shown). These results suggest that thaumatin exerts activity against filamentous fungi and may contribute to the beetles’ antifungal defense. In addition, we are currently investigating the potential of thaumatin-like proteins from Tribolium to confer resistance against phytopathogens in transgenic plants (will be published elsewhere), similarly as we have recently shown for the antifungal insect gallerimycin [40]. Defensins have been found in a variety of animals and plants and even in the fungus Pseudoplectania nigrella, suggesting an evolutionarily conserved role in innate immunity and that they may have arisen from a common ancestral gene [41]. Here, we identified one transcript that shares homology to other defensins. Two additional isoforms were traceable in the Tribolium genome. All three defensins contain a predicted signal, pro-sequence, and mature peptide that is similar to other insect defensins (Fig. 4A). Our phylogenetic analysis of the Tribolium defensins in comparison with other insect defensins and with counterparts from plants and a fungus implicates the presence of three subfamilies in insects. The three Tribolium defensins cluster with the majority of known insect defensins. This group also includes a defensin from the apterygote insect Thermobia domestica [19], suggesting that this defensin subfamily is evolutionarily conserved among insects (Fig. 4B). On the other hand, Drosophila drosomycin shares highest similarity to the plant defensin, whereas gallerimycin from the lepidopteran Galleria mellonella and the dragonfly defensin from Aeschna are most similar to the fungal defensin (Fig. 4B). Furthermore, screening EST databases at NCBI for beetle sequences resulted in drosomycin-like (e.g. Trox sp. JH-2005, DV767316) and gallerimycin-like (e.g. Leptinotarsa decemlineata, EB755080) peptides in diverse coleopteran species.

3.5. Detoxification and stress response proteins Several analyzed transcripts encode proteins potentially involved in cell motility, vesicular transport, detoxification, and stress responses. The latter ones include members of

591

Fig. 3 Purification of recombinant Tribolium thaumatin-1 and determining its antifungal activity. (A) SDS–PAGE analysis of the purification of Tribolium thaumatin-1. Thaumatin-1 (lane 2) was purified to apparent homogeneity from the urea-soluble E. coli inclusion bodies fraction (lane 1). Molecular mass standards are indicated in kDa. The migration velocity of the Tribolium thaumatin-1 is in accordance with the calculated molecular mass of 27.8 kDa. (B) Inhibition of fungal spore germination in the presence of purified Tribolium thaumatin-1. Airborne conidia ´ Lhota, spores of B. bassiana (Boverols, Fytovita, Ostrozˇska Czech Republic) and F. culmorum (kindly provided by Prof. Kogel, Phytopathology, Giessen, Germany) were incubated for 24 h at 25 1C for germination in the absence or presence of recombinant Tribolium thaumatin-1 in 5 mM sodium phosphate, pH 7. Bovine serum albumin at same concentrations had no significant inhibitory effects on spore germination. Results represent mean values of three independent determinations 7S.D.

heat-shock proteins (Hsp), cytochrome P450, and ATP-binding cassette (ABC) transporter that are known to be important for xenobiotic stress adaptation resulting in resistance against environmental toxins and mutagens. In agreement, we also found a homolog of apolipoprotein D (apoD) that has recently been shown to increase stress resistance and to extend the life span of Drosophila when overexpressed [42,43]. ApoD is a lipocalin, primarily associated with high-density lipoproteins, that has essential roles in lipid metabolism. In humans, its

