- Email: [email protected]
Bias in topoisomerase (TOPO)-cloning of multitemplate PCR products using locked nucleic acid (LNA)-substituted primers
Journal of Microbiological Methods 91 (2012) 483–486
Contents lists available at SciVerse ScienceDirect
Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth
Note
Bias in topoisomerase (TOPO)-cloning of multitemplate PCR products using locked nucleic acid (LNA)-substituted primers Yuan Liu, Jessica Döring, Thomas Hurek ⁎ University of Bremen, Department of Microbe–Plant Interactions, CBIB (Center for Biomolecular Interactions Bremen), 28359 Bremen, Germany
a r t i c l e
i n f o
Article history: Received 5 September 2012 Received in revised form 5 October 2012 Accepted 6 October 2012 Available online 12 October 2012
a b s t r a c t Locked nucleic acid (LNA) modifications help to improve nucleic acid recognition in molecular biology applications. We report that LNA-substituted primers in PCR reactions may cause considerable cloning bias when the widely used topoisomerase-based ligation is used for cloning of multitemplate PCR products. © 2012 Elsevier B.V. All rights reserved.
Keywords: Cloning bias LNA PCR TOPO
Locked nucleic acids (LNAs), first described by Singh et al. (1998), are RNA derivatives with a methylene linkage between the ribose 2′oxygen and the 4′-carbon. The incorporation of LNA into oligonucleotide primers has been shown to increase template binding strength and specificity of DNA amplification in polymerase chain reactions (PCR) (Ballantyne et al., 2008), which offers a promising strategy to improve PCR detection (Burbano et al., 2010; Burbano et al., 2011; Rupp et al., 2006) and quantification (Rupp et al., 2006; Ugozzoli et al., 2004). Owing to favourable properties such as improved hybridization behaviour and efficient mismatch discrimination (Petersen and Wengel, 2003) LNA is also widely used in other molecular biology applications, including single nucleotide polymorphism (SNP) (Rupp et al., 2006) and microarray analysis (Briones and Moreno, 2012; Wang et al., 2011), fluorescence in-situ hybridization (FISH) (Robertson et al., 2010; Robertson and Vora, 2012), antisense (Wahlestedt et al., 2000) and anti-gene (Zaghloul et al., 2011) approaches. Azoarcus sp. BH72 is a diazotrophic betaproteobacterium with an endophytic and non-pathogenic lifestyle, which can supply nitrogen derived from N2-fixation to Kallar grass (Leptochloa fusca, L. Kunth), where it was isolated from (Reinhold-Hurek and Hurek, 2011). It can reach high densities in roots of field-grown, non-diseased host plants and become the most actively nitrogen-fixing bacterium there (Reinhold-Hurek and Hurek, 2011). The identification of bacteria with this lifestyle in planta is
⁎ Corresponding author. Tel.: +49 421 218 62868; fax: +49 421 218 62873. E-mail address: [email protected] (T. Hurek). 0167-7012/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.mimet.2012.10.002
methodologically challenging (Burbano et al., 2011). For this purpose nifH, the gene for the Fe protein in the evolutionary conserved nitrogenase protein complex, is commonly used as a marker. To achieve a high coverage of nifH genes, approaches are usually based on PCR-reactions with degenerate primers which suffer from low sensitivity and efficiency. Under these circumstances the use of LNA-substituted primers can drastically improve PCR detection (Burbano et al., 2010). We accidentally observed that nifH PCR products with the sequence of Azoarcus sp. BH72 could almost not be cloned by TOPO TA (Invitrogen) when amplicons were obtained with LNA-substituted degenerate primers, although they could be cloned using T4 DNA ligase (unpublished data). Here we show that LNA substitution of primers used in PCR reactions with Taq DNA polymerase may unexpectedly lead to blunt-end PCR products, which are not suitable for topoisomerase-cloning using the TA approach. We also show that cloning into a blunt-end TOPO vector may cause preferential ligation of multitemplate PCR products in a sequence-dependent manner, when primers are substituted with LNA bases. The widely used TOPO TA cloning relies on the efficient topoisomerase ligation of PCR products with vector DNA with the help of single-base 3′ overhangs added to PCR products by the template-independent transferase activity of Taq DNA polymerase (Clark, 1988). In order to investigate whether Taq DNA polymerase can add a single deoxynucleotide to the 3′-ends of PCR products obtained with LNA-substituted primers, a ligation to a single-stranded DNA adaptor was carried out. This adaptor (Table 1) was 5′-phosphorylated and modified by a 3′-ddC (dideoxycytidine) to permit ligation only to the free 3′-ends of PCR products. The genomic DNA from Azoarcus sp. BH72 was used as template for PCR reactions with degenerate nifH-specific LNA- or DNA-Zehr primers, developed by Zehr and McReynolds (1989). Ligation reactions were done in 20 μl, containing 1×ligase buffer, 20 pmol adaptor, approx. 1 pmol purified
484
Y. Liu et al. / Journal of Microbiological Methods 91 (2012) 483–486
Table 1 Oligonucleotide sequences. Namea
Sequence (5′–3′)b
Reference
DNA-Zehr-F LNA-Zehr-F DNA-NW-F LNA-NW-F DNA-Zehr-R LNA-Zehr-R DNA-AR-R LNA-AR-R DNA-BHNW-R LNA-BHNW-R KP2S Adapter
TGYGAYCCNAARGCNGA TGYGAYCCNAARGCNGA TGTGATCCGAAGGCAGA TGTGATCCGAAGGCAGA ADNGCCATCATYTCNCC ADNGCCATCATYTCNCC AGAGCCATCATTTCGCC AGAGCCATCATTTCGCC ATGGCCATCATTTCGCC ATGGCCATCATTTCGCC TCGCGACCGTAGTCC GGACTACGGTCGCGATGGCACGATACGCAGCATCACAAGAACT
Zehr and McReynolds (1989) Burbano et al. (2010) This study This study Zehr and McReynolds (1989) Burbano et al. (2010) This study This study This study This study This study This study
a The primer pair DNA-Zehr-F and DNA-Zehr-R (or LNA-Zehr-F and LNA-Zehr-R) was used for broad-range amplification of nifH. For all other primer pairs pA72, carrying the partial nifH gene fragment from Azoarcus sp. BH72 and pRW3, carrying the partial nifH gene fragment from Rhizobium rosettiformans W3 were used as targets. b LNA bases are depicted in boldface and are underlined.
