Beneficial effects of silicon on photosynthesis of tomato seedlings under water stress

Journal of Integrative Agriculture 2018, 17(10): 2151–2159 Available online at www.sciencedirect.com

ScienceDirect

RESEARCH ARTICLE

Beneficial effects of silicon on photosynthesis of tomato seedlings under water stress ZHANG Yi1*, SHI Yu1*, GONG Hai-jun2, ZHAO Hai-liang1, LI Huan-li2, HU Yan-hong2, WANG Yi-chao2 1 2

College of Horticulture, Shanxi Agricultural University, Taigu 030801, P.R.China College of Horticulture, Northwest A&F University, Yangling 712100, P.R.China

Abstract Silicon can improve drought tolerance of plants, but the mechanism still remains unclear. Previous studies have mainly concentrated on silicon-accumulating plants, whereas less work has been conducted in silicon-excluding plants, such as tomato (Solanum lycopersicum L.). In this study, we investigated the effects of exogenous silicon (2.5 mmol L–1) on the chlorophyll fluorescence and expression of photosynthesis-related genes in tomato seedlings (Zhongza 9) under water stress induced by 10% (w/v) polyethylene glycol (PEG-6000). The results showed that under water stress, the growth of shoot and root was inhibited, and the chlorophyll and carotenoid concentrations were decreased, while silicon addition improved the plant growth and increased the concentrations of chlorophyll and carotenoid. Under water sterss, chlorophyll fluorescence parameters such as PSII maximum photochemical efficiency (Fv/Fm), effective quantum efficiency, actual photochemical quantum efficiency (ФPSII), photosynthetic electron transport rate (ETR), and photochemical quenching coefficient (qP) were decreased; while these changes were reversed in the presence of added silicon. The expressions of some photosynthesis-related genes including PetE, PetF, PsbP, PsbQ, PsbW, and Psb28 were down-regulated under water stress, and exogenous Si could partially up-regulate their expressions. These results suggest that silicon plays a role in the alleviation of water stress by modulating some photosynthesis-related genes and regulating the photochemical process, and thus promoting photosynthesis. Keywords: tomato, water stress, silicon, photosynthesis

1. Introduction

Received 12 March, 2018 Accepted 6 July, 2018 ZHANG Yi, Mobile: +86-18404969601, E-mail: harmony1228 @163.com; Correspondence SHI Yu, Mobile: +86-18235419551, E-mail: [email protected] * These authors contributed equally to this study. © 2018 CAAS. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http:// creativecommons.org/licenses/by-nc-nd/4.0/) doi: 10.1016/S2095-3119(18)62038-6

Silicon is the second most abundant element in the earth’s crust (Debona et al. 2017). Although it is not considered as an essential element for higher plants, it is beneficial for plants, especially when they are subjected to environmental stresses (Al-Aghabary et al. 2005; Sanglard et al. 2014; Adrees et al. 2015; Kleiber et al. 2015; Debona et al. 2017). Drought is one of the major threats to crop production worldwide. Drought affects crop growth and development, leading to decreased crop yield and low quality (Wang et al. 2015, 2017). Silicon addition has been reported that it could

2152

ZHANG Yi et al. Journal of Integrative Agriculture 2018, 17(10): 2151–2159

alleviate drought-induced damage in various plants (Zhu and Gong 2014). Different mechanisms have been proposed for siliconmediated drought tolerance. These include prevention of transpirational water loss (Agarie et al. 1998), activation of plant antioxidant defense system (Gong et al. 2005; Gunes et al. 2008), keeping mineral balance (Kaya et al. 2006), enhancing water uptake by roots (Sonobe et al. 2011; Liu et al. 2014), stimulating osmolyte accumulation (Ming et al. 2012), increasing the activity of photosynthetic enzyme (Gong and Chen 2012) and regulating growth substance levels (Zhu and Gong 2014). However, most of these studies were conducted on silicon-accumulating gramineous plants (Zhu and Gong 2014), and little work has been done on low silicon-accumulating plants. Exploring the function of silicon in low silicon-accumulating plants may help clarify the biochemical mechanism for silicon-mediated drought tolerance. Tomato (Solanum lycopersicum L.), a popular vegetable worldwide, has become a model plant for the genetic and stress tolerance research of Solanaceous crops (Bergougnoux 2014). Most tomato varieties are sensitive to drought stress, especially at early growth stages (Foolad et al. 2003). Tomato accumulates much less silicon when compared to the monocotyledons such as rice and wheat and is classified as silicon excluder (Nikolic et al. 2007). Therefore, tomato may be an ideal plant to study the exact physiological and biochemical mechanism for siliconmediated tolerance to drought stress. In our previous study, we observed that exogenous silicon could increase water stress tolerance by enhancing root hydraulic conductance and decreasing oxidative damage in tomato seedlings (Shi et al. 2016), suggesting the involvement of silicon in physiological and biochemical processes. However, the mechanism for silicon-mediated water stress tolerance in tomato still needs to be explored. Photosynthesis is the basis of plant growth and crop yield. The positive effects of Si on the leaf photosynthesis under drought have been observed in different plants (Zhu and Gong 2014; Etesami and Jeong 2018). However, little is known about the regulatory mechanism of silicon on photosynthesis under drought/ water stress. In this study, we investigated the effects of silicon on the chlorophyll fluorescence and expression of photosynthesis-related genes in tomato seedlings under water stress. The results suggest that silicon plays a role in the alleviation of water stress by increasing the transcriptional rate of some photosynthesis-related genes and regulating the photochemical process, and thus promoting photosynthesis.

