Behaviors of nitrifiers in a novel biofilm reactor employing hanging sponge-cubes as attachment site

~

Pergamon

Waf. Sci Tech. Vol. 39, No.7, pp. 23-31,1999 iCl999IAWQ

Pll: 80273-1223(99)00146-8

Published by Elsevier Science Ltd Printed in Great Britain. All rights reserved 0273-1223199520.00 + 0.00

BEHAVIORS OF NITRIFIERS IN A NOVEL BIOFILM REACTOR EMPLOYING HANGING SPONGE-CUBES AS ATTACHMENT SITE Nobuo Araki*, Akiyoshi Ohashi**, Izarul Machdar** and Hideki Harada** • Department ofCivil Engineering. Nagaoka National College ofTechnology, 888 Nishi-Katakai. Nagaoka 940-8532. Japan •• Department ofEnvironmental Systems Engineering, Nagaoka University of Technology, 1603-1 Kamitomioka. Nagaoka 940-2188, Japan

ABSTRACT Fluorescence in-situ hybridization (FISH) and DO microelectrodes were applied to biofilms developed in a novel reactor named DHS (downflow hanging sponge-cubes), to investigate the mechanisms of simultaneous carbon removal and mtrification. The DHS reactor was employed as an aerobic post-treatment process after an UASB anaerobic pre-treatment process receiving a municipal sewage. The presence ratio of Nitrosomonas and Nitrobacter cells to total cells of the DHS biomass was estimated by FISH technique to be 1.4% and 0.18%, respectively. Cell concenlraltons of both nitrifying bacteria were in good agreement with the magnitudes of ammoma-oxldizmg and nitrite-oxidizing activities evaluated from batch tests. The habitats of both nitrifiers were the interior space of spongc-cubes, rather than within the biofilms attached onto sponge• cube surfaces. DO microelectrodes verify that the sponge-cubes insides were kept aerobIcally throughout the whole reactor height excluding the mlet vlcmity porlton. iO 1999 IAWQ Published by Elsevier Science Ltd. All rights reserved

KEYWORDS Municipal sewage; post-treatment process; fluorescent in situ hybridization; nitrifying bacteria; biofilm; DO microelectrodes. INTRODUCTION Our research group has been developing a novel sewage treatment system as a cost-effective and easy• maintenance system, by combining an anaerobic UASa reactor as a pre-treatment unit and an aerobic DHS (downflow hanging sponge-cubes) reactor as a post-treatment unit (Agrawal et al., 1997; Machdar et al., 1997). Our originally proposed DHS process has a unique design concept: each module is a 2-3 m string of vertically diagonally-connected sponge cubes (1-2 cm size polyurethane form cubes). The influent wastewater is permeating by gravity into sponge-cube inside. The DHS reactor has two prominent advantages; requiring neither external aeration input nor withdrawal of excess sludge. The pre-treatment UASB unit performed sixty to seventy percent removal of the influent organic matters. The post-treatment DHS reactor exhibited an excellent removal of the remaining COD of the UASB effluent as well as 23

24

N ARAKI ef al.

relatively hIgh (sixty to seventy percent) nitnfication. The DHS reactor was capable of retainmg high biomass, and a resultant long SRT allowed existence of nitrifying bacteria in the retained sludge. Recently, for in situ analysis of biofilm microbial community structure, newly developed tools have been increasmgly mtroduced, such as fluorescently labeled rRNA-targeted oligonucleotide probes and microelectrodes. The 16S rRNA-targeted probe technique has been successfully applied in a variety of complex microbial communities such as activated sludge, anaerobic granules and nitrifying biofilms (Wagner et al., 1994; Raskin et al., 1995; Schramm et al., 1996). Microelectrodes enabled us to monitor the microprofile of each substrate/products in biofilm and biomass aggregates (De Beer et al., 1993; Schramm et al., 1996). The purpose of this study IS to clanfy the mechanism of nitrification occurring in the DHS reactor by applying the above-mentioned two new tools. FISH determmed that both types of nitrifier counting were correlated with biomass ammonia-oxidizmg and mtrite-oxidlzing activities obtained by conventional batch tests. Spatial distribution of nitrifying bacteria was assessed by applying FISH technique to bIOmass sectioning samples harvested from the sponge-cube surface and the interior portion. A DO microelectrode was used to examine the availability of dissolved oxygen inside the sponge-cubes.