PCR product, 10 μl 50% polyethylene glycerol (PEG) 4000 and 10 U T4 RNA ligase I (New England Biolabs, Frankfurt am Main, Germany). Ligation was carried out at 22 °C for 1 h. To obtain the sequence information at the 3′-termini of the PCR products, 1.0 μl of the ligation mixture was used as template for PCR reactions with primer KP2S (Table 1), which anneals to the adaptor. Subsequently, PCR products were cloned into the pCR2.1-TOPO TA cloning vector (Invitrogen, Darmstadt, Germany) and analysed with M13 forward and reverse primers by Sanger sequencing (LGC Genomics, Berlin, Germany). Sequencing of at least 2 random clones each showed that 3′ overhangs were only formed when DNA primers were used, while in the case of LNA-substituted primers the overhangs were completely missing (Fig. 1). The topoisomerase-mediated ligation can still have a high efficiency, when the PCR product contains a 3′ G, T or C overhang (Cheng and Shuman, 2000) which does not perfectly match to the 3′ T overhang of the vector. However, when the blunt-end PCR product is cloned into the pCR2.1-TOPO TA vector, the covalent intermediate between PCR product and vector is not formed since the 3′ overhang is missing from the PCR product, leading to lower ligation and consequently lower cloning efficiency. Probably, LNA nucleotides affect the terminal transferase activity of Taq DNA polymerase. It was reported that positioning of LNA nucleotides at or near the 3′ terminus of a primer can significantly affect polymerase-mediated extension (Di Giusto and King, 2004; Latorra et al., 2003). LNA nucleotides in double stranded DNA cause a conversion from the B into an A-like conformation (Petersen and Wengel, 2003) and inhibit PCR extension when located at the 3′ end of the primer (Latorra et al., 2003). Hereby, a larger conformational change is caused by the penultimate LNA than by a terminal LNA-substituted base, leading to active side deformation of the polymerase and reduction of the polymerization rate (Di Giusto and King, 2004). The inhibition of a single-base addition to 3′ ends by Taq DNA polymerase may be explained likewise. Before single base 3′-overhangs are formed in a non-template-dependent manner, blunt-end PCR products are dissociated from the polymerase after the completion of template-dependent synthesis. Subsequently the polymerase reassociates with the bluntend substrate to perform the non-templated synthesis (Clark, 1988). Probably, not only the template-dependent polymerase activity but also the non-template-dependent terminal transferase activity of the Taq DNA polymerase is sensitive to A-like conformations of duplex DNA, leaving blunt ends. To study the effect of 5′-LNA substitution of PCR products on TOPO cloning efficiency, two plasmids, pA72 and pRW3 were constructed with the TOPO TA vector, carrying a partial nifH gene fragment from Azoarcus sp. BH72 and from Rhizobium rosettiformans W3 (Burbano et al., 2011), respectively. Both nifH fragments had been obtained by PCR using LNA-substituted Zehr forward and reverse primers (Table 1). We chose to analyse nifH fragments from these two organisms since
preliminary experiments had shown that the TOPO TA cloning efficiency of the nifH fragment from Azoarcus sp. BH72 genomic DNA was drastically lower than the one from pRW3 (data not presented). This observation could not be explained alone by our finding that PCR products amplified with LNA-substituted primers had no 3′ overhang (Fig. 1), since the cloning efficiency of blunt-end PCR products in comparison to PCR products with a 3′-end has been shown to decrease only by 20% when the TOPO TA vector is used (Geng et al., 2006). Sequence comparisons revealed that target regions for the Zehr forward primer in both plasmids and in Azoarcus sp. BH72 genomic DNA were identical. However, the target region of the LNA-Zehr reverse primer in Azoarcus sp. BH72 genomic DNA and in the two plasmids differed from each other by two