2. Materials and methods 2.1. Plant materials and treatment Tomato (Solanum lycopersicum L.) Zhongza 9 was used in this study. Seeds were surface-sterilized in 55°C water bath for 25 min, immersed into distilled water for 6 h, germinated on double-layered wetting filter paper for 2 d in an incubator at 28°C, and then sown in compound substrate (Xintiandi Co., Yangling, Shaanxi, China). At four-leaf stage, uniform seedlings were transplanted into plastic containers, and each container had 12 L of half-strength Hoagland nutrient solution (pH 6.2±0.1) in an environmentally-controlled hydroponic room maintained at 25–30°C during the day, 15–18°C at night, with relative humidity between 65 and 75%. At five-leaf stage, the seedlings were separated into four groups and treated with the following different solutions respectively: (1) CT=1/2 Hoagland nutrient solution without added Si or PEG; (2) Si=1/2 Hoagland nutrient solution with the addition of 2.5 mmol L–1 silicon; (3) PEG=1/2 Hoagland nutrient solution with the addition of 10% (w/v) polyethylene glycol (PEG-6000); and (4) PEG+Si=1/2 Hoagland nutrient solution with the addition of 2.5 mmol L–1 Si and 10% (w/v) PEG-6000. Potassium silicate (K2SiO3·nH2O) was used as the silicon source. The Si concentration (2.5 mmol L–1) was chosen by our preliminary experiment. The introduction of potassium ions due to K2SiO3 addition was subtracted from the total potassium nitrate, and the resultant loss of nitrate ions was supplemented with dilute nitric acid. PEG-6000, which can reduce the water potential of solution and induce tissue dehydration, was utilized to simulate the water deficit stress in this study. The solution pH was adjusted to 6.2 daily.

2.2. Determination of biomass and leaf chlorophyll content After 7 d of water stress, the tomato seedlings were divided into shoots and roots, oven-dried at 75°C for 72 h and the dry weights were recorded. Root morphological traits including total root length, surface area, volume and average diameter were analyzed using the MRS-9600TFU2L Root Scanner (Zhongjing Co., Ltd., Shanghai, China). The chlorophyll content was measured on the second recently fully-expanded leaves after 5 d of water stress. A total of 100 mg of ground leaves were added with 15 mL of 96% alcohol and put in the dark at room temperature with intermittent shaking until fully blenched, after which the volume was adjusted to 25 mL by supplementing 96% alcohol. The absorption values of the extract at

2153

ZHANG Yi et al. Journal of Integrative Agriculture 2018, 17(10): 2151–2159

665, 649 and 470 nm were measured using an ultraviolet spectrophotometry (UV-2450, Shimadzu, Japan). The contents of chlorophyll a, chlorophyll b and carotenoids were calculated according to the formulae of Lichtenthaler and Wellburn (1983).