ARTICLE IN PRESS 592

B. Altincicek et al.

Fig. 4 Three defensin genes exist in Tribolium. (A) The predicted mature defensin sequences from T. castaneum defensins (Tribolium-Defensin1, XP_967194; Tribolium-Defensin2, XP_968237; Tribolium-Defensin3, XP_973575) were aligned to defensin sequences from the hemipteran Triatoma brasiliensi (UniProt: Q4VSI0), the coleopteran Tenebrio molitor (UniProt: Q27023), the hymenopterans Apis mellifera (Defensin, NP_001011638; Royalisin, NP_001011616) and Formica aquilonia (UniProt: Q5BU36), the dipteran D. melanogaster (Defensin, UniProt: P36192; Drosomycin, NP_523901), the dragonfly Aeschna cyanea (UniProt: P80154), the apterygote insect Thermobia domestica (EMBL-Bank: AM495104), the lepidopteran Galleria mellonella (AAM46728), the plant Raphanus sativus (AAA69541), and the fungus Pseudoplectania nigrella (UniProt: Q53I06). (B) A Bayesian protein tree was generated and we found that the three Tribolium defensins (indicated by gray shading) grouped together with the insect-type defensins, whereas the Aeschna defensin and Galleria gallerimycin grouped with the fungal defensin, and Drosophila drosomycin with the plant defensin. These findings reveal the presence of three defensin subfamilies in insects. The scale bar represents the substitutions per site.

expression is induced in several pathological and stressful conditions and LPS shows a time- and dose-dependent effect on apoD expression in human cells that correlates with an increase in proliferation [44]. At the promoter level, NF-kB, AP-1, and APRE-3 proved to be the elements implicated in this LPS response. However, apart from the involvement of apoD in lipid metabolism, its binding activity for progesterone and arachidonic acid plays a role in cancer development and neurological diseases. In agreement, insect lipocalins were found to bind a variety of lipophilic molecules (endogenous and exogenous compounds) and to be involved in e.g. cryptic coloration, olfaction, pheromone transport, enzyme synthesis of prostaglandins, nerve cell guidance (apoD homolog Lazarillo), or retinoic acid binding [45]. This suggests that potential lipophilic hormones may be involved in insect immunity by transcriptional regulation of important genes by e.g. nuclear receptors.

3.6. Quantitative real-time RT-PCR analysis of immune-induced genes in Tribolium To confirm and precisely determine expression levels of identified immune-induced genes we performed quantitative real-time RT-PCR. We compared RNA from untreated Tribolium beetles with RNA samples from animals that were wounded with sterile saline or LPS, respectively. In addition, we analyzed mRNA levels from mild heat-shocked beetles in order to directly compare the induction levels of immune and stress-responsive genes. We examined the expression of two house-keeping genes, four potential antimicrobial effector genes, and seven potential stress-responsive genes. The latter ones include apoD, Hsp 68, Hsp 27, cytochrome P450, and hypoxia-inducible gene 1 (HIG), and additionally thor and hypoxia-inducible factor 1 a (HIF). Thor is a member of the eIF4E-binding proteins (4E-BPs) and an

ARTICLE IN PRESS Identification of immune-inducible genes from the model insect T. castaneum

593

Fig. 5 Quantitative real-time RT-PCR analysis of transcriptional levels of selected Tribolium genes that are up-regulated in response to septic injury. The mRNA levels of selected genes in heat-shocked, sterile wounded, and septic wounded animals were determined and are shown relative to their expression levels in untreated animals. The expression of the house-keeping genes 18S rRNA and a-tubulin were not significantly influenced by the treatments. Results represent mean values of three independent determinations 7S.D.

