Bilateral and simultaneous accumulation of lipid and biomass in the novel oleaginous green microalga Tetradesmus bernardii under mixotrophic growth

Algal Research 37 (2019) 64–73

Contents lists available at ScienceDirect

Algal Research journal homepage: www.elsevier.com/locate/algal

Bilateral and simultaneous accumulation of lipid and biomass in the novel oleaginous green microalga Tetradesmus bernardii under mixotrophic growth Baoyan Gao, Luodong Huang, Feifei Wang, Ailing Chen, Chengwu Zhang

T

⁎

Department of Ecology, Research Center for Hydrobiology, Jinan University, Guangzhou 510632, People's Republic of China

A R T I C LE I N FO

A B S T R A C T

Keywords: Tetradesmus bernardii Trophic mode Mixotrophic culture Lipid Fatty acids

A new oleaginous strain of Tetradesmus bernardii exhibiting various trophic modes was isolated from an inland water body of South China. In the present study, the biomass and lipid accumulation capacity of T. bernardii in addition to its fatty acid composition were evaluated under photoautotrophic, heterotrophic, and mixotrophic cultivation conditions. T. bernardii accumulated high lipid contents up to 65.8% of dry weight under low nitrogen conditions (1 mM) in photoautotrophic cultivation. Biomass yields under heterotrophic cultivation were much higher than in photoautotrophic cultures, while lipid contents were reduced. However, T. bernardii accumulated higher biomass yields and lipid contents (54.7% of dry weight) under mixotrophic growth and high nitrogen availability (18 mM). Thus, T. bernardii achieved maximum lipid productivity due to the bilateral and synchronous enhancement of lipid content and biomass production. The fatty acid composition of T. bernardii comprised over 70% of saturated fatty acids (i.e., palmitic acid (C16:0), stearic acid (C18:0)) and monounsaturated fatty acids (i.e., palmitoleic acid (C16:1), oleic acid (C18:1)). Specifically, the mixotrophic cultivation of T. bernardii would be the preferable means for oil-rich biomass.

1. Introduction

microalgae conduct mixotrophic growth. During mixotrophy, microalgae simultaneously or sequentially grow via photoautotrophic and heterotrophic metabolisms. Mixotrophy allows greater flexibility in microalgal growth due to the simultaneous use of inorganic and organic carbon sources and light energy [9]. Moreover, the use of organic carbon sources during mixotrophic cultivation can overcome issues due to light limitation, reduce or stop photo-inhibition and protect algae from photo-oxidative damage that is stimulated by oxygen accumulation in enclosed photo-bioreactors [3,9]. Further, mixotrophic cultivation reduces the loss of biomass due to respiration during dark hours [9]. Lastly, less organic carbon is needed for mixotrophic culture growth compared to heterotrophic cultures [10]. Various trophic modes have different effects on the accumulation of biomass and lipid content of microalgae. Generally, higher biomass yields are obtained in heterotrophic and mixotrophic cultures compared to those achieved in photoautotrophic cultures [9]. Furthermore, heterotrophic and mixotrophic cultures can lead to greater accumulation of lipids in microalgae than those cultivated in photoautotrophic conditions, such as in Chlorella vulgaris and Chlorella sorokiniana [11,12]. However, the lipid content of some oleaginous microalgae decreases after switching from photoautotrophic to heterotrophic cultivation [11]. Nutrients and salt concentrations of growth medium can also significantly affect the growth and lipid content of microalgae, and

Microalgae have attracted immense attention as a potential feedstock for the production of valuable chemicals, including lipids, pigments, fatty acids, polysaccharides, and small molecular metabolites [1]. Microalgae are generally photoautotrophic organisms that can perform oxygenic photosynthesis and fix carbon dioxide. That is, microalgal cells need light energy and inorganic carbon as energy and carbon sources, respectively [2]. However, some microalgae are capable of uptake and utilization of organic compounds, such as glucose, acetate, and glycerol, as energy and carbon sources for heterotrophic growth in dark environments. Heterotrophic cultures can overcome many limitations associated with phototrophic cultivation of microalgae, including light dependence. In most cases, heterotrophic culture facilities are easier to construct and scale up, and higher cell densities can be obtained with the development of industrial fermentation technologies [3]. Under heterotrophic conditions, many algal strains possess the potential to obtain high levels of biomass, fatty acids, or valuable chemicals. For example, such activity has been observed for Haematococcus pluvialis, Chlorella protothecoides, Galdieria sulphuraria, Crypthecodinium cohnii, and Neochloris oleoabundans, among others [4–8]. In addition to photoautotrophic and heterotrophic growth, some ⁎

Corresponding author. E-mail address: [email protected] (C. Zhang).

https://doi.org/10.1016/j.algal.2018.11.012 Received 28 September 2018; Received in revised form 13 November 2018; Accepted 23 November 2018 2211-9264/ © 2018 Published by Elsevier B.V.