nucleotides. These observations suggested that the sequence composition in the primer target region of the LNA-Zehr reverse primer was responsible for the reduction of the cloning efficiency. To prove this hypothesis, two non-degenerate LNA reverse primers, BHNW-R (targeting Azoarcus sp. BH72 genomic DNA) and AR-R (targeting plasmids pA72 and pRW3) were designed which differed from each other by these two nucleotides (Table 1). Plasmids pA72 and pRW3 were used as templates to generate PCR products with the two non-degenerate LNA primer sets, NW-F+AR-R and NW-F+BHNW-R (Table 1). Since PCR products obtained with LNA-substituted primers had no 3′ overhang (Fig. 1), the Pfu DNA polymerase (Fermentas, St. Leon-Rot, Germany) and TOPO ZeroBlunt kit (Invitrogen, Darmstadt, Germany) were used for cloning. The results (Table 2) clearly showed that the sequence within the LNA-substituted BHNW-R primer was responsible for the drastic reduction of the cloning efficiency. This effect was independent from the internal sequences of pA72 and pRW3 which had a nucleotide sequence identity of 78% in an alignment consisting of 328 positions (excluding the primer target regions). When this experiment was repeated twice with DNA primers, cloning efficiencies>80% were obtained for all four types of PCR products. Our data show that LNA substitutions near the 5′-end of the PCR product may drastically affect TOPO cloning efficiency. This effect probably arises from disrupting base stacking interactions required for topoisomerase-mediated ligation. Shuman (1992) showed that dsDNA containing one covalently topoisomerase-activated terminus could ligate to a blunt-end duplex DNA, regardless of the sequence of the acceptor molecule. However, Tian et al. (2004) suggested that continuous base stacking of the acceptor DNA strands is very important for topoisomerase-catalysed ligation. Since LNA modifications in duplex DNA might cause discontinuous base stacking compared to native DNA duplexes (You et al., 2006), LNA base substitution may prevent the ligation catalysed by topoisomerase. In this study, the combination of LNA-T, LNA-C, and LNA-A nucleotides in primer LNA-BHNW-R (Table 1) prevented ligation, whereas the combination of LNA-G, LNA-C, and LNA-A nucleotides in primer LNA-AR-R (Table 1) had no
Y. Liu et al. / Journal of Microbiological Methods 91 (2012) 483–486
485
A
B
C
D Fig. 1. Representative DNA sequence chromatograms showing presence (A, B) or absence (C, D) of single-base 3′ overhangs in Taq-amplicons obtained with DNA (A, B) primers or LNA-modified primers (C, D). Genomic DNA of Azoarcus sp. BH72 was used as template. LNA bases are headed by arrows.
effect (Table 2). This may be related to the higher base-pairing stability of LNA-T than LNA-G (McTigue et al., 2004) which would increase discontinuous base stacking. Accordingly, a less efficient ligation would result in a lower cloning efficiency.
In conclusion, our results showed that the use of LNA-substituted primers in PCR may cause preferential ligation of multitemplate PCR products and may inhibit TA-cloning by decreased formation of 3′-overhangs in PCR reactions with Taq DNA polymerase. The
486
Y. Liu et al. / Journal of Microbiological Methods 91 (2012) 483–486
Table 2 The effect of sequence composition within LNA-substituted primers on TOPO cloning efficiency of four different PCR fragments. Template
pA72d pRW3 a b c d
d
Primer pair
LNA-NW-F + LNA-AR-R LNA-NW-F + LNA-BHNW-R LNA-NW-F + LNA-AR-R LNA-NW-F + LNA-BHNW-R
Replication 1a
Replication 2a
Replication 3a
Tested
Positive
Tested
Positive
Tested
Positive
50 10 50 13
40 0 40 2
50 6 50 5
45 0 42 0
NDc ND 50 6
ND ND 35 0
Cloning efficiencyb (%)
P value (t test result)
85 ± 5 0 78 ± 4 5±5
0.0034 0.0004
Tested, colonies selected from the plate; positive, inserts with appropriate size. Cloning efficiency, the percentage of positive clones among the clones tested. ND, not determined. For explanation see Table 1.