2.3. Determination of chlorophyll fluorescence parameters After 6 d of water stress, the chlorophyll fluorescence parameters of the second recently fully-expanded leaves were measured using a photosynthesis system (LI-6400; LI-COR, America), according to the method of Zhu et al. (2016). The minimal (Fo) chlorophyll fuorescence in darkadapted leaves, the maximal (Fm) chlorophyll fluorescence, the steady-state fluorescence (Fs), the maximum (Fm´) and minimal (Fo´) fluorescence level in light adapted state, and the photosynthetic electron transport rate (ETR) were recorded automatically by the machine. Then the other fluorescence parameters were calculated with the following formulae: PSII maximum photochemical efficiency Fv/ Fm=(Fm–Fo)/Fm; PSII potential activity Fv/Fo=(Fm–Fo)/Fo; PSII effective quantum efficiency Fv´/Fm´=(Fm´–Fo´)/Fm´; PSII actual photochemical quantum efficiency ФPSII=(Fm´–Fs)/ Fm´; and photochemical quenching coefficient qP=(Fm´–Fs)/ (Fm´–Fo´) .

2.4. Expression analysis of photosynthesis genes After 3 d (72 h) of water stress, the second recently fullyexpanded leaves were collected for total RNA extraction. High-quality RNA samples for each treatment were sent to Shanghai Biotechnology Corporation (Shanghai, China) for cDNA library construction and transcriptome sequencing. Differentially expressed genes were analyzed through enrichment analysis. Based on the results of enrichment

analysis, the main genes related to photosynthesis were selected and further confirmed by qRT-PCR. To identify significantly differentially expressed genes, the criterion of FDR≤0.05 was adopted. In this study, KEGG was used as the main database for the transcriptomics analyses, followed by the steps of genome mapping and differential gene analysis. Based on results of high-throughput sequencing, the differently expressed genes (PEG vs. CT) related to photosynthesis were validated by qRT-PCR. For qRT-PCR analysis, the second recently fully-expanded leaves were sampled, frozen in liquid nitrogen and immediately stored at –80°C until analysis. The sequences of specific primers for tomato leaf photosynthesis genes (PetE, PetF, PsbP, PsbQ, PsbW, and Psb28) are shown in Table 1. Total RNA was extracted from 100 mg of frozen leaf samples by using RNeasy Plant Mini Kit (DP419; TIANGEN, Beijing, China) following the manufacturer’s instructions. The RNA concentration was determined by a UV spectrophotography (NanoDrop 2000; Thermo Scientific, USA) at 230, 260 and 280 nm, and its integrity was checked by running 1% (w/v) agarose gel-electrophoresis. Reverse transcription reactions were carried out on 1 μg total RNA using the PrimeScript™ RT Reagent Kit with gDNA Eraser (TaKaRa, Shiga, Japan) according to the manufacturer’s instructions, including a special step for the removal of remaining genomic DNA. The obtained cDNA was diluted to 100 ng μL–1 with RNase-free and double-distilled water, then 1 μL of cDNA was used for the qRT-PCR using SYBR® Premix Ex Taq™ (TaKaRa Bio, Shiga, Japan). All the above reactions were conducted on a Bio-Rad CFX-96 Real-time PCR System (Bio-Rad, USA). A melting curve analysis was performed to further confirm the lack of multiple products or primer dimers. The final volume of reaction system was 25 μL, which contained 12.5 μL SYBR Premix Ex TaqII (2×), 1.0 μL forward primer (10 μmol L–1), 1.0 μL reverse primer

Table 1 Primers for the photosynthesis-related genes used in qRT-PCR Gene Plastocyanin (PetE)

Locus Solyc04g082010.1

Ferredoxin (PetF)

Solyc03g005190.2

Photosystem II oxygen evolving complex protein (PsbP)

Solyc03g114930.2

Photosystem II reaction center PsbW protein (PsbW)

Solyc06g084050.2

photosystem II oxygen-evolving enhancer protein 3 (PsbQ)

Solyc02g079950.2

Photosystem II reaction center Psb28 protein (Psb28)

Solyc09g064500.2

Actin

XM_004239742

Primer sequence (5´→3´) F: GTTCCCACACAACGTCGTA R: GACAGTAACTTTGCCAACCA F: TTCCTCACTCACAATGGCAAC R: CCAGCTCTGTAGTTTTACCTT F: AAAATTATATCACTCCGTGTC R: GTATCTGAGAAGTCATCAGC F: GGCCCTCCTACATAAGGCATC R: GCCCAGTTCCTTCTGTACTCA F: CGCTTGAGTACTGTTAGCACCA R:AATGGCAAACTGAAGTCCCT F: GATTGTGCCTATCCCGTTC R: ATCAAACCTGAATATAGCCAT F: GATGGTGTCAGCCACAC R: ATTCCAGCAGCTTCCATTCC