Algal Research 37 (2019) 64–73

B. Gao et al.

2.5. Culture conditions

this is especially evident for nitrogen [13]. Nitrogen is essential for the growth of all microalgae, and nitrogen deprivation leads to changes in key metabolic pathways of microalgae. For example, such shifts generally occur from proteosynthesis towards lipid or starch synthesis [14]. To achieve the highest possible microalgal lipid productivity in a cost-effective manner, it is crucial to promote the optimal trophic mode and optimal nutrient management of microalgal cultivation [9]. Due to the diversity of microalgal trophic modes, researchers can screen algal strains for advantageous and optimal modes of nutritional metabolism that promote high cell densities and high concentrations of target metabolites. Here, the microalgal strain Tetradesmus bernardii JNU15 was isolated from small subtropical inland water bodies and was phenotypically and genotypically characterized. In addition, changes in the growth and lipid accumulation of T. bernardii were evaluated under photoautotrophic, heterotrophic, and mixotrophic cultivation modes with different nitrogen and glucose concentrations.

The stock culture was maintained in modified BG-11 medium [16] with sodium nitrate as the nitrogen source. All experimental conditions were performed with triplicated replications. Phototrophic experiments were initiated with seven different nitrogen concentrations (1, 3, 6, 9, 12, 15, and 18 mM) and were conducted in Ø4.5 × 70-cm bubble column glass photobioreactors with 800 mL working volumes. Cultures were aerated with 1% CO2 enriched compressed air and exposed to continuous illumination and a light intensity of 300 μmol m−2 s−1 from one side. Algal biomass was harvested on day 18. Heterotrophic experiments were initiated with sodium nitrate as the nitrogen source (18 mM nitrogen concentration), but supplemented with different glucose concentrations (10, 20, 30, 40, 50, and 60 g L−1). The experiments were performed in 250 mL Erlenmeyer flasks with 150 mL working volumes and incubated on a shaker with rotation at 180 rpm. Heterotrophic cultures were incubated for 12 days in the dark. Mixotrophic experiments were designed with sodium nitrate as the nitrogen source (18 mM nitrogen concentration), but supplemented with different concentrations of glucose (10, 20, 30, 40, 50, and 60 g L−1). The experiments were conducted in Ø4.5 × 70-cm bubble column glass photobioreactors with 800 mL working volumes. The culture conditions were the same as for phototrophic cultures, with the exception of aeration with 1% CO2 enriched compressed air via a millipore filter (0.2-μm pore size) that was passed through an inlet and outlet.

2. Material and methods 2.1. Experimental materials The initial axenic Tetradesmus bernardii strain JNU15 was isolated from small subtropical inland water bodies of the Guangdong Province, China (23°13.166′, 113°34.754′), and then maintained in our laboratory. 2.2. Light microscopy

2.6. Dry weight measurements Cell morphologies of cultures were observed using an Olympus CX41 microscope.

A 10 mL culture sample was filtered using a dry 0.45-μm glass fiber filter membrane (dry weight, W1) and a vacuum filter. The filter membranes containing algal cells were then dried in an oven at 105 °C to constant weight (dry weight, W2). The dry weight of the algal cells was then calculated based on the difference between W2 and W1, and the volume of sampled algal suspension.

2.3. Transmission electron microscopy (TEM) Microalgal cell pellets were generated by centrifugation and then fixed with 2.5% glutaraldehyde in phosphate buffer (pH 7.2) for 2 h. Pellets were subsequently washed with a phosphate buffer three times (10–15 min for each) and post-fixed in 1% osmium tetroxide with the same buffer for 2 h. Cells were again washed with the phosphate buffer three times (10–15 min) and dehydrated in a series of increasing concentrations of acetone (50%, 70%, 80%, 90%, 95%, and 100%), for 10 min each. Cells were then infiltrated with resin by gradually introducing mixtures of acetone and Epon 812 resin (1:3, 1:1, 3:1), for 2 h each. The samples were then finally embedded into 100% Epon 812 resin for 2 h. Resin blocks with cells were incubated in an oven at 45 °C for 12 h, and then again at 60 °C for 24 h. Ultra-thin sections were stained with uranyl acetate and lead citrate, followed by observations with TEM (Philips, Tecnai 10).

2.7. Lipid quantification Total lipid content determination was conducted based on slightly modified methods described by Khozin-Goldberg [17]. About 50–80 mg of algal powder was extracted with 2 mL of dimethyl sulfoxide - methanol mixture (V:V = 1:9) in a 50 °C water bath for 1.5 h. The mixture was then centrifuged at 3500 rpm (2740 ×g) for 5 min, and the supernatant was collected into 15 mL glass vials. The residue was re-extracted with 4 mL diethyl ether-hexane mixed solution (V:V = 1:1) in an ice bath for 1.5 h and then centrifuged. The supernatant was collected into the same glass vial and the extraction process was repeated. Distilled water (4 mL) was then added to the small bottle with the collected supernatant and then shaken and mixed. The organic phase of the upper layer was then transferred to another clean glass bottle and dried with nitrogen, followed by transfer to a 1.5 ml centrifuge tube and weighed.