resulting bias will have to be taken into consideration particularly when diverse amplicons or microbial communities are studied by PCR-based cloning approaches. Acknowledgement This work was supported by grant Hu 579/7-1 from the Deutsche Forschungsgemeinschaft. References Ballantyne, K.N., van Oorschot, R.A., Mitchell, R.J., 2008. Locked nucleic acids in PCR primers increase sensitivity and performance. Genomics 91, 301–305. Briones, C., Moreno, M., 2012. Applications of peptide nucleic acids (PNAs) and locked nucleic acids (LNAs) in biosensor development. Anal. Bioanal. Chem. 402, 3071–3089. Burbano, C.S., Reinhold-Hurek, B., Hurek, T., 2010. LNA-substituted degenerate primers improve detection of nitrogenase gene transcription in environmental samples. Environ. Microbiol. Rep. 2, 251–257. Burbano, C.S., Liu, Y., Rösner, K., Reis, V., Caballero-Mellado, J., Reinhold-Hurek, B., Hurek, T., 2011. Predominant nifH transcript phylotypes related to Rhizobium rosettiformans in field grown sugarcane plants and in Norway spruce. Environ. Microbiol. Rep. 3, 383–389. Cheng, C., Shuman, S., 2000. DNA strand transfer catalyzed by vaccinia topoisomerase: ligation of DNAs containing a 3′ mononucleotide overhang. Nucleic Acids Res. 28, 1893–1898. Clark, J.M., 1988. Novel non-templated nucleotide addition reactions catalyzed by procaryotic and eucaryotic DNA polymerases. Nucleic Acids Res. 16, 9677–9686. Di Giusto, D.A., King, G.C., 2004. Strong positional preference in the interaction of LNA oligonucleotides with DNA polymerase and proofreading exonuclease activities: implications for genotyping assays. Nucleic Acids Res. 32, e32. Geng, L., Xin, W., Huang, D.W., Feng, G., 2006. A universal cloning vector using vaccinia topoisomerase I. Mol. Biotechnol. 33, 23–28. Latorra, D., Arar, K., Hurley, J.M., 2003. Design considerations and effects of LNA in PCR primers. Mol. Cell. Probes 17, 253–259. McTigue, P.M., Peterson, R.J., Kahn, J.D., 2004. Sequence-dependent thermodynamic parameters for locked nucleic acid (LNA)-DNA duplex formation. Biochemistry 43, 5388–5405.
Petersen, M., Wengel, J., 2003. LNA: a versatile tool for therapeutics and genomics. Trends Biotechnol. 21, 74–81. Reinhold-Hurek, B., Hurek, T., 2011. Living inside plants: bacterial endophytes. Curr. Opin. Plant Biol. 14, 435–443. Robertson, K.L., Vora, G.J., 2012. Locked nucleic acid and flow cytometry-fluorescence in situ hybridization for the detection of bacterial small noncoding RNAs. Appl. Environ. Microbiol. 78, 14 http://dx.doi.org/10.1128/AEM.06399-11. Robertson, K.L., Verhoeven, A.B., Thach, D.C., Chang, E.L., 2010. Monitoring viral RNA in infected cells with LNA flow-FISH. RNA 16, 1679–1685. Rupp, J., Solbach, W., Gieffers, J., 2006. Single-nucleotide-polymorphism-specific PCR for quantification and discrimination of Chlamydia pneumoniae genotypes by use of a “locked” nucleic acid. Appl. Environ. Microbiol. 72, 3785–3787. Shuman, S., 1992. DNA strand transfer reactions catalyzed by vaccinia topoisomerase I. J. Biol. Chem. 267, 8620–8627. Singh, S.K., Nielsen, P., Koshkin, A.A., Wengel, J., 1998. LNA (locked nucleic acids): synthesis and high-affinity nucleic acid recognition. Chem. Commun. (Camb.) 4, 455–456. Tian, L., Sayer, J.M., Jerina, D.M., Shuman, S., 2004. Individual nucleotide bases, not base pairs, are critical for triggering site-specific DNA cleavage by vaccinia topoisomerase. J. Biol. Chem. 279, 39718–39726. Ugozzoli, L.A., Latorra, D., Pucket, R., Arar, K., Hambya, K., 2004. Real-time genotyping with oligonucleotide probes containing locked nucleic acids. Anal. Biochem. 324, 143–152. Wahlestedt, C., Salmi, P., Good, L., Kela, J., Johnsson, T., Hokfelt, T., Broberger, C., Porreca, F., Lai, J., Ren, K., Ossipov, M., Koshkin, A., Jakobsen, N., Skouv, J., Oerum, H., Jacobsen, M.H., Wengel, J., 2000. Potent and nontoxic antisense oligonucleotides containing locked nucleic acids. Proc. Natl. Acad. Sci. U. S. A. 97, 5633–5638. Wang, B., Howel, P., Bruheim, S., Ju, J., Owen, L.B., Fodstad, O., Xi, Y., 2011. Systematic evaluation of three microRNA profiling platforms microarray, beads array, and quantitative real-time PCR array. PLoS One 6e17167 http://dx.doi.org/10.1371/ journal.pone.0017167. You, Y., Moreira, B.G., Behlke, M.A., Owczarzy, R., 2006. Design of LNA probes that improve mismatch discrimination. Nucleic Acids Res. 34, e60. Zaghloul, E.M., Madsen, A.S., Moreno, P.M.D., Oprea, I.I., El-Andaloussi, S., Bestas, B., Gupta, P., Pedersen, E.B., Lundin, K.E., Wengel, J., Edvard Smith, C.I., 2011. Optimizing anti-gene oligonucleotide ‘Zorro-LNA'for improved strand invasion into duplex DNA. Nucleic Acids Res. 39, 1142–1154. Zehr, J.P., McReynolds, L.A., 1989. Use of degenerate oligonucleotides for amplification of the nifH gene from the marine cyanobacterium Trichodesmium thiebautii. Appl. Environ. Microbiol. 55, 2522–2526.