Product size (bp) 194 200 240 209 257 185 350

2154

ZHANG Yi et al. Journal of Integrative Agriculture 2018, 17(10): 2151–2159

3. Results

weight was not significantly changed. Compared to water stress treatment alone, the shoot and root dry weights were increased by 50.6 and 77.5% in silicon-added stressed plants (Table 2). In non-stress conditions, silicon addition had no significant effect on the root morphological traits including total root length, surface area, root volume and average root diameter (Table 2). The total root length and surface area were significantly decreased under water stress, while the root total volume and average diameter did not show significant change. Compared with water stress treatment alone, silicon addition increased the total root length and surface area respectively by 53.1 and 54.1% in the waterstressed plants. Silicon addition had no significant effect on the root total volume or average diameter in the stressed plants.

3.1. Plant growth and root morphological traits

3.2. Chlorophyll contents

The shoot and root dry weights were significantly increased by silicon addition in non-stress conditions (Table 2). Under water stress, the shoot dry weight was significantly decreased compared to the control, while the root dry

In non-stress conditions, silicon addition did not change the leaf chlorophyll or carotenoid content of tomato seedlings (Fig. 1). Under water stress, the contents of chlorophyll a, chlorophyll b and carotenoid were all decreased significantly.

(10 μmol L–1), 1.0 μL cDNA, and 9.5 μL of double-distilled water. The reaction conditions were as following: 95.0°C for 5 min, then 40 cycles under 95.0°C for 10 s, 56.0°C for 30 s, and 72.0°C for 20 s. The actin gene from tomato was used as an internal control. Relative transcript abundances of target genes were calculated using the 2–∆∆CT method (Livak and Schmittgen 2001). Each treatment had three replications.

2.5. Statistical analysis Data were analyzed with SAS software (SAS Institute, Cary, NC) using Duncan’s multiple range test at P<0.05 level, the average data were obtained from three repetitions.

Table 2 Effects of silicon on the growth of tomato seedlings grown under water stress Shoot dry (g)

Root dry (g)

2.290±0.493 b 3.071±0.375 a 1.396±0.076 c 2.103±0.386 b

0.219±0.011 b 0.329±0.041 a 0.178±0.018 b 0.316±0.078 a

Treatment1) CT Si PEG PEG+Si

Total root length (cm) 1 890.8±75.2 a 1 974.5±102.3 a 1 033.9±191.6 c 1 583.2±134.9 b

Root morphological trait Total surface area Total root volume (cm3) (cm2) 368.9±11.4 a 14.5±1.0 a 386.0±24.5 a 14.0±3.7 a 210.9±53.4 b 9.7±3.6 a 324.9±19.6 a 14.2±2.6 a

Average root diameter (mm) 0.67±0.06 a 0.68±0.03 a 0.72±0.05 a 0.68±0.07 a

1)

Pigment concentration (mg g–1 DW)

CT, control; Si, silicon; PEG, polyethylene glycol; PEG+Si, polyethylene glycol plus silicon. Data are shown as mean±SD. Within each column followed by the same lowercase letters are not significantly different by the Duncan test at P≤0.05.

A 30

a

Chl a

B

C

Chl b

30

a b

20

20

c a

10

ab

CT

Si

PEG PEG+Si

CT

10

b c

0

Carotenoid

Si PEG PEG+Si Treatment

ab

a

CT

Si

c

b

PEG PEG+Si

0

Fig. 1 Effects of silicon on the chlorophyll contents in the leaves of tomato seedlings under water stress. A, chlorophyll a (Chl a). B, chlorophyll b (Chl b). C, carotenoid. CT, control; Si, silicon; PEG, polyethylene glycol; PEG+Si, polyethylene glycol plus silicon. Data are shown as mean±SD of three replicates. Bars with different letters mean significant difference at P<0.05.

2155

ZHANG Yi et al. Journal of Integrative Agriculture 2018, 17(10): 2151–2159

Compared with water stress alone, added Si increased the

redistribution in PSII reaction center and improved the leaf

chlorophyll a, chlorophyll b and carotenoid contents by 26.7,

photochemical activities of water-stressed plants.

57.0 and 54.0%, respectively (Fig. 1). The results indicated

3.4. Expression of photosynthesis-related genes

that exogenous silicon alleviated water stress-induced chlorophyll degradation.