2.4. ITS sequence analysis Tetradesmus bernardii DNA was extracted using an EZ-10 Spin Column Plant Genomic DNA Purification Kit (Sangon Biotech). The ITS gene was then amplified in 25 μL PCR reactions using the primers ITS-F (5′CGTTCCGTAGGTGAACCTGC3′) and ITS-R (CATATGCTTAAGTTCA GCGGGT) [15] and KOD-Plus-Neo DNA polymerase (product code: KOD-401). The resultant ITS gene sequence (1449 bp length) was deposited in the Genbank database with the accession number MH900176. The ITS gene sequence was compared against other microalgal ITS gene sequences in the NCBI database using the BLAST algorithm. Multiple sequence alignment of the JNU15 sequence and other reference sequences was constructed using the ClustalX 2.1 aligner. In addition, a molecular phylogenetic tree was constructed from the multiple sequence alignment using Maximum Likelihood methods (ML) in the MEGA 6.06 software package.

2.8. Fatty acid analysis A total of 25 mg dry weight of freeze-dried biomass was added to a 2 ml solution comprising 2% H2SO4 and methanol: methylbenzene (90:10, V/V) in a small vial that was filled with Ar gas. The mixture was then incubated in a water bath at 80 °C for 1.5 h in order to promote the transmethylation of fatty acids. The reaction was then quenched by adding the mixture to a separate mixture of 1 ml H2O and 1 mL hexane. The solution was centrifuged at 3500 rpm (2740 ×g) for 5 min, and the upper layer was transferred to another tube. The mixture was then dried with N2, followed by addition of 100 μL hexane. Heptadecanoic acid (Sigma Chemical Co., USA) was used as an internal standard. The 65

Algal Research 37 (2019) 64–73

B. Gao et al.

Fig. 1. Cellular morphology of T. bernardii. The scale bars in a–h indicate 10 μm, and the scale bars in i–l indicate 1 μm. CL, chloroplast; Py, pyrenoid; S, starch; M, mitochondria; LB, lipid body.

Phylogenetic analysis of the JNU15 ITS sequence clearly indicated that the strain belonged to the genus Tetradesmus (Fig. 2). Tetradesmus bernardii was originally classified as Acutodesmus pectinatus var. bernadii in 2011 by Tsarenko and John [18], but then Hegewald et al. [19] suggested that Acutodesmus bernardii was independent of the genus Acutodesmus. Wynne and Hallan [20] also suggested that Tetradesmus, as named by G. M. Smith was recognized earlier than Acutodesmus, and that Acutodesmus should be changed to Tetradesmus. Therefore, A. bernardii should have been named T. bernardii (G. M. Smith) M. J. Wynne comb. nov. However, given these observations, the names of many algae belonging to the genus Tetradesmus have not yet been corrected in the NCBI database. Consequently, these accession names were attributed to the genus Tetradesmus in Fig. 2. Tetradesmus bernardii and Tetradesmus nygaardii belonged to the same group based on the phylogenetic analysis, but significant morphological differences exist between them. For example, the arrangement of coenobia cells of T. nygaardii is always disposed on the same plane [21]. Thus, this difference can be used to distinguish T. bernardii and T. nygaardii.

fatty acid methyl esters were then analyzed with gas chromatography (GC) on an Agilent Gas Chromatograph (Agilent 6890N GC, Agilent Technologies, USA) and authentic standards. Detailed methods for GC analysis have been described elsewhere [16]. 2.9. Statistical analyses Statistical analyses were performed using the SPSS 17.0 software package. Significant differences (P < 0.05) between treatments were investigated using two-way ANOVA tests with LSD (Least Significant Difference) and Duncan post-hoc tests. 3. Results 3.1. Morphological and molecular phylogenetic analysis of T. bernardii JNU15 Strain JNU15 exhibited a morphology with coenobia of (2–)4 or 8 cells in a zigzag, alternating arrangement. Each cell was united by its apex to subapical or medium portions of adjacent cells, and the arrangements of coenobia cells were not disposed in the same plane (Fig. 1a–d). Cell sizes were (1.8–)3–7(−7.3) × 7–40(−48) μm. Cells were spindle-shaped to arc-like, and the two ends of the cell tapered to acute, sometimes slightly obtuse apices. Cells had a peripheral, lamellar chloroplast with a single pyrenoid (Fig. 1i–l). Autospores (colonies) were formed via asexual reproduction (Fig. 1e–h).