infection-inducible factor in Drosophila that links cellular translation to life span during environmental stress [46] and to innate immunity [47]. HIF represents a central regulator in adaptation to oxygen levels that was also found to control the output of heat-shock response in Drosophila [48]. Our analysis revealed that the defensins and thaumatin-1 are strongly induced in response to septic injury (Fig. 5). In addition, LPS challenge and, as expected, a mild heat-shock treatment resulted in a strong induction of apoD, Hsp 68, Hsp 27, and cytochrome P450 and about 2-fold induction of HIG and HIF. Expression levels of thor were not induced on immune challenge, which is in striking contrast to findings from Drosophila [47], suggesting a potential different regulation of this important factor in Tribolium. In order to analyze whether wounding itself induces immune genes, we injured beetles with needles dipped in sterile saline. This sterile wounding results in strong induction of defensin-2, thaumatin-1, and apoD. However, induced expression of defensin-1, defensin-3, Hsp 68, Hsp 27, cytochrome P450, and HIG is dependent on the presence of microbial elicitors that may be recognized by specific receptors suggesting a sophisticated regulation of gene expression in response to different immune stimuli. LPS may trigger immune responses by binding to a Tribolium homolog (XP_969758) of the characterized LPS-binding protein from the coleopteran Holotrichia diomphalia [49]. Furthermore, LPS-binding proteins from arthropods are also known from the cockroach Periplaneta americana [50], factor C from horseshoe crab Tachypleus tridentatus [51], and LPS-binding lectin from Bombyx mori [52] that were demonstrated to function in pathogen recognition and innate immunity. In total, these results reveal that septic injury induces potential immune-effector genes and a variety of stressresponsive genes including hypoxia and heat-shock-responsive ones. This may support our hypothesis that immune and stress responses are linked at some levels.

In conclusion, we describe 75 immune-responsive genes from Tribolium. They include homologs of e.g. Toll, PGRPSC, lysozyme, and multiple isoforms of defensins and thaumatin-like peptides. These may have been evolved in Tribolium by gene duplication and evolutionary selection to target a variety of pathogens probably similar as described for the six a-defensins and four b-defensins from humans [53]. Recombinant thaumatin-1 was produced and showed inhibitory activities against pathogenic fungi similar to that described for thaumatins from plants [39]. In addition, septic injury results in the induced expression of stress adaptation and insecticide resistance genes suggesting that there may be crosstalk between immune and stress responses in Tribolium. This is in agreement with recent findings that disclose links between immunity and stress responses in Drosophila [54–56]. Interestingly, a very recently published microarray analysis of Rel-inducible genes in Drosophila immune responses demonstrates Reldependent expression of a cytochrome p450, a glutathione S-transferase, and two Hsps [57]. The latter ones include Hsp70 BC that is highly similar to the presently identified Hsp68 from Tribolium. Since stress-induced factors including Hsps have been recognized as important danger-signaling molecules in humans [58,59], their involvement in insect immunity will be further elucidated in following studies. The identified immune-inducible genes from T. castaneum may help to reveal differences and similarities between immunity in beetles and in other insects.

Acknowledgments We are indebted to the Human Genome Sequencing Center, Baylor College of Medicine, USA, for the open access to the Tribolium genome sequence database. We thank Meike Fischer for excellent technical assistance and Katja

ARTICLE IN PRESS 594 Altincicek for a critical reading of the manuscript. We are grateful to Gregor Bucher (Georg August University of Go ¨ttingen, Germany) for kindly providing us with Tribolium beetles. This project was supported by a Grant (AL 902/2-1) to B.A. from the Deutsche Forschungsgemeinschaft (Bonn, Germany).