High-throughput sequencing result showed that many of the

3.3. Plant chlorophyll fluorescence parameters

photosynthesis-related genes were down-regulated under water stress, shown in green boxes, while two genes were

In non-stress conditions, silicon addition had no significant

up-regulated in photosynthesis process by water stress,

effect on the leaf chlorophyll fluorescence parameters of

shown in red boxes (Appendix A). Using qRT-PCR, we

tomato seedlings (Fig. 2-A–F). Under water stress, Fv/Fo,

analyze the expressions of some of the photosynthesis-

(Fig. 2-A), Fv/Fm (Fig. 2-B), Fv´/Fm´ (Fig. 2-C), ФPSII (Fig. 2-D),

related genes over the stress period. As shown in Fig. 3,

ETR (Fig. 2-E) and q P (Fig. 2-F) were all decreased.

the relative expressions of PetE, PetF, PsbP, PsbQ, PsbW,

Compared with water stress treatment alone, added silicon

and Psb28 were gradually down-regulated with the water

significantly increased the parameters (Fig. 2-A–F). These

stress progressing, while exogenous silicon could partially

results indicate that silicon addition enhanced the energy

inhibit the down-regulation.

B a

0.82 a

a

a a

b

3.5

b

0.78

3.0

0.76

2.5 2.0

C

Fv´/Fm´

0.8

0.74 0.30

D a

a

a

0.6

c

b

0.20 b c

0.2 0 100 ETR

0.25

a

0.4

120

0.80

0.15 0.10 0.05

E

F

a

0 0.4

a a

a

0.3

80 60

c

b

40

b

c

0.1

20 0

CT

Si

0.2

qP

Fv/Fo

4.0

a

Fv/Fm

A

ФPSII

4.5

PEG PEG+Si

CT

Si

PEG PEG+Si

0

Treatment

Fig. 2 Effects of silicon on chlorophyll fluorescence parameters of tomato seedlings grown under water stress. A, PSII potential activity (Fv/Fo). B, PSII maximum photochemical efficiency (Fv/Fm). C, PSII effective quantum efficiency (Fv´/Fm´). D, PSII actual photochemical quantum efficiency (ФPSII). E, photosynthetic electron transport rate (ETR). F, photochemical quenching coefficient (qP). CT, control; Si, silicon; PEG, polyethylene glycol; PEG+Si, polyethylene glycol plus silicon. Data are shown as mean±SD of three replicates. Bars with different letters mean significant difference at P<0.05.

2156

ZHANG Yi et al. Journal of Integrative Agriculture 2018, 17(10): 2151–2159

1.5 a 1.0

a aa

ab a

b

a

aa

c b

b

b c

Relative expression

a

a ab

1.0

1.5 1.0

c

a

1.0

a

E

ab b

b

a a ab bc c

a

c

a

a

b

.5

a

a

b

1.0

b c

a

b

b b

b

b

a

a

1.5

a

a bb

b

a 1.0

b b

b

a

a

a

.5 0 2.0

Psb28

a

c

a

c

a

c

a

ab b

F

a

c

0.5

c

b

0 2.0

c

a a

a

a

b

PsbW

a

c

PsbQ

aba

aa

a b

b

1.5

a

c

a

b

1.5

a

a

d

D

a

c

a

a

b

b

0.5

ab

b

PsbP

aa a

0 2.0 Relative expression

C

1.5

aa

a

b

.5 0 2.0

a a a a

aa

a

2.0

PetF

Relative expression

B

PetE

Relative expression

A

c

b

b

0.5

Relative expression

Relative expression

2.0

PEG+Si

PEG

Si

CT

c

0

0 8h

1d

3d

5d

7d 8h Stress duration

1d

3d

5d

7d

Fig. 3 Effects of silicon on the relative transcript levels of photosynthesis-related genes in the leaves of tomato seedlings under water stress. A, plastocyanin gene PetE. B, ferredoxin gene PetF. C, photosystem II oxygen evolving complex protein gene PsbP. D, photosystem II oxygen evolving complex protein gene PsbQ. E, photosystem II reaction center psbW protein gene PsbW. F, photosystem II reaction center psb28 protein gene Psb28. CT, control; Si, silicon; PEG, polyethylene glycol; PEG+Si, polyethylene glycol plus silicon. Data are shown as mean±SD. Means followed by the same letters are not significantly different between treatments at P<0.05.