3.2. Growth, lipid accumulation, and fatty acid composition of T. bernardii under phototrophic cultivation The effect of seven nitrogen concentrations (1, 3, 6, 9, 12, 15, and 18 mM) on the growth, lipid content, and lipid productivity of T. bernardii were evaluated under phototrophic culture conditions (Fig. 3). Increases in initial nitrogen concentrations resulted in biomass 66

Algal Research 37 (2019) 64–73

B. Gao et al.

AJ249509 Tetradesmus (Scenedesmus) acutus strain MPI JQ082316 Tetradesmus (Acutodesmus)obliquus var. dactylococcoides strain CCAP 276/42 49 JQ082319 Tetradesmus obliquus strain CCAP 276/49 HQ246449 Tetradesmus (Acutodesmus) bajacalifornicus strain ZA1-5 JQ082312 Tetradesmus (Acutodesmus) acuminatus strain CCAP 276/30 5770 78 JQ082313 Tetradesmus (Acutodesmus) distendus strain CCAP 276/37 AY510474 Tetradesmus (Scenedesmus) deserticola isolate BCP-EM2-VF3 JQ082326 Tetradesmus (Acutodesmus) reginae strain CCAP 276/66 92 56 Tetradesmus bernardii JNU15 96 JQ082320 Tetradesmus (Acutodesmus) nygaardii strain CCAP 276/50 99 JQ082325 Tetradesmus (Acutodesmus) nygaardii strain CCAP 276/62 AY510466 Tetradesmus (Dactylococcus) dissociatus isolate UTEX 1537 GQ375103 Dimorphococcus lunatus strain SAG 224-1 18S GQ375096 Coelastrum morum strain SAG217-5 46 DQ417572 Coelastrum microporum Tow6/3P-9W 99 68 GQ375089 Coelastrum astroideum strain SAG 65.81 JQ082315 Chodatodesmus mucronulatus strain CCAP 276/41 29 JQ082323 Pectinodesmus regularis strain CCAP 276/56 85 JQ082321 Pectinodesmus pectinatus strain CCAP 276/51 67 JQ082334 Pectinodesmus holtmannii strain Krienitz 2005-5 KC315288 Desmodesmus baconii 61 AB917111 Desmodesmus brasiliensis strain: GS2n 86 DQ417557 Desmodesmus pirkollei isolate NDem 6/3 T-13W 48 AB917139 Desmodesmus pannonicus strain: GM4n 97 FR865701 Desmodesmus intermedius CCAP 258/36 69 FR865727 Desmodesmus armatus var. subalternans CCAP 276/4A 40 AB917112 Desmodesmus armatus strain: GS2o 99 AB917107 Desmodesmus opoliensis strain: GS2j JQ910904 Scenedesmus armatus isolate G2 99 DQ417532 Desmodesmus opoliensis isolate Tow 6/16 T-16W 81 KU175228 Desmodesmus insignis strain JNU24 FR865576 Chlamydomonas reinhardtii CCAP 11/32CW15 52 89

64

Tetradesmus

Dimorphococcus Coelastrum Chodatodesmus Pectinodesmus

Desmodesmus

0.050

Fig. 2. Phylogenetic analysis of the T. bernardii ITS gene sequence. The Maximum Likelihood tree was inferred from an alignment of 1449 bp in MEGA 6.06.

content of saturated and polyunsaturated fatty acids of total fatty acids decreased with decreases in nitrogen concentrations within the media. In contrast, the monounsaturated fatty acid content increased with lower media nitrogen concentrations.

increases, with maximum values at 9 mM nitrogen concentration, after which, biomass increases declined gradually (Fig. 3a). The maximum biomass yield was 5.83 g L−1 with NaNO3 as the nitrogen source. Nitrogen concentrations of 9 mM, 3 mM, and 1 mM all significantly influenced biomass yield (two-way ANOVA, P < 0.05). In contrast, there were no significant influences from the other nitrogen concentrations on biomass yield (P > 0.05). The lipid content of T. bernardii increased gradually with lower nitrogen concentrations (Fig. 3b). The highest lipid content was 64.97% of dry weight under 1 mM nitrogen, which was 2.22-fold higher than the lipid content with 18 mM nitrogen. All of the nitrogen concentrations significantly influenced lipid content yields (P < 0.05). Lipid productivity can be used to evaluate the relationship between lipid content and biomass in cells. Under low nitrogen concentrations, the lipid content of T. bernardii increased, but the biomass yields decreased. The trade-off between biomass yields and lipid content resulted in lipid productivity values that varied with nitrogen concentration (Fig. 3c). The highest lipid productivity measurement, 0.137 g L−1 day−1, was obtained with 3 mM nitrogen. The fatty acid composition profiles of T. bernardii during photoautotrophic cultivation were dominated by palmitic acid (C16:0), oleic acid (C18:1), linoleic acid (C18:2) and linolenic acid (18:3) that together contributed > 80% of the total cellular fatty acids (Table 1). The