UASB Reactor Volume:155L UASB unit (GSS:35L)

DBS unit

Inner diameter:20cm

FIgure I. SchematICs and photographs of expenmental set up, UASB plus DHS reactor systems, Installed at a sewage treatment plant sIte.

MATERIAL AND METHODS Experimental setup The UASB plus DHS system was installed at a municipal sewage treatment plant site in Nagaoka City, Japan. The schematic and the photographs of the system are shown in Fig. 1. The UASB reactor has ISS L of working volume, including a 35 L gas/solid separator. The effluent from the UASB was further forwarded for polish-up to the followmg aerobIc DHS post-treatment unit. The DHS reactor consists of a number of hanging sponge-cubes strings, each string having 2.0 m vertical length, composed of 90 polyurethane sponge-cubes (1.5 x 1.5 x 1.5 cm) connected diagonally in series with each other. In the DHS reactor the mfluent stream was gravitationally migrating downward from the anterior cube to the posterior cubes toward the outlet. The flow rate of each sponge-cubc string of the DHS unit was kept at 2.1 mLimin. The UASB

Novel blotilm reactor employing banging oponge-cubes

25

unit and the DH8 unit were operated at 7 h HRT and 1.3 h HRT, respectively, resulting in the overall HRT of8.3 h. Both units were maintained at 25°C. OLIGONUCLEOTIDE PROBES Two originally designed oligonucleotide probes complementary specific regions of 16S rRNA were used in this study; Nsm657 (5' TGGAATTCCACTCCCCTCTG 3', E. coli position: 657-667) specific for the genus Nitrosomonas and Ntbl169 (5' TTGCTTCCCATTGTCACC 3', E. coli position: 1169·1188) specific for the genus Nitrobacter. The probes were 5' I abeled with tetramethylrhodamine-isothyocyanate (TRITC) using an amino-linker. The optimal conditions for whole-cell hybridization were determined with a mixture of the target organisms and some reference; Nitrosomonas europaea (IFO I4928), Nitrosomonas eutropha, Nitrobacter winogradski (IF014927), Bradyrhizobium japonicum (IFOI4783), Psuedomonasputida (IFOI4796). Cells were fixed with 4% parafonnaldehyde for 24 h at 4°C. Fluorescent in-situ hybridization (FISH) For in situ hybridization with fluorescently labeled oligonucleotides, the protocol described by Amann (Amann, 1995) was used with some minor modifications. The hybridization buffer contained 0.9 M NaCI, 20 mM TrisHCI (pH 7.2), om % sodium dodecyl sulfate (80S), and 25% Block Ace (Snow Brand Milk Products, Japan). Formamide was added at a final concentration of20% for Nmn657 and 10% for Ntbl169 to ensure optimal hybridization stringcncy. Each hybridization was performed for 2 h at a hybridization temperature of 40°C. Washing step was performed for 20 min at 42°C with the hybridization buffer including no probes. Nitti fyiDl: bacteria countinl: Sludge samples for cell counting of nitrifying bacteria were taken out at three different locations of the DHS reactor on operation day 170. Three cell-suspensions were prepared by squeezing three pieces of the sponge• cube from the upper portion, 17 pieces from the middle portion and 29 pieces from the bottom portion of the DHS reactor, respectively. The cell samples were fixed with 4% paraformaldehyde for 24 h at 4°C. Then, for homogenization, the samples were sonicated for 5 min on ice (Branson Sondier 250, output control I), and diluted. The cells in one mL of four different diluted samples, i.e., 10 1_104, were collected on a polycarbonate nuclepore membrane (Millipore, 0.2 11m, 13 mm~, and directly forwarded FISH procedure. Cell staining with 4', 6-diamidino-2-phenylingole (DAPI) was carried out after FISH for 10 min at ambient temperature. The membranes were examined' with an epifluorescence microscopy (Olympus BX-60-FLA) with two standard filter sets: WIU (V-excitation for DAPI), and WIG (G-excitation for TRITC). At least ten microscopic fields were viewed at the most appropriate dilution for each sample. Thin sections Two different sources of sludge were obtained from 50 cm downward location of the DHS reactor; one as attached biofilm on the sponge-cube surface and the other as aggregated-biomass deposited in the interior space of the sponge-cubes. Sludge samples were fixed with 4% paraformaldehyde for 24 h at 4°C, and then embedded with melted paraplast (Sherwood Medical). Thin sectioning was made with a microtome at 1-2 11m thickness, which was then spread on a gelatin-coated slide glass. Deparaffined sections on the slide glass were forwarded to the FISH procedure. Njtrifyini: activity tests and MPN cell couptinl: The cell-suspensions were also offered for separate batch activity tests and three tubes multiple MPN method, with respect to ammonia-oxidation and nitrite-oxidation. For the activity tests, an appropriate quantity of the cell-suspension was transferred to ammonia- and nitrite-medium (pH 7.1-7.2) containing 20 mg-NIL as a final concentration. The activities were determined as ammonia-oxidation and nitrite-oxidation rates during the initial 2 h at 25°C.