Contents lists available at SciVerse ScienceDirect
Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth
Note
Bias in topoisomerase (TOPO)-cloning of multitemplate PCR products using locked nucleic acid (LNA)-substituted primers Yuan Liu, Jessica Döring, Thomas Hurek ⁎ University of Bremen, Department of Microbe–Plant Interactions, CBIB (Center for Biomolecular Interactions Bremen), 28359 Bremen, Germany
a r t i c l e
i n f o
Article history: Received 5 September 2012 Received in revised form 5 October 2012 Accepted 6 October 2012 Available online 12 October 2012
a b s t r a c t Locked nucleic acid (LNA) modifications help to improve nucleic acid recognition in molecular biology applications. We report that LNA-substituted primers in PCR reactions may cause considerable cloning bias when the widely used topoisomerase-based ligation is used for cloning of multitemplate PCR products. © 2012 Elsevier B.V. All rights reserved.
Keywords: Cloning bias LNA PCR TOPO
Locked nucleic acids (LNAs), first described by Singh et al. (1998), are RNA derivatives with a methylene linkage between the ribose 2′oxygen and the 4′-carbon. The incorporation of LNA into oligonucleotide primers has been shown to increase template binding strength and specificity of DNA amplification in polymerase chain reactions (PCR) (Ballantyne et al., 2008), which offers a promising strategy to improve PCR detection (Burbano et al., 2010; Burbano et al., 2011; Rupp et al., 2006) and quantification (Rupp et al., 2006; Ugozzoli et al., 2004). Owing to favourable properties such as improved hybridization behaviour and efficient mismatch discrimination (Petersen and Wengel, 2003) LNA is also widely used in other molecular biology applications, including single nucleotide polymorphism (SNP) (Rupp et al., 2006) and microarray analysis (Briones and Moreno, 2012; Wang et al., 2011), fluorescence in-situ hybridization (FISH) (Robertson et al., 2010; Robertson and Vora, 2012), antisense (Wahlestedt et al., 2000) and anti-gene (Zaghloul et al., 2011) approaches. Azoarcus sp. BH72 is a diazotrophic betaproteobacterium with an endophytic and non-pathogenic lifestyle, which can supply nitrogen derived from N2-fixation to Kallar grass (Leptochloa fusca, L. Kunth), where it was isolated from (Reinhold-Hurek and Hurek, 2011). It can reach high densities in roots of field-grown, non-diseased host plants and become the most actively nitrogen-fixing bacterium there (Reinhold-Hurek and Hurek, 2011). The identification of bacteria with this lifestyle in planta is
⁎ Corresponding author. Tel.: +49 421 218 62868; fax: +49 421 218 62873. E-mail address: [email protected] (T. Hurek). 0167-7012/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.mimet.2012.10.002
methodologically challenging (Burbano et al., 2011). For this purpose nifH, the gene for the Fe protein in the evolutionary conserved nitrogenase protein complex, is commonly used as a marker. To achieve a high coverage of nifH genes, approaches are usually based on PCR-reactions with degenerate primers which suffer from low sensitivity and efficiency. Under these circumstances the use of LNA-substituted primers can drastically improve PCR detection (Burbano et al., 2010). We accidentally observed that nifH PCR products with the sequence of Azoarcus sp. BH72 could almost not be cloned by TOPO TA (Invitrogen) when amplicons were obtained with LNA-substituted degenerate primers, although they could be cloned using T4 DNA ligase (unpublished data). Here we show that LNA substitution of primers used in PCR reactions with Taq DNA polymerase may unexpectedly lead to blunt-end PCR products, which are not suitable for topoisomerase-cloning using the TA approach. We also show that cloning into a blunt-end TOPO vector may cause preferential ligation of multitemplate PCR products in a sequence-dependent manner, when primers are substituted with LNA bases. The widely used TOPO TA cloning relies on the efficient topoisomerase ligation of PCR products with vector DNA with the help of single-base 3′ overhangs added to PCR products by the template-independent transferase activity of Taq DNA polymerase (Clark, 1988). In order to investigate whether Taq DNA polymerase can add a single deoxynucleotide to the 3′-ends of PCR products obtained with LNA-substituted primers, a ligation to a single-stranded DNA adaptor was carried out. This adaptor (Table 1) was 5′-phosphorylated and modified by a 3′-ddC (dideoxycytidine) to permit ligation only to the free 3′-ends of PCR products. The genomic DNA from Azoarcus sp. BH72 was used as template for PCR reactions with degenerate nifH-specific LNA- or DNA-Zehr primers, developed by Zehr and McReynolds (1989). Ligation reactions were done in 20 μl, containing 1×ligase buffer, 20 pmol adaptor, approx. 1 pmol purified
484
Y. Liu et al. / Journal of Microbiological Methods 91 (2012) 483–486
Table 1 Oligonucleotide sequences. Namea
Sequence (5′–3′)b
Reference
DNA-Zehr-F LNA-Zehr-F DNA-NW-F LNA-NW-F DNA-Zehr-R LNA-Zehr-R DNA-AR-R LNA-AR-R DNA-BHNW-R LNA-BHNW-R KP2S Adapter
TGYGAYCCNAARGCNGA TGYGAYCCNAARGCNGA TGTGATCCGAAGGCAGA TGTGATCCGAAGGCAGA ADNGCCATCATYTCNCC ADNGCCATCATYTCNCC AGAGCCATCATTTCGCC AGAGCCATCATTTCGCC ATGGCCATCATTTCGCC ATGGCCATCATTTCGCC TCGCGACCGTAGTCC GGACTACGGTCGCGATGGCACGATACGCAGCATCACAAGAACT
Zehr and McReynolds (1989) Burbano et al. (2010) This study This study Zehr and McReynolds (1989) Burbano et al. (2010) This study This study This study This study This study This study
a The primer pair DNA-Zehr-F and DNA-Zehr-R (or LNA-Zehr-F and LNA-Zehr-R) was used for broad-range amplification of nifH. For all other primer pairs pA72, carrying the partial nifH gene fragment from Azoarcus sp. BH72 and pRW3, carrying the partial nifH gene fragment from Rhizobium rosettiformans W3 were used as targets. b LNA bases are depicted in boldface and are underlined.