4. Discussion

non-silicon accumulators, such as tomato. In our previous

Water resource shortage has become one of the most

stress tolerance in tomato (Shi et al. 2016). In this study,

study, we observed a positive effect of silicon on water

serious problems in many areas of the world (Yang et al.

added silicon significantly increased the biomass of tomato

2010). Drought adversely affects crop survival, growth

seedlings under waters stress (Table 2), which is consistent

and yield (Balakhnina and Borkowska 2013). As an

with the previous observation (Shi et al. 2016). These

agriculturally beneficial element, silicon has been found to

results indicate that silicon can also improve the drought

improve drought tolerance of plants (Zhu and Gong 2014).

tolerance of non-silicon-accumulating plants. The results

However, the majority of these studies have been conducted

also suggest that silicon fertilizer may be applied in tomato

on silicon accumulators, while less work has been done in

production in arid areas.

ZHANG Yi et al. Journal of Integrative Agriculture 2018, 17(10): 2151–2159

Root is the main alimentative organ for water and nutrient uptake in plants, and its morphological features can be used to evaluate stress tolerance of plants (Chen et al. 2011). In this study, compared with the control, the total root length and surface area were notably decreased under water stress, while they were significantly increased in the presence of added silicon (Table 2). The increased root length and surface area might have contributed to the increased water uptake and thus improved water status under water stress, as observed in our previous study (Shi et al. 2016). As the physiological basis of biomass formation, photosynthesis provides raw material and energy for the growth and development of plants, and more than 90% of shoot dry matter is transformed from photosynthesis (Wang et al. 2010). However, adverse environmental conditions affect photosynthetic performance. Chlorophyll fluorescence can be used to monitor photosynthetic performance in plants. In this study, the chlorophyll fluorescence parameter Fv/Fm in tomato was significantly decreased under drought, and it was significantly increased in the presence of added silicon, indicating an improved photochemical efficiency. Similar result has also been observed in rice - a silicon accumulator under drought (Chen et al. 2011). In this work, added silicon also increased Fv´/Fm´ in drought stressed plants (Fig. 2-C), suggesting that the efficiency of excitation energy captured by open PSII centers was increased, while the part of excitation energy (dissipation as heat) in the PSII antennae was relatively decreased. The photochemical quenching coefficient (qP, Fig. 2-F) was significantly increased by silicon addition in drought-stressed tomato (Table 3). This suggests that more PSII reaction centers were open in silicon-applied plants, which might allow more excitation energy to be used for electron transport under drought (Zhu et al. 2016). ΦPSII is proportional to electron transport rate (Kalaji et al. 2017). In this study, silicon-mediated increase in ΦPSII (Fig. 2-D) and ETR (Fig. 2-E) under drought suggests an improved capacity to convert photon energy into chemical energy. All these results suggest that silicon addition could decrease drought-induced damages to the PSII, and thus maintaining the dry matter production under drought. Chlorophyll is the main pigment for carrying out photosynthesis in plants, involving in the process of light energy absorption, transfer, distribution and transformation (Biswal et al. 2012). Under environmental stresses, the reason of decrease in PSII photochemical efficiency under drought may be related to reduction of chlorophyll content (Song et al. 2014). In this study, drought-induced decrease of chlorophyll contents was significantly alleviated by added silicon (Fig. 1), which might contribute to the improved

2157

photochemical efficiency in tomato leaves under drought (Table 3). Silicon-mediated increase of chlorophyll content under drought might be associated with the improved antioxidant defense and decreased oxidative damage by added silicon, as observed in our previous study (Shi et al. 2016). The beneficial effects of silicon on the photosynthesis under drought have been observed in different plants (Zhu and Gong 2014; Etesami and Jeong 2018), while the regulatory mechanism still remains unknown. To investigate the regulatory mechanism of silicon on the photosynthesis under drought stress, we analyzed the differentially expressed genes among the four treatments (CT, Si, PEG and PEG+Si) after 3 d of treatment by using high-throughout transcriptome sequencing, then we analyzed the time-course expression changes of key genes related photosynthesis. According to KEGG enrichment analysis, most of the photosynthesis-related genes were down-regulated under water stress (Fig. 2). Then we used qRT-PCR and analyzed the time-course expression changes of some of these genes, including plastocyanin gene PetE (Solyc04g082010.1)), ferredoxin gene PetF (Solyc03g005190.2), photosystem II oxygen evolving complex protein gene PsbP (Solyc03g114930.2) and PsbQ (Solyc02g079950.2), and photosystem II reaction center protein gene PsbW (Solyc06g084050.2) and Psb28 (Solyc09g064500.2). The results showed that added silicon significantly increased the expressions of these genes under water stress (Fig. 3). Plastocyanin (Pc) and ferredoxin (Fd) function in transferring electrons, and usually considered as principal components of the photosynthetic electron transport chain (Sun and Yang 2012). PsbP, PsbW, PsbQ and Psb28 are important subunits of PSII pigment-protein complexes, and are closely associated with water-splitting in light-dependent reactions. Therefore, silicon-mediated enhancement of expressions of these gene might have contributed to the increased electron transport rate and photochemical efficiency, as observed in this study (Fig. 2).