N. ARAKI et al.

26

DO measurement In situ measurement of DO profiles was carried out as a function of sponge-cube inward depth and reactor height. DO microsensor with a tip diameter about 10 11m was prepared as a built-in reference electrode (Harada et al., 1997). RESULTS AND DISCUSSION Reactor performance Process performance of the UASB pre-treatment unit and the DHS post-treatment unit are summarized in Table 1. The sewage (the influent to the UASB) has the average total-COD of 672 mg/L (S.D. ± 163 mg/L) and the soluble-COD of201 mg/L (S.D. ± 67 mg/L). During an experimental period of 170 days continuous operation, the VASB unit achieved 80% removal on the total COD basis and 65% removal on the soluble COD basis at 7 h HRT. No substantial ammonia removal occurred within the UAsa unit. The DHS post• treatment unit received the effluent from the VASB unit, having 144 mg/L of total-COD and 67 mgIL of soluble-COD. The DHS unit functioned satisfactorily not only for removals of residual organics of the VASB effluent, but also nitrogen removal. The DHS process performed 78% of ammonia conversion to nitrate, and concurrently some denitrification. The whole system (VASB unit plus DHS unit) consistently achieved an excellent performance for organic removal: 94% of total-COD (based on the influent total-COD versus the effluent total-COD), 81 % of soluble-COD (the influent soluble-COD versus the effluent soluble• COD), and nearly complete removals for total-BOD and SS at the overall HRT of only 8.3 h. Table 1. Summary ofthe VASB unit, the DHS unit, and the whole system during 170 days continuous operation

-

Parameter Inf (Sewage) VASB effluent DHS effluent Total System 40(18) COOt (mg/L) 144(54) 672(163) 36(16) COOs (mg/L) 67(18) 201(22) 2(1) BOOt (mg/L) 68(33) 259(110) BODs (mg/L) 23(15) 95(60) 56(19) 6(2) T-Kjelgahl (mg-N/L) 52(10) 42(9) 40(8) S-Kjeldahl (mg-N/L) NH4-N (mg-N/L) 6(5) 31(8) 32(15) NQ2-N (mg-N/L) 0.64* NO NO 30(8) N03-N (mg-N/L) NO NO 5S (mg/L) 75(39) NO 235(116) VS5 (mg/L) 43(27) NO 201(95) 7.18(0.6) DO (mg/L) 0.7(0.6) 0 3.8 6.3-8.5 6.4-7.4 pH 71(12) 94 COOt removal (%) 80(10) 44(15) 81 COOs removal (%) 65(10) 78(18) 75 NH4-N removal (%) 55 removal (%) 100 100 60 .. ( ): standard deViatIOn, *:detected only until one week after start-up, NO: not detectable Nitrogen compound profiles along the DHS reactor height were measured at appropriate time intervals during the 170-day operation, and a representative profile was given in Fig. 2. A significant ammonia oxidation to nitrate occurred until the upper half height of the DHS reactor, at which some nitrite accumulation was also observed. The final effluent from the DHS reactor contained almost no nitrite• nitrogen and a low level of ammonia-nitrogen.

Novel blofilm reactor ernploymg hangmg sponge-cubes

27

200 ~------(:J--------. NH4

002

~150

N03

E

f

100

~

~

50

10

20

30

40

50

Nitrogen cone. (mg-N/L) FIgure 2. Profiles of nitrogen species along DHS reactor height on the day 170.