PCR product, 10 μl 50% polyethylene glycerol (PEG) 4000 and 10 U T4 RNA ligase I (New England Biolabs, Frankfurt am Main, Germany). Ligation was carried out at 22 °C for 1 h. To obtain the sequence information at the 3′-termini of the PCR products, 1.0 μl of the ligation mixture was used as template for PCR reactions with primer KP2S (Table 1), which anneals to the adaptor. Subsequently, PCR products were cloned into the pCR2.1-TOPO TA cloning vector (Invitrogen, Darmstadt, Germany) and analysed with M13 forward and reverse primers by Sanger sequencing (LGC Genomics, Berlin, Germany). Sequencing of at least 2 random clones each showed that 3′ overhangs were only formed when DNA primers were used, while in the case of LNA-substituted primers the overhangs were completely missing (Fig. 1). The topoisomerase-mediated ligation can still have a high efficiency, when the PCR product contains a 3′ G, T or C overhang (Cheng and Shuman, 2000) which does not perfectly match to the 3′ T overhang of the vector. However, when the blunt-end PCR product is cloned into the pCR2.1-TOPO TA vector, the covalent intermediate between PCR product and vector is not formed since the 3′ overhang is missing from the PCR product, leading to lower ligation and consequently lower cloning efficiency. Probably, LNA nucleotides affect the terminal transferase activity of Taq DNA polymerase. It was reported that positioning of LNA nucleotides at or near the 3′ terminus of a primer can significantly affect polymerase-mediated extension (Di Giusto and King, 2004; Latorra et al., 2003). LNA nucleotides in double stranded DNA cause a conversion from the B into an A-like conformation (Petersen and Wengel, 2003) and inhibit PCR extension when located at the 3′ end of the primer (Latorra et al., 2003). Hereby, a larger conformational change is caused by the penultimate LNA than by a terminal LNA-substituted base, leading to active side deformation of the polymerase and reduction of the polymerization rate (Di Giusto and King, 2004). The inhibition of a single-base addition to 3′ ends by Taq DNA polymerase may be explained likewise. Before single base 3′-overhangs are formed in a non-template-dependent manner, blunt-end PCR products are dissociated from the polymerase after the completion of template-dependent synthesis. Subsequently the polymerase reassociates with the bluntend substrate to perform the non-templated synthesis (Clark, 1988). Probably, not only the template-dependent polymerase activity but also the non-template-dependent terminal transferase activity of the Taq DNA polymerase is sensitive to A-like conformations of duplex DNA, leaving blunt ends. To study the effect of 5′-LNA substitution of PCR products on TOPO cloning efficiency, two plasmids, pA72 and pRW3 were constructed with the TOPO TA vector, carrying a partial nifH gene fragment from Azoarcus sp. BH72 and from Rhizobium rosettiformans W3 (Burbano et al., 2011), respectively. Both nifH fragments had been obtained by PCR using LNA-substituted Zehr forward and reverse primers (Table 1). We chose to analyse nifH fragments from these two organisms since
preliminary experiments had shown that the TOPO TA cloning efficiency of the nifH fragment from Azoarcus sp. BH72 genomic DNA was drastically lower than the one from pRW3 (data not presented). This observation could not be explained alone by our finding that PCR products amplified with LNA-substituted primers had no 3′ overhang (Fig. 1), since the cloning efficiency of blunt-end PCR products in comparison to PCR products with a 3′-end has been shown to decrease only by 20% when the TOPO TA vector is used (Geng et al., 2006). Sequence comparisons revealed that target regions for the Zehr forward primer in both plasmids and in Azoarcus sp. BH72 genomic DNA were identical. However, the target region of the LNA-Zehr reverse primer in Azoarcus sp. BH72 genomic DNA and in the two plasmids differed from each other by two