5. Conclusion Our results showed that silicon could increase the chlorophyll content and expression of some photosynthesisrelated genes, regulate the photochemical process and thus promote photosynthesis of tomato seedlings. The beneficial effect of silicon in tomato - a non-siliconaccumulator, suggests a possible involvement of silicon in the physiological and/or biochemical process, rather than physical barrier as suggested in silicon accumulators. The results also suggest that silicon fertilizer may be applied in tomato production in arid areas.

2158

ZHANG Yi et al. Journal of Integrative Agriculture 2018, 17(10): 2151–2159

Acknowledgements The study was funded by the National Natural Science Foundation of China (31501750, 31501807, 31471866, 31772290). Appendix associated with this paper can be available on http://www.ChinaAgriSci.com/V2/En/appendix.htm

References Adrees M, Ali S, Rizwan M, Zia-Ur-Rehman M, Ibrahim M, Abbas F, Farid M, Qayyum M F, Irshad M K. 2015. Mechanisms of silicon-mediated alleviation of heavy metal toxicity in plants: A review. Ecotoxicology and Environmental Safety, 119, 186–197. Agarie S, Uchida H, Agata W, Kubota F, Kaufman P B. 1998. Effects of silicon on transpiration and leaf conductance in rice plants (Oryza sativa L.). Plant Production Science, 1, 89–95. Al-aghabary K, Zhu Z J, Shi Q H. 2005. Influence of silicon supply on chlorophyll content, chlorophyll fluorescence, and antioxidative enzyme activities in tomato plants under salt stress. Journal of Plant Nutrition, 27, 2101–2115. Balakhnina T, Borkowska A. 2013. Effects of silicon on plant resistance to environmental stresses: Review. International Agrophysics, 27, 225–232. Bergougnoux V. 2014. The history of tomato: From domestication to biopharming. Biotechnology Advances, 32, 170–189. Biswal A K, Pattanayak G K, Pandey S S, Leelavathi S, Reddy V S, Tripathy B C. 2012. Light intensity-dependent modulation of chlorophyll b biosynthesis and photosynthesis by overexpression of chlorophyllide a oxygenase in tobacco. Plant Physiology, 159, 433–449. Chen W, Yao X Q, Cai K Z, Chen J. 2011. Silicon alleviates drought stress of rice plants by improving plant water status, photosynthesis and mineral nutrient absorption. Biological Trace Element Research, 142, 67–76. Debona D, Rodrigues F A, Datnoff L E. 2017. Silicon’s role in abiotic and biotic plant stresses. Annual Review of Phytopathology, 55, 85–107. Etesami H, Jeong B R. 2018. Silicon (Si): Review and future prospects on the action mechanisms in alleviating biotic and abiotic stresses in plants. Ecotoxicology and Environmental Safety, 147, 881–896. Foolad M R, Zhang L P, Subbiah P. 2003. Genetics of drought tolerance during seed germination in tomatoes: Inheritance and QTL mapping. Genome, 46, 536–545. Gong H J, Chen K M. 2012. The regulatory role of silicon on water relations, photosynthetic gas exchange, and carboxylation activities of wheat leaves in field drought conditions. Acta Physiologiae Plantarum, 34, 1589–1594. Gong H J, Zhu X Y, Chen K M, Wang S M, Zhang C L. 2005. Silicon alleviates oxidative damage of wheat plants in pots under drought. Plant Science, 169, 313–321.