FIgure 3. Whole cell hybridIZatIon WIth fluorescent oligonucleotIde probes specific for the genus Mtrosomonas (a, b) and Nitrobacter (c, d). The identical microscopIc fields were viewed under U-excitabon (a, c) and under G-excltabon (b, d). Scale bar, 30 fim.

CeIl concentration ofnitrifyini bacteria in PHS reactor For direct counting of nitrifying bacteria, the FISH procedure using the aforementioned two probes was

ap~lied to the membrane filters on which the ceil-suspensions of 101_104 dilution were fixed. Cell density of 10 dilution was most appropriate for microscopic counting of Nilrosomonas with the probe Nmn657, as shown in Fig.3 (b). Since Nilrobacler were present at a much lower concentration, compared with Nilrosomonas, only the ]01 dilution cell-suspension was able to provide a reliable cell counting, as shown in

Fig. 3 (d). Figure 3 (c) shows V-excitation of the same microscopic field as Fig. 3 (d), giving too high a cell density for direct ceIl counting. Accordingly, for DAPI-stained ceIl counting, the cell-suspension of 104 was

28

N. ARAKI et al.

adopted as the optimum dilution rate. FISH application to the cells collected on a membrane filter offered a ready, but reliable, quantification of specifically targeted taxa in a microbial community. Table 2. Comparison of the cell numbers present in sludge samples obtained at different height locations of the DRS reactor, determined by the FISH and conventional MPN method DHS location

Upper

Middle

Lower

1.9+0.2 x 10 9 (N=14) 2.1 +0.4 x 10 9 (N=15) 1.7+0.1 x 10 9 (N=14) Nmn657·DeC (eells/mL ) 2.9+ 1.1 x 10 7 (N=JO) 2.6+0.9 x 10 7 (N=JO) 2.4+ 1.0 x 10 7 (N=IO) FISH Ntbl 169-DeC (eellslmL) 3.6+1.6 x J06(N=1I) 3.3+0.9 x 10 6 (N=IO) 3.0+ 1.5 x 10 6 (N=JO) NH4 -Oxidizer (MPN/mL) 7500 2900 1100 MPN 7500 N~-Oxidizer (MPN/mL ) 4300 1100 DeC; Direct Cell Counts, N; Number of optical fields for DeC DAPI-DeC (eells/mL)

Table 2 shows the comparison in the cell number between DAPI-staining total cells, Nitrosomonas cells, Nitrobacter cells and the conventional MPN-determined cells. Direct-cell counting by the probes Nmn657 and Ntb1l69 revealed that the DHS reactor contained 1.4 x 109-1.2 x 108 cells per mL-cube volume of Nitrosomonas, and 1.8 x 108-0.2 x 108 cells per mL-cube volume of Nitrobacter, respectively. There was no significant difference by DHS reactor height in the ratio of nitrifying bacteria to DAPI-stained total cells; 1.4% for Nitrosomonas and 0.18% for Nitrobacter. In contrast, the MPN method gave far lower estimation by the magnitude of 103 to 104 orders for either of the nitrifying bacteria, than the FISH analysis. Wagner reported that almost no Nitrobacter signal was detected by FISH in several different sources of sludge samples (Wagner et al., 1996), while a significant fraction of Nitrospira-like bacteria was present in an activated sludge sample (Wagner et al., 1998). Some nitrite-oxidizing bacteria other than Nitrobacter are probably present in the DHS reactor. Table 3. Sludge concentration, nitrifying activities and nitrifies cell numbers, based on sponge-cube volume at different locations of DHS reactor height DHS location Number of Sponges Sampled Total Sponge Volume (cm 3) VSS (mg/L in 500mL suspended biomass sample) VSS based on sponge volume (mg/cm 3-cube volume) NH4-0xidizing Activity (mg-N/cm3-cube volume / d )* N02-0xidizing Activity (mg-N/cm3-cube volume / d ).. Probe:Nmn657 (cellslcm 3-cube volume x 107 ) Probe:Ntbl 169 (cellslcm 3.cube volume x 107 ) Per cell Activity of NH4-0xidizer (pmollcelllh) Per cell Activity of NQ2.0xidizer (pmol/cell/h)