nucleotides. These observations suggested that the sequence composition in the primer target region of the LNA-Zehr reverse primer was responsible for the reduction of the cloning efficiency. To prove this hypothesis, two non-degenerate LNA reverse primers, BHNW-R (targeting Azoarcus sp. BH72 genomic DNA) and AR-R (targeting plasmids pA72 and pRW3) were designed which differed from each other by these two nucleotides (Table 1). Plasmids pA72 and pRW3 were used as templates to generate PCR products with the two non-degenerate LNA primer sets, NW-F+AR-R and NW-F+BHNW-R (Table 1). Since PCR products obtained with LNA-substituted primers had no 3′ overhang (Fig. 1), the Pfu DNA polymerase (Fermentas, St. Leon-Rot, Germany) and TOPO ZeroBlunt kit (Invitrogen, Darmstadt, Germany) were used for cloning. The results (Table 2) clearly showed that the sequence within the LNA-substituted BHNW-R primer was responsible for the drastic reduction of the cloning efficiency. This effect was independent from the internal sequences of pA72 and pRW3 which had a nucleotide sequence identity of 78% in an alignment consisting of 328 positions (excluding the primer target regions). When this experiment was repeated twice with DNA primers, cloning efficiencies>80% were obtained for all four types of PCR products. Our data show that LNA substitutions near the 5′-end of the PCR product may drastically affect TOPO cloning efficiency. This effect probably arises from disrupting base stacking interactions required for topoisomerase-mediated ligation. Shuman (1992) showed that dsDNA containing one covalently topoisomerase-activated terminus could ligate to a blunt-end duplex DNA, regardless of the sequence of the acceptor molecule. However, Tian et al. (2004) suggested that continuous base stacking of the acceptor DNA strands is very important for topoisomerase-catalysed ligation. Since LNA modifications in duplex DNA might cause discontinuous base stacking compared to native DNA duplexes (You et al., 2006), LNA base substitution may prevent the ligation catalysed by topoisomerase. In this study, the combination of LNA-T, LNA-C, and LNA-A nucleotides in primer LNA-BHNW-R (Table 1) prevented ligation, whereas the combination of LNA-G, LNA-C, and LNA-A nucleotides in primer LNA-AR-R (Table 1) had no
Y. Liu et al. / Journal of Microbiological Methods 91 (2012) 483–486
485
A
B
C
D Fig. 1. Representative DNA sequence chromatograms showing presence (A, B) or absence (C, D) of single-base 3′ overhangs in Taq-amplicons obtained with DNA (A, B) primers or LNA-modified primers (C, D). Genomic DNA of Azoarcus sp. BH72 was used as template. LNA bases are headed by arrows.
effect (Table 2). This may be related to the higher base-pairing stability of LNA-T than LNA-G (McTigue et al., 2004) which would increase discontinuous base stacking. Accordingly, a less efficient ligation would result in a lower cloning efficiency.
In conclusion, our results showed that the use of LNA-substituted primers in PCR may cause preferential ligation of multitemplate PCR products and may inhibit TA-cloning by decreased formation of 3′-overhangs in PCR reactions with Taq DNA polymerase. The
486
Y. Liu et al. / Journal of Microbiological Methods 91 (2012) 483–486
Table 2 The effect of sequence composition within LNA-substituted primers on TOPO cloning efficiency of four different PCR fragments. Template
pA72d pRW3 a b c d
d
Primer pair
LNA-NW-F + LNA-AR-R LNA-NW-F + LNA-BHNW-R LNA-NW-F + LNA-AR-R LNA-NW-F + LNA-BHNW-R
Replication 1a
Replication 2a
Replication 3a
Tested
Positive
Tested
Positive
Tested
Positive
50 10 50 13
40 0 40 2
50 6 50 5
45 0 42 0
NDc ND 50 6
ND ND 35 0
Cloning efficiencyb (%)
P value (t test result)
85 ± 5 0 78 ± 4 5±5
0.0034 0.0004
Tested, colonies selected from the plate; positive, inserts with appropriate size. Cloning efficiency, the percentage of positive clones among the clones tested. ND, not determined. For explanation see Table 1.