References [1]. Tribolium Genome Sequencing Consortium. The first genome sequence of a beetle, Tribolium castaneum, a model for insect development and pest biology. Nature, in revision. [2] Sokoloff A. The Biology of Tribolium with Special Emphasis on Genetic Aspects. Oxford: Oxford University Press; 1974. [3] Berghammer AJ, Klingler M, Wimmer EA. A universal marker for transgenic insects. Nature 1999;402:370–1. [4] Bucher G, Scholten J, Klingler M. Parental RNAi in Tribolium (Coleoptera). Curr Biol 2002;12:R85–6. [5] Lorenzen MD, Berghammer AJ, Brown SJ, Denell RE, Klingler M, Beeman RW. piggyBac-mediated germline transformation in the beetle Tribolium castaneum. Insect Mol Biol 2003;12: 433–40. [6] Lorenzen MD, Kimzey T, Shippy TD, Brown SJ, Denell RE, Beeman RW. piggyBac-based insertional mutagenesis in Tribolium castaneum using donor/helper hybrids. Insect Mol Biol 2007;16:265–75. [7] Pavlopoulos A, Berghammer AJ, Averof M, Klingler M. Efficient transformation of the beetle Tribolium castaneum using the Minos transposable element: quantitative and qualitative analysis of genomic integration events. Genetics 2004;167: 737–46. [8] Tomoyasu Y, Denell RE. Larval RNAi in Tribolium (Coleoptera) for analyzing adult development. Dev Genes Evol 2004;214: 575–8. [9] Wimmer EA. Innovations: applications of insect transgenesis. Nat Rev Genet 2003;4:225–32. [10] Cherry S, Silverman N. Host–pathogen interactions in Drosophila: new tricks from an old friend. Nat Immunol 2006;7: 911–7. [11] Evans JD, Aronstein K, Chen YP, Hetru C, Imler JL, Jiang H, et al. Immune pathways and defence mechanisms in honey bees Apis mellifera. Insect Mol Biol 2006;15:645–56. [12] Jiravanichpaisal P, Lee BL, So ¨derha ¨ll K. Cell-mediated immunity in arthropods: hematopoiesis, coagulation, melanization and opsonization. Immunobiology 2006;211:213–36. [13] Lemaitre B, Hoffmann JA. The host defense of Drosophila melanogaster. Annu Rev Immunol 2007;25:697–743. [14] Oduol F, Xu J, Niare O, Natarajan R, Vernick KD. Genes identified by an expression screen of the vector mosquito Anopheles gambiae display differential molecular immune response to malaria parasites and bacteria. Proc Natl Acad Sci USA 2000;97:11397–402. [15] Altincicek B, Vilcinskas A. Analysis of the immune-inducible transcriptome from microbial stress resistant, rat-tailed maggots of the drone fly Eristalis tenax. BMC Genomics 2007; 8:326. [16] Seitz V, Clermont A, Wedde M, Hummel M, Vilcinskas A, Schlatterer K, et al. Identification of immunorelevant genes from the greater wax moth (Galleria mellonella) by a subtractive hybridization approach. Dev Comp Immunol 2003; 27:207–15. [17] Zhu Y, Johnson T, Myers A, Kanost M. Identification by subtractive suppression hybridization of bacteria-induced genes expressed in Manduca sexta fat body. Insect Biochem Mol Biol 2003;33:541–59.