3.3. The growth, lipid accumulation, and fatty acid composition of T. bernardii under heterotrophic culture conditions Varying concentrations of glucose were amended to the mBG-11 medium to investigate heterotrophic cultivation of T. bernardii under dark conditions while using 18 mM NaNO3 as the fixed nitrogen source (Fig. 4). The biomass yield of T. bernardii increased with glucose concentrations between 10 g L−1 and 30 g L−1 (Fig. 4a), with a maximum yield at a concentration of 10.40 g L−1. When the glucose concentration exceeded 30 g L−1, biomass yields decreased. The influence of glucose concentrations of 30 g L−1, 40 g L−1, 50 g L−1, and 60 g L−1 on biomass yields were not statistically significant (P > 0.05). The remainder of the glucose concentrations significantly influenced biomass yields (P < 0.05). The lipid content of T. bernardii varied with glucose concentration variation (Fig. 4b), with the highest lipid content of 33.38% dry weight that was achieved with 20 g L−1 glucose. Changes in lipid productivity of T. bernardii under heterotrophic culture conditions were similar to 67

Algal Research 37 (2019) 64–73

B. Gao et al.

Fig. 3. The effect of various nitrogen concentrations on the growth (a), lipid content (b) and lipid productivity (c) of T. bernardii under phototrophic culture conditions.

Fig. 4. The effect of varying glucose concentrations on the growth (a), lipid content (b) and lipid productivity (c) of T. bernardii under heterotrophic culture conditions.

the changes observed for biomass yield and lipid content. Increasing glucose concentrations from 10 g L−1 to 30 g L−1 first resulted in increases of lipid productivity, but lipid productivity decreased at glucose concentrations higher than 30 g L−1. The highest lipid productivity, 27 g L−1 day−1, was attained in the 30 g L−1 glucose concentration treatment. There was no significant difference in the individual fatty acids among the total fatty acids during heterotrophic growth and varying glucose concentrations, with the exception of the 10 g L−1 glucose treatment (Table 2). C16:0 and C18:1 were the major fatty acid constituents of T. bernardii and accounted for > 70% of the total fatty acids in heterotrophic cultures, which was nearly identical to that of the photoautotrophic culture. The polyunsaturated fatty acid content of cells in heterotrophic culture was much lower than that of photoautotrophic cultures, and especially when compared to photoautotrophic cultures grown with high nitrogen concentrations.

3.4. The growth, lipid accumulation, and fatty acid composition of T. bernardii under mixotrophic culture conditions During mixotrophic cultivation, the nitrogen concentration of 18 mM which was the original nitrogen concentration in the BG-11 medium was choose as the high nitrogen concentration treatment, and 3 mM which was the optimal nitrogen concentration to accumulate lipid productivity in the photoautotrophic culture was choose as the low nitrogen concentration treatment. An increase in T. bernardii biomass was observed with increases in glucose concentrations when the NaNO3 concentration was 18 mM and the glucose concentration ranged between 10 g L−1 to 30 g L−1 (Fig. 5a). However, the biomass yield gradually decreased when the glucose concentration was higher than 30 g L−1. The maximum biomass yield was 10.82 g L−1 which was twice that obtained under photoautotrophic conditions (5.27 g L−1, Fig. 3a). The biomass yields for all glucose treatments during mixotrophic culture conditions were significantly higher than those obtained under photoautotrophic culture conditions. Moreover, the biomass yields of mixotrophic cultures were much higher than that under

Table 1 Fatty acid composition of T. bernardii grown with varying nitrogen levels in photoautotrophic culture conditions. Nitrogen concentration

C16:0

C16:1

C16:2

C18:0

C18:1

C18:2

C18:3

SFA

MUFA

PUFA

18 mM 15 mM 12 mM 9 mM 6 mM 3 mM 1 mM

34.67 34.73 33.58 30.83 27.26 29.54 25.66

1.43 1.57 1.56 1.78 2.25 2.23 2.11

1.07 1.63 1.61 2.05 3.06 2.70 2.82

2.75 2.50 2.69 3.19 3.56 3.63 3.23

22.46 25.14 28.28 34.02 40.20 44.13 47.62

12.57 12.97 12.47 11.32 11.06 7.67 8.15

12.76 11.75 10.81 8.57 8.01 7.63 7.65

37.42 37.23 36.27 34.02 30.82 33.17 28.89

23.89 26.71 29.84 35.8 42.45 46.36 49.73

26.40 26.35 24.89 21.94 22.13 18.00 18.62

68

Algal Research 37 (2019) 64–73

B. Gao et al.

Table 2 The fatty acids compositions of T. bernardii grown under different glucose concentrations in heterotrophic culture. Glucose concentration −1

10 g L 20 g L−1 30 g L−1 40 g L−1 50 g L−1 60 g L−1

C16:0

C16:1

C16:2

C18:0

C18:1

C18:2

C18:3

SFA

MUFA

PUFA

34.24 31.15 30.89 30.62 31.30 30.63

2.99 2.81 2.48 2.45 2.87 2.77

2.47 2.22 2.23 2.28 2.18 2.36

4.93 7.38 7.76 7.34 7.35 6.58

35.78 40.10 41.41 41.11 40.52 40.96

8.65 8.29 8.28 8.51 7.90 8.29

4.22 3.32 3.62 3.83 3.56 3.77

39.17 38.53 38.65 37.96 38.65 37.20

38.77 42.91 43.89 43.56 43.39 43.73

15.35 13.83 14.13 14.61 13.65 14.41

concentrations were higher than 30 g L−1. The biomass yield gradually decreased with increasing glucose concentration when the nitrogen concentration was 3 mM (P > 0.05). The maximum biomass yield was 5.79 g L−1, which was higher than that of photoautotrophic cultures with the same nitrogen treatment. The lipid content of T. bernardii under mixotrophic culture conditions increased with increasing glucose concentrations when the NaNO3 concentration was 18 mM and the glucose concentration was between 10 g L−1 and 30 g L−1 (Fig. 5b). However, lipid content no longer increased when glucose concentrations were above 30 g L−1. The highest lipid content obtained was 54.74% of dry weight, which was 1.87 times that obtained in the photoautotrophic culture. In addition, the lipid contents from all glucose treatments under mixotrophic culture conditions were significantly higher than those obtained from photoautotrophic cultures. The lipid contents from mixotrophic cultures were also significantly higher than those from heterotrophic cultures when comparing yields from the same nitrogen and glucose conditions for each. With a nitrogen concentration of 3 mM, the lipid content of T. bernardii gradually decreased with increasing glucose concentration (P > 0.05). The maximum lipid content obtained was 51.52% of dry weight, which was not significantly different from the lipid content obtained from photoautotrophic cultures (51.62%) grown under the same conditions (Fig. 3b). Changes in lipid productivity of T. bernardii under mixotrophic culture conditions were similar to the changes observed for biomass yields and lipid content. The lipid productivity first increased with increasing glucose concentration when the NaNO3 concentration was 18 mM, but then gradually decreased. The highest lipid productivity, 0.33 g L−1 day−1, was attained with the 30 g L−1 glucose concentration treatment. The lipid productivity decreased with increasing glucose concentrations in the 3 mM nitrogen treatment. The highest lipid productivity, 0.17 g L−1 day−1, was attained with the 10 g L−1 glucose treatment. Under high nitrogen amendment (18 mM) during mixotrophic culture conditions, the content of saturated and polyunsaturated fatty acids among total fatty acids decreased with increasing glucose concentrations (Table 3). In contrast, monounsaturated fatty acid content increased with increasing glucose concentration treatments. Under low nitrogen amendment (3 mM), the differences of each fatty acid among the different glucose treatments were much lower when compared against the high nitrogen treatment.

Fig. 5. The effect of varying glucose concentrations and nitrogen concentrations on the growth (a), lipid content (b) and lipid productivity (c) of T. bernardii under mixotrophic culture conditions.

heterotrophic culture conditions when the glucose concentration was between 10 and 20 g L−1. This was especially evident for the glucose treatment of 10 g L−1, wherein biomass yield was 1.8 times higher than that obtained in heterotrophic cultures. However, heterotrophic culture yields were superior to those of mixotrophic cultures when glucose

Table 3 The fatty acids compositions of T. bernardii grown under different nitrogen concentrations and glucose concentrations in mixotrophic culture. Concentration

C16:0

C16:1

C16:2

C18:0

C18:1

C18:2

C18:3

SFA

MUFA

PUFA

18 mM–10 g L−1 18 mM–20 g L−1 18 mM–30 g L−1 18 mM–40 g L−1 18 mM–50 g L−1 3 mM–10 g L−1 3 mM–20 g L−1 3 mM–30 g L−1 3 mM–40 g L−1 3 mM–50 g L−1

34.67 34.73 33.58 30.83 27.26 30.53 29.42 25.84 25.95 26.17

1.43 1.57 1.56 1.78 2.25 2.18 2.19 2.00 2.07 2.40

1.07 1.63 1.61 3.05 3.06 2.50 2.52 3.19 3.20 3.16

2.75 2.50 2.69 3.19 3.56 4.74 4.88 4.09 3.90 3.84

22.46 25.14 28.28 34.02 40.20 43.63 44.27 44.42 44.06 43.63

12.57 12.97 12.47 11.32 11.06 6.40 7.02 9.82 9.83 9.44

12.76 11.75 10.81 8.57 8.01 5.73 5.87 8.00 8.19 8.27

37.42 37.23 36.27 34.02 30.82 36.95 36.38 34.39 34.26 35.53

23.89 26.71 29.84 35.8 42.45 38.48 44.96 43.29 41.56 40.56

26.40 26.35 24.89 22.94 22.13 21.14 15.78 18.27 21.10 19.80

69

Algal Research 37 (2019) 64–73

B. Gao et al.

nine when the nitrogen concentration was 18 mM. The biomass in the heterotrophic culture at the same time point was 8.0 g L−1 when the nitrogen concentration was 18 mM. Evaluation of the residual nitrogen in the culture medium under different trophic modes revealed that the nitrogen absorption rate by T. bernardii was very rapid (Fig. 6b). At the early stages of culture, nitrogen was quickly taken up in the photoautotrophic cultures, resulting in 92.2% and 91.2% of the initial nitrogen being absorbed by the second day in the high and low nitrogen treatments, respectively. The nitrogen absorption rate at the initial stage of mixotrophic culture growth was lower than that of the photoautotrophic cultures, but higher than that in the heterotrophic cultures. The residual nitrogen in the culture medium under mixotrophic culture conditions was lowest after the second day, and the residual nitrogen in the medium on the ninth day was only 1.6% of the initial nitrogen in the high nitrogen treatment. In contrast, nitrogen was completely taken up at the early stage of the low nitrogen treatment cultures. The nitrogen absorption rates of the heterotrophic cultures were much lower compared to the other two nutritional modes, but there was only about 3% of the initial nitrogen remaining in the medium at the end of the experiments in the high and low nitrogen treatments. Evaluation of the residual glucose in the medium indicated that the glucose absorption rates in heterotrophic cultures were significantly higher than that of mixotrophic cultures under the same nitrogen treatment conditions (Fig. 6c). The glucose absorption rate in the high nitrogen treatment (initial 18 mM nitrogen) was significantly higher than that in the low nitrogen treatment (initial 3 mM nitrogen). After nine days of culture under heterotrophic conditions and high nitrogen treatment, 93% of the glucose in the medium was absorbed by T. bernardii. However, only 38.95% of the glucose was absorbed from the medium in the low nitrogen treatment cultures. The glucose absorption rate of the mixotrophic cultures were inhibited compared with the heterotrophic cultures. Lastly, T. bernardii eventually absorbed 68.35% and 9.2% of the total glucose in the media under mixotrophic culture conditions in the high and low nitrogen treatments, respectively. 4. Discussion Nitrogen concentrations significantly influence the growth and lipid accumulation of T. bernardii. Nitrogen is essential for the growth of microalgae, but the supply of nitrogen is not the more the better for the growth of microalgae. During photoautotrophic cultivation of T. bernardii, the optimum nitrogen concentration was 9 mM, and the addition of more nitrogen was not conducive for biomass accumulation. Similarly, Griffiths et al. [22] observed that Chlorella vulgaris exhibited the highest growth rate when nitrate concentrations were between 40 and 100 mg L−1, but growth rates decreased when nitrate concentrations reached 2 g L−1. Thus, the optimal nitrogen concentrations for microalgal growth are species-dependent. Many microalgae can accumulate lipids when nitrogen supplies are limited, wherein neutral lipids in the form of triacylglycerols (TAG) are the dominant component [13]. For example, Chlorella protothecoides could accumulate high content of lipid which was 52.5% of dry weight under nitrogen deficiency [23]. Under 1 mM nitrogen treatment, the lipid content of photoautotrophic T. bernardii cultures reached 65.80% of dry weight, which was 2.40 times higher than that obtained under 18 mM nitrogen treatments. These results demonstrate that nitrogen deficiency is an effective way to promote lipid accumulation in T. bernardii. Further, these results also demonstrate that T. bernardii is an oleaginous microalga that can accumulate high lipid content. Although many studies concerning microalgal growth and lipid content yields have been conducted, the relationship between lipid accumulation and the degree of nitrogen limitation required for lipid accumulation has remained unclear. Adams et al. [24] compared the effects of higher nitrogen limitation (4 mM treatment) and lower nitrogen limitation (11 mM and 16 mM treatments) on the lipid accumulation of six

Fig. 6. The effect of varying nitrogen concentrations on the growth (a), nitrogen absorption rate (b), and glucose absorption rate (c) of T. bernardii under different trophic culture conditions. P, photoautotrophic culture; M, mixotrophic culture; H, heterotrophic culture.

3.5. The growth, nitrogen assimilation, and glucose uptake rate of T. bernardii under different culture conditions With increasing culture times, the biomass yields of T. bernardii increased gradually under different nutritional modes (Fig. 6a). The growth rates of mixotrophic and heterotrophic cultures at high nitrogen concentration (18 mM) were significantly higher than those of other experimental groups. In addition, the initial growth rate of mixotrophic cultures was higher than those of photoautotrophic and heterotrophic cultures when comparing experiments with the same nitrogen concentrations. The growth rates of cultures in the high nitrogen treatments were higher than those in the low nitrogen treatments under different nutritional cultivation modes. This was especially evident for the heterotrophic and mixotrophic cultures. The maximum biomass obtained overall (8.46 g L−1) was from the mixotrophic culture on day 70

Algal Research 37 (2019) 64–73

B. Gao et al.

cultivation. Park [36] observed that 14 species of microalgae had higher biomass and fatty acid yields under mixotrophic culture conditions than under photoautotrophic culture conditions. Further, Bhatnagar et al. [37] observed that the biomass yields of Chlamydomonas globosa, Chlorella minutissima, and Scenedesmus bijuga grown in mixotrophic cultures were 3–10 times higher than those obtained under corresponding photoautotrophic culture conditions. One reason for higher biomass yields from mixotrophic cultures could be that pH is more stable, because CO2 is absorbed during photosynthesis and released under respiration. In photoautotrophic cultures, the pH can increase to higher than 10, whereas it can remain stable around 7 in mixotrophic cultures [38]. It is important to note that the biomass yield of mixotrophic cultures depend on several factors including algal strains, the type and concentration of carbon sources, the intensity of light, and other components of the culture medium. For example, the addition of some carbon sources in the photoautotrophic culture of some algae would inhibit growth, while it would promote growth for others [39]. Photosynthesis and oxidative phosphorylation are independent in some algae, and thus the growth rate under mixotrophic culture conditions is the sum of the growth rate under photoautotrophic and heterotrophic conditions. Under some culture conditions, the presence of organic carbon inhibits the ability of some microalgae to release oxygen during photosynthesis in addition to the activity of enzymes involved in the Calvin cycle [40]. In contrast, photosynthetic inorganic carbon fixation can be affected by light intensity under mixotrophic conditions, while the absorption and assimilation of heterotrophic carbon can be affected by organic carbon concentrations. Thus, growth in mixotrophic cultures is affected by light intensity, types and concentrations of available organic carbon, and CO2 concentrations [41,42]. Mixotrophic cultivation can not only improve the yield of microalgal biomass, but also promote lipid accumulation. Ratha et al. [43] observed that the lipid productivity of 20 different species of Cyanobacteria and green algae were highest under mixotrophic growth compared with heterotrophic and photoautotrophic growth. Comparison of current study with previous reports of microalgae under three different culture modes, the biomass and lipid content of T. bernardii was higher than other microalgae under mixotrophic culture (Table 4). However, the lipid contents of cells in mixotrophic cultures also depend

oleaginous microalgal species. The results indicated that some microalgae first grew and then accumulated lipids (Chlorella sorokiniana and Scenedesmus naegelii). In contrast, others (Chlorococcum oleofaciens, Chlorella vulgaris, Neochloris oleoabundans, and Scenedesmus dimorphus) synchronized growth and lipid accumulation to improve lipid production. At 3 mM nitrogen, photoautotrophic cultures of T. bernardii achieved high biomass yields and accumulated high lipid contents simultaneously, consequently achieving maximum lipid productivity. T. bernardii can use organic carbon sources for heterotrophic growth under dark conditions. The addition of organic carbon sources to microalgal culture media results in changes from photosynthetic autotrophic growth to heterotrophic or mixotrophic growth in several species [25,26]. Generally, the biomass yields obtained from heterotrophic cultures are much higher than those obtained from photoautotrophic cultures. The biomass yield of most photosynthetic organisms has been observed as lower than 5 g L−1, but under heterotrophic cultivation, the biomass density of Chlorella pyrenoidosa reached 10.5 g L−1 at 72 h with fast growth rate, and the biomass yield of Chlorella protothecoides was observed to reach 15.5 g L−1, and that for Tetraselmis suecica observed to reach 28.8 g L−1 [27–29]. The biomass yields of T. bernardii observed in heterotrophic culture conditions here were also significantly higher than those obtained during photoautotrophic cultivation. However, heterotrophic cultivation also significantly influenced the lipid content of T. bernardii. During photoautotrophic cultivation, the lipid content of T. bernardii was as high as 60% of the dry weight, while the lipid content decreased to only 34% of the dry weight during heterotrophic cultivation. This result was similar to other oleaginous microalgae that exhibited increases in biomass yield, but decreases in lipid content when heterotrophically grown rather than photoautotrophically cultivated [11]. However, other microalgae exhibit the opposite effect. For example, the lipid content of C. protothecoides increased from 15% in photoautotrophic culture to > 50% in heterotrophic culture [30]. In other microalgae like Scenedesmus quadricauda, biomass yields increased, but lipid content did not change when switching trophic modes from photoautotrophy to heterotrophy [31]. During mixotrophic cultivation, T. bernardii exhibited higher biomass and lipid yields than obtained during photoautotrophic and heterotrophic cultivation, and this was especially evident at low glucose (30 g L−1) and high nitrogen (18 mM) treatments. In mixotrophic culture, growth does not depend entirely on light, since organic carbon is available as a carbon and energy source, and thus light is not an indispensable growth factor. Read [32] and Fernandez Sevilla [33] suggested that mixotrophic cultivation required relatively low light intensities for growth, thereby reducing energy costs of cultivation. In the experiments described here, light significantly affected glucose absorption. Under mixotrophic culture conditions, the glucose absorption rate of T. bernardii was significantly lower than that for heterotrophic cultures. In C. vulgaris, light inhibited the expression of hexose/H+ transport systems. Specifically, visible blue light significantly inhibited the absorption of hexoses, while red light only exhibited a slight effect on absorption [34]. When Chlorella is grown in a medium containing glucose, blue light controls many metabolic reactions including inhibition of absorption of glycine, proline, arginine and ammonia, but activates nitrate reductase and increases the absorption of oxygen and nitrate [35]. Similarly, the initial nitrate absorption by T