Gunes A, Pilbeam D J, Inal A, Coban S. 2008. Influence of silicon on sunflower cultivars under drought stress, I: growth, antioxidant mechanisms, and lipid peroxidation. Communications in Soil Science and Plant Analysis, 39, 1885–1903. Kalaji hm, Schansker G, Brestic M, Bussotti F, Calatayud A, Ferroni L, Goltsev V, Guidi L, Jajoo A, Li P, Losciale P, Mishra V K, Misra A N, Nebauer S G, Pancaldi S, Penella C, Pollastrini M, Suresh K, Tambussi E, Yanniccari M, et al. 2017. Frequently asked questions about chlorophyll fluorescence, the sequel. Photosynthesis Research, 132, 13–66. Kaya C, Tuna L, Higgs D. 2006. Effect of silicon on plant growth and mineral nutrition of maize grown under water-stress conditions. Journal of Plant Nutrition, 29, 1469–1480. Kleiber T, Calomme M, Borowiak K. 2015. The effect of cholinestabilized orthosilicic acid on microelements and silicon concentration, photosynthesis activity and yield of tomato grown under Mn stress. Plant Physiology and Biochemistry, 96, 180–188. Lichtenthaler H K, Wellburn A R. 1983. Determinations of total carotenoids and chlorophylls a and b of leaf extracts in different solvents. Biochemical Society Transactions, 11, 591–592. Liu P, Yin L, Deng X, Wang S, Tanaka K, Zhang S. 2014. Aquaporin-mediated increase in root hydraulic conductance is involved in silicon-induced improved root water uptake under osmotic stress in Sorghum bicolor L. Journal of Experimental Botany, 65, 4747–4756. Livak K J, Schmittgen T D. 2001. Analysis of relative gene expression data using real time quantitative PCR and the

2–∆∆CT method. Methods, 25, 402–408. Ming D F, Pei Z F, Naeem M S, Gong H J, Zhou W J. 2012. Silicon alleviates PEG-induced water-deficit stress in upland rice seedlings by enhancing osmotic adjustment. Journal of Agronomy and Crop Science, 198, 14–26. Nikolic M, Nikolic N, Liang Y C, Kirkby E A, Römheld V. 2007. Germanium-68 as an adequate tracer for silicon transport in plants. Characterization of silicon uptake in different crop species. Plant Physiology, 143, 495–503. Sanglard L M, Martins S C, Detmann K C, Silva P E, Lavinsky A O, Silva M M, Detmann E, Araújo W L, DaMatta F M. 2014. Silicon nutrition alleviates the negative impacts of arsenic on the photosynthetic apparatus of rice leaves: An analysis of the key limitations of photosynthesis. Physiologia Plantarum, 152, 355–366. Shi Y, Zhang Y, Han W H, Feng R, Hu Y H, Guo J, Gong H J. 2016. Silicon enhances water stress tolerance by improving root hydraulic conductance in Solanum lycopersicum L. Frontiers in Plant Science, 7, 196. Song A, Li P, Fan F, Li Z, Liang Y. 2014. The effect of silicon on photosynthesis and expression of its relevant genes in rice (Oryza sativa L.) under high-zinc stress. PLoS ONE, 9, e113782. Sonobe K, Hattori T, An P, Tsuji W, Eneji A E, Kobayashi S, Inanaga S. 2011. Effect of silicon application on sorghum

ZHANG Yi et al. Journal of Integrative Agriculture 2018, 17(10): 2151–2159

root responses to water stress. Journal of Plant Nutrition, 34, 71–82. Sun R X, Yang C H. 2012. Structure and function of photosystem II and the environmental response of photosynthetic membrane. Acta Biophysica Sinica, 28, 537–548. (in Chinese) Wang Y, Cai S, Yin L, Shi K, Xia X, Zhou Y, Yu J, Zhou J. 2015. Tomato HsfA1a plays a critical role in plant drought tolerance by activating ATG genes and inducing autophagy. Autophagy, 11, 2033–2047. Wang Y, Zhou J, Yu J. 2017. The critical role of autophagy in plant responses to abiotic stresses. Frontiers of Agricultural Science and Engineering, 4, 28–36. Wang Y H, Han Z M, Han M, Yang L M. 2010. Effects of shading

2159

on the growth and photosynthetic characteristics of Clematis manshurica Rupr. Acta Ecologica Sinica, 30, 6762–6770. (in Chinese) Yang S, Vanderbeld B, Wan J, Huang Y. 2010. Narrowing down the targets: towards successful genetic engineering of drought-tolerant crops. Molecular Plant, 3, 469–490. Zhu Y X, Gong H J. 2014. Beneficial effects of silicon on salt and drought tolerance in plants. Agronomy for Sustainable Development, 34, 455–472. Zhu Y X, Guo J, Feng R, Jia J H, Han W H, Gong H J. 2016. The regulatory role of silicon on carbohydrate metabolism in Cucumis sativus L. under salt stress. Plant and Soil, 406, 231–249.

Section editor LIANG Yong-ch ao Managing editor SUN Lu-juan