B. Altincicek et al. [18] Ursic-Bedoya R, Lowenberger CA. Rhodnius prolixus: identification of immune-related genes up-regulated in response to pathogens and parasites using suppressive subtractive hybridization. Dev Comp Immunol 2007;31:109–20. [19] Altincicek B, Vilcinskas A. Identification of immune-related genes from an apterygote insect, the firebrat Thermobia domestica. Insect Biochem Mol Biol 2007;37:726–31. [20] Altincicek B, Vilcinskas A. Analysis of the immune-related transcriptome of a lophotrochozoan model, the marine annelid Platynereis dumerilii. Front Zool 2007;4:18. [21] Bouchut A, Coustau C, Gourbal B, Mitta G. Compatibility in the Biomphalaria glabrata/Echinostoma caproni model: new candidate genes evidenced by a suppressive subtractive hybridization approach. Parasitology 2007;134:575–88. [22] de Lorgeril J, Saulnier D, Janech MG, Gueguen Y, Bachere E. Identification of genes that are differentially expressed in hemocytes of the Pacific blue shrimp (Litopenaeus stylirostris) surviving an infection with Vibrio penaeicida. Physiol Genomics 2005;21:174–83. [23] Guillou F, Mitta G, Galinier R, Coustau C. Identification and expression of gene transcripts generated during an antiparasitic response in Biomphalaria glabrata. Dev Comp Immunol 2007;31:657–71. [24] Huang G, Liu H, Han Y, Fan L, Zhang Q, Liu J, et al. Profile of acute immune response in Chinese amphioxus upon Staphylococcus aureus and Vibrio parahaemolyticus infection. Dev Comp Immunol 2007;31:1013–23. [25] Lin B, Chen S, Cao Z, Lin Y, Mo D, Zhang H, et al. Acute phase response in zebrafish upon Aeromonas salmonicida and Staphylococcus aureus infection: striking similarities and obvious differences with mammals. Mol Immunol 2007;44: 295–301. [26] Tanguy A, Guo X, Ford SE. Discovery of genes expressed in response to Perkinsus marinus challenge in Eastern (Crassostrea virginica) and Pacific (C. gigas) oysters. Gene 2004;338: 121–31. [27] Corpet F. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res 1988;16:10881–90. [28] Ronquist F, Huelsenbeck JP. MrBayes 3, Bayesian phylogenetic inference under mixed models. Bioinformatics 2003;19: 1572–4. [29] Huelsenbeck J, Rannala B. Frequentist properties of Bayesian posterior probabilities of phylogenetic trees under simple and complex substitution models. Syst Biol 2004;53:904–13. [30] Rozen S, Skaletsky H. Primer3 on the WWW for general users and for biologist programmers. Bioinformatics Methods and Protocols: Methods in Molecular Biology. Totowa, NJ: Humana Press; 2000. [31] De Gregorio E, Spellman PT, Rubin GM, Lemaitre B. Genomewide analysis of the Drosophila immune response by using oligonucleotide microarrays. Proc Natl Acad Sci USA 2001;98: 12590–5. [32] Irving P, Troxler L, Heuer TS, Belvin M, Kopczynski C, Reichhart JM, et al. A genome-wide analysis of immune responses in Drosophila. Proc Natl Acad Sci USA 2001;98: 15119–24. [33] Johansson KC, Metzendorf C, So ¨derha ¨ll K. Microarray analysis of immune challenged Drosophila hemocytes. Exp Cell Res 2005;305:145–55. [34] Suzuki T, Hashimoto S, Toyoda N, Nagai S, Yamazaki N, Dong HY, et al. Comprehensive gene expression profile of LPS-stimulated human monocytes by SAGE. Blood 2000;96:2584–91. [35] Wang J, Maldonado MA. The ubiquitin–proteasome system and its role in inflammatory and autoimmune diseases. Cell Mol Immunol 2006;3:255–61. [36] Finn RD, Mistry J, Schuster-Bo ¨ckler B, Griffiths-Jones S, Hollich V, Lassmann T, et al. Pfam: clans, web tools and services. Nucleic Acids Res 2006;34:D247–51.