resulting bias will have to be taken into consideration particularly when diverse amplicons or microbial communities are studied by PCR-based cloning approaches. Acknowledgement This work was supported by grant Hu 579/7-1 from the Deutsche Forschungsgemeinschaft. References Ballantyne, K.N., van Oorschot, R.A., Mitchell, R.J., 2008. Locked nucleic acids in PCR primers increase sensitivity and performance. Genomics 91, 301–305. Briones, C., Moreno, M., 2012. Applications of peptide nucleic acids (PNAs) and locked nucleic acids (LNAs) in biosensor development. Anal. Bioanal. Chem. 402, 3071–3089. Burbano, C.S., Reinhold-Hurek, B., Hurek, T., 2010. LNA-substituted degenerate primers improve detection of nitrogenase gene transcription in environmental samples. Environ. Microbiol. Rep. 2, 251–257. Burbano, C.S., Liu, Y., Rösner, K., Reis, V., Caballero-Mellado, J., Reinhold-Hurek, B., Hurek, T., 2011. Predominant nifH transcript phylotypes related to Rhizobium rosettiformans in field grown sugarcane plants and in Norway spruce. Environ. Microbiol. Rep. 3, 383–389. Cheng, C., Shuman, S., 2000. DNA strand transfer catalyzed by vaccinia topoisomerase: ligation of DNAs containing a 3′ mononucleotide overhang. Nucleic Acids Res. 28, 1893–1898. Clark, J.M., 1988. Novel non-templated nucleotide addition reactions catalyzed by procaryotic and eucaryotic DNA polymerases. Nucleic Acids Res. 16, 9677–9686. Di Giusto, D.A., King, G.C., 2004. Strong positional preference in the interaction of LNA oligonucleotides with DNA polymerase and proofreading exonuclease activities: implications for genotyping assays. Nucleic Acids Res. 32, e32. Geng, L., Xin, W., Huang, D.W., Feng, G., 2006. A universal cloning vector using vaccinia topoisomerase I. Mol. Biotechnol. 33, 23–28. Latorra, D., Arar, K., Hurley, J.M., 2003. Design considerations and effects of LNA in PCR primers. Mol. Cell. Probes 17, 253–259. McTigue, P.M., Peterson, R.J., Kahn, J.D., 2004. Sequence-dependent thermodynamic parameters for locked nucleic acid (LNA)-DNA duplex formation. Biochemistry 43, 5388–5405.
Petersen, M., Wengel, J., 2003. LNA: a versatile tool for therapeutics and genomics. Trends Biotechnol. 21, 74–81. Reinhold-Hurek, B., Hurek, T., 2011. Living inside plants: bacterial endophytes. Curr. Opin. Plant Biol. 14, 435–443. Robertson, K.L., Vora, G.J., 2012. Locked nucleic acid and flow cytometry-fluorescence in situ hybridization for the detection of bacterial small noncoding RNAs. Appl. Environ. Microbiol. 78, 14 http://dx.doi.org/10.1128/AEM.06399-11. Robertson, K.L., Verhoeven, A.B., Thach, D.C., Chang, E.L., 2010. Monitoring viral RNA in infected cells with LNA flow-FISH. RNA 16, 1679–1685. Rupp, J., Solbach, W., Gieffers, J., 2006. Single-nucleotide-polymorphism-specific PCR for quantification and discrimination of Chlamydia pneumoniae genotypes by use of a “locked” nucleic acid. Appl. Environ. Microbiol. 72, 3785–3787. Shuman, S., 1992. DNA strand transfer reactions catalyzed by vaccinia topoisomerase I. J. Biol. Chem. 267, 8620–8627. Singh, S.K., Nielsen, P., Koshkin, A.A., Wengel, J., 1998. LNA (locked nucleic acids): synthesis and high-affinity nucleic acid recognition. Chem. Commun. (Camb.) 4, 455–456. Tian, L., Sayer, J.M., Jerina, D.M., Shuman, S., 2004. Individual nucleotide bases, not base pairs, are critical for triggering site-specific DNA cleavage by vaccinia topoisomerase. J. Biol. Chem. 279, 39718–39726. Ugozzoli, L.A., Latorra, D., Pucket, R., Arar, K., Hambya, K., 2004. Real-time genotyping with oligonucleotide probes containing locked nucleic acids. Anal. Biochem. 324, 143–152. Wahlestedt, C., Salmi, P., Good, L., Kela, J., Johnsson, T., Hokfelt, T., Broberger, C., Porreca, F., Lai, J., Ren, K., Ossipov, M., Koshkin, A., Jakobsen, N., Skouv, J., Oerum, H., Jacobsen, M.H., Wengel, J., 2000. Potent and nontoxic antisense oligonucleotides containing locked nucleic acids. Proc. Natl. Acad. Sci. U. S. A. 97, 5633–5638. Wang, B., Howel, P., Bruheim, S., Ju, J., Owen, L.B., Fodstad, O., Xi, Y., 2011. Systematic evaluation of three microRNA profiling platforms microarray, beads array, and quantitative real-time PCR array. PLoS One 6e17167 http://dx.doi.org/10.1371/ journal.pone.0017167. You, Y., Moreira, B.G., Behlke, M.A., Owczarzy, R., 2006. Design of LNA probes that improve mismatch discrimination. Nucleic Acids Res. 34, e60. Zaghloul, E.M., Madsen, A.S., Moreno, P.M.D., Oprea, I.I., El-Andaloussi, S., Bestas, B., Gupta, P., Pedersen, E.B., Lundin, K.E., Wengel, J., Edvard Smith, C.I., 2011. Optimizing anti-gene oligonucleotide ‘Zorro-LNA'for improved strand invasion into duplex DNA. Nucleic Acids Res. 39, 1142–1154. Zehr, J.P., McReynolds, L.A., 1989. Use of degenerate oligonucleotides for amplification of the nifH gene from the marine cyanobacterium Trichodesmium thiebautii. Appl. Environ. Microbiol. 55, 2522–2526.