Upper

Middle

Lower

3 10.1 1700 84 9.46 4.69 143 18 0.020 0.078

17 57.4 1560 14 0.50 0.44 23 2.8 0.007 0.047

29 97.9 1450 7.4 0.17 0.13 12 1.5 0.004 0.028

"Cell number in the 500mL cell-suspensions in Table2 x 500mL / total sponge volume (em3) Table 3 presents, on the basis of unit sponge-cube volume, sludge concentration, nitrification activities and nitrifier cell concentration. A relatively high nitrification performance of nitrification of the DHS reactor (Table 1) suggests that this reactor configuration is advantageous for maintaining a very long SRT. The DRS unit demonstrated superior capability in retaining biomass. At the upper portion of DHS, very thick and dense biofilms accumulated onto the sponge-cube surfaces, and the total biomass was estimated to be 84000 mg-VSS per litre of sponge-cube volume basis. The cell numbers detected by the probes Nmn657 and Ntb1l69 were well correlated with ammonia-oxidation and nitrite-oxidation activities. This suggested that FISH analysis provides a useful monitoring tool for nitrification processes. Per cell activity of ammonia• oxidizer that was calculated from the cube-volume activity and the FISH cell counting, was well consistent with that of a pure culture of Nitrosomonas reported by Belser (Belser, 1979). On the other hand, per cell nitrite-oxidizing activity was rather higher, compared with those previously reported (Belser, 1979),

Novel blofilrn reaclor employing hanging sponge-cubes impl~ng

bactena.

29

that FISH detection by the probe Ntb1169 covers only a part of the nitrite-oxidation performing

Spatial distribution ofnitritYini bacteria in biofilm Biomass retainment in the DHS reactor took place in two different forms: the one is thick-and-dense biofilm developed onto the sponge-cube surfaces, and the other is deposited or entrapped forms in the interior void• space of the sponge-cubes. FISH of the two probes was applied to thin sections of both forms of the DHS biomass. A relatively small amount of Nitrosomonas (but no Nitrobacter) was observed only until 50 llm• depth from the outer surface of the thick-biofilm, as shown in Fig. 4 (b). This is likely due to no availability of DO at a depth beyond 50 11m. Nitrosomonas cells were mainly located at the outer boundary of biomass aggregates deposited within the interstice voids of cubes. Even though Nitrobacter was detected at much lower concentration, they tended to coexist with Nitrosomonas.

FIgure 4. In SItu IdentIficatIon of Nitrosomonas in the sectIOns ofbiofilrn (a, b) and sludge aggregates entrapped in the rntenor space of the sponge-cubes (c, d) ldenhcal fluorescent miCroSCOPIC fields were VIewed by U-excitahon (a, c) and by G-excltation (b, d) Scale bar, 30 11m.

DO profile measurement Figure 5 shows the results of in situ measurement of DO profiles as a function of DHS reactor height (a), and sponge-cube inward depth (b), on day 170 after the start-up. The DO profile expenment was conducted, using a DO microelectrode as shown in Fig. 6, at two different flow rates, 2.1 and 6.3 mLimin. Although no forced aeration was provided to the DHS reactor, DO level increased from zero at the inlet (the VASH effluent) up to 5 mglL at 50 cm below, as shown in Fig. 5 (a). Figure 5 (b) indicates DO level drops drastically from 5 mg/L at the sponge-cube surface to null at 0.75 cm inward-depth of the sponge-cube. Wastewater migration by gravity through permeation from the anterior cube to the posterior cube functioned well for supply of sufficient DO. Comparison of FISH analysis of thin section between the surface attached biofilm and the interior deposited biomass revealed both nitrifiers prefer, as a habitat, the inside of the sponge cubes rather than densely attached biofilm on the sponge-cube surface. The DHS reactor accomplished simultaneously some extent of denitrification (data not shown). A plausible reason is that an

30

N. ARAKI et al.

anoxic local condition favorable to denitrifiers prevailed deep inside the sponge-cube as well as slightly inside the dense biofilm attached on the surfaces. Inlet

6

(a)

-. 10

ig4 5

!20 a- 30

!4O

g3 0

o 2.1 mVmln (b) 06.3 mVmln

0

u

~50

..

Q

200

0

.