ARTICLE IN PRESS Identification of immune-inducible genes from the model insect T. castaneum [37] Katoh Y, Shiba Y, Mitsuhashi H, Yanagida Y, Takatsu H, Nakayama K. Tollip and Tom1 form a complex and recruit ubiquitin-conjugated proteins onto early endosomes. J Biol Chem 2004;279:24435–43. [38] Dziarski R. Peptidoglycan recognition proteins (PGRPs). Mol Immunol 2004;40:877–86. [39] Shatters RG, Boykin LM, Lapointe SL, Hunter WB, Weathersbee AA. Phylogenetic and structural relationships of the PR5 gene family reveal an ancient multigene family conserved in plants and select animal taxa. J Mol Evol 2006; 63:12–29. [40] Langen G, Imani J, Altincicek B, Kieseritzky G, Kogel KH, Vilcinskas A. Transgenic expression of gallerimycin, a novel antifungal insect defensin from the greater wax moth Galleria mellonella, confers resistance to pathogenic fungi in tobacco. Biol Chem 2006;387:549–57. [41] Mygind PH, Fischer RL, Schnorr KM, Hansen MT, Sonksen CP, Ludvigsen S, et al. Plectasin is a peptide antibiotic with therapeutic potential from a saprophytic fungus. Nature 2005; 437:975–80. [42] Sanchez D, Lo ´pez-Arias B, Torroja L, Canal I, Wang X, Bastiani MJ, et al. Loss of glial lazarillo, a homolog of apolipoprotein D, reduces lifespan and stress resistance in Drosophila. Curr Biol 2006;16:680–6. [43] Walker DW, Muffat J, Rundel C, Benzer S. Overexpression of a Drosophila homolog of apolipoprotein D leads to increased stress resistance and extended lifespan. Curr Biol 2006;16: 674–9. [44] Do Carmo S, Levros LC, Rassart E. Modulation of apolipoprotein D expression and translocation under specific stress conditions. Biochim Biophys Acta 2007;1773:954–69. [45] Flower DR. The lipocalin protein family: structure and function. Biochem J 1996;318:1–14. [46] Tettweiler G, Miron M, Jenkins M, Sonenberg N, Lasko PF. Starvation and oxidative stress resistance in Drosophila are mediated through the eIF4E-binding protein, d4E-BP. Genes Dev 2005;19:1840–3. [47] Bernal A, Kimbrell DA. Drosophila Thor participates in host immune defense and connects a translational regulator with innate immunity. Proc Natl Acad Sci USA 2000;97:6019–24. [48] Baird NA, Turnbull DW, Johnson EA. Induction of the heat shock pathway during hypoxia requires regulation of heat shock

[49]

[50]

[51]

[52]

[53]

[54]

[55]

[56]

[57]

[58]

[59]

595

factor by hypoxia-inducible factor-1. J Biol Chem 2006;281: 38675–81. Ju JS, Cho MH, Brade L, Kim JH, Park JW, Ha NC, et al. A novel 40-kDa protein containing six repeats of an epidermal growth factor-like domain functions as a pattern recognition protein for lipopolysaccharide. J Immunol 2006;177:1838–45. Jomori T, Natori S. Molecular cloning of cDNA for lipopolysaccharide-binding protein from the hemolymph of the American cockroach, Periplaneta americana: similarity of the protein with animal lectins and its acute phase expression. J Biol Chem 1991;266:13318–23. Muta T, Miyata T, Misumi Y, Tokunaga F, Nakamura T, Toh Y, et al. Limulus factor C. An endotoxin-sensitive serine protease zymogen with a mosaic structure of complement-like, epidermal growth factor-like, and lectin-like domains. J Biol Chem 1991;266:6554–61. Koizumi N, Morozumi A, Imamura M, Tanaka E, Iwahana H, Sato R. Lipopolysaccharide-binding proteins and their involvement in the bacterial clearance from the hemolymph of the silkworm Bombyx mori. Eur J Biochem 1997;248:217–24. Crovella S, Antcheva N, Zelezetsky I, Boniotto M, Pacor S, Verga Falzacappa MV, et al. Primate beta-defensins—structure, function and evolution. Curr Protein Pept Sci 2005;6: 7–21. Ekengren S, Hultmark D. A family of Turandot-related genes in the humoral stress response of Drosophila. Biochem Biophys Res Commun 2001;284:998–1003. Brun S, Vidal S, Spellman P, Takahashi K, Tricoire H, Lemaitre B. The MAPKKK Mekk1 regulates the expression of Turandot stress genes in response to septic injury in Drosophila. Genes Cells 2006;11:397–407. Girardot F, Monnier V, Tricoire H. Genome wide analysis of common and specific stress responses in adult Drosophila melanogaster. BMC Genomics 2004;5:74. Pal S, Wu J, Wu LP. Microarray analyses reveal distinct roles for Rel proteins in the Drosophila immune response. Dev Comp Immunol 2007. Karin M, Lawrence T, Nizet V. Innate immunity gone awry: linking microbial infections to chronic inflammation and cancer. Cell 2006;124:823–35. Pockley AG. Heat shock proteins as regulators of the immune response. Lancet 2003;362:469–76.