1 2 3 4 5 6 7 DO conc. (mgIL)

0 2 Q

1

B

0

0

0 0

R

0.00 0.25 0.50 0.75 Depth (cm)

Figure 5. (a) DO profiles along DHS reactor height, and (b) mtra-cube DO profiles (from surface to 0.75 cm inward depth of the sponge-cubes) at 50 em downward location ofDHS reactor.

Figure 6. In situ measurement of DO profile with a ffi1croelectrode.

CONCLUSIONS A novel biofilm reactor, named DHS (downflow hanging sponge-cubes) process was employed as an aerobic post-treatment unit after an anaerobic UASB pre-treatment of municipal sewage. The DHS process showed a relatively high nitrification performance. FISH technique revealed Nitrosomonas and Nitrobacter were present at 1.4% and 0.18% of DAPI-stained total cell counts respectively. Cell density of both nitrifying bacteria were well correlated with ammonia-oxidizing and nitrite-oxidizing activities estimated from batch tests. Habitats of both nitrifiers were the interior void space of sponge-cubes, rather than the outer surface of sponge-cubes. A DO microelectrode study verified sufficient availability of DO Inside the sponge-cube. REFERENCES Agrawal, L. K, Ohashi, Y., Mochida, E., OkUI, H., Veki, Y., Harada, H. and Ohashi, A. (1997) Treatment of raw sewage III a temperature climate usmg a VASB reactor and the hangmg sponge cubes process. Wat ScI Tech., 36(6-7), 200-207 Amann, R. I. (1995). In Situ IdentificatIOn of mlcro-orgamsms by whole cell hybndizatlon With rRNA-targeted nucleiC acid probes. Molecular MIcrobial Ecology Manual 3.3.6: 1-15, Kluwer AcademiC PublIshers, The Netherlands. Belser, L. W. (1979). PopulatIOn ecology ofmtrifymg bactena Annual RevIew ofMIcrobIOlogy, 33,309-333. De Beer, D., van den Hheuvel, J. C. and Sweens, J.-P. R. A. (1993). Mlcroelectrode measurements of the activity dlstnbul10n in mtrlfymg bacterial aggregates. Applied and EnVlronmetal MIcrobiology, 15, 601-609 Harada, H., Ohashi, A, Shutubo, S and Yamazaki, S. (1997) Evaluation ofintrablOfilm profiles of substrates and products by use of mlcroelectrodes. Water and Wastewater (m Japanese), 39(8), 53-60.

Novel biofilm reactor employing hangmg sponge-cubes

31

Machdar, I., Harada, H., Ohashi, A., Seklguchl, Y., Okui, H. and Ueki, K. (1997). A novel and cost-effective sewage treatment system consisting of UASB pre-treatment and aerobic post-treatment units for developmg countnes. Waf Sci Tech., 36(2), 189- 197. Raskm, L., Amann, R. I., Poulsen, L. K., RIttmann, B. E. and Stahl, D. A. (1995). Use of ribosomal RNA-based molecular probes for characterization of complex microbial communities in anaerobic biofilms. Waf. Sci. Tech., 31(1), 261-272. Schramm, A., Larsen, L. H., Revsbech, N. P., Ramsing, N. B., Amann, R. and Schleifer, K.-H. (1996) Structure and function ofa nitrifymg biofiIrns as determined by in situ hybridization and the use of microelectrodes. App/. EnViron. MicrobIC!., 62, 4641-4647. Wagner, M., Amann, R., Kampfer, P., Abmus, B., Hartruann, A., Hutzler, P., Spnnger, N. and Schleifer, K.-H. (1994). Identification and in situ detection of gram-negative filamentous bactena In actIVated sludge. SySf App/. MicroblO/., 17, 405-417. Wagner, M., Ratb, G. Koops, H.-P., Flood, 1. and Amann, R. (1996). In situ analysis ofnitnfymg bactena 10 sewage treatment plants. Waf. ScI Tech., 34, 237-244. Wagner, M., Juretscko, S., Koops, H.-P., Pommerening-Roser, A., Schmid, M., Timmermann, G. and Schleifer, K.-H. (1998). Polyphaslc approach to analyze the natural diversity of nitrifying and denitnfymg bactena 10 activated sludge. MicrobIal community and functions 10 Wastewater Treatment Processes, The International SymposIUm of the COE, UniversIty of Tokyo, Japan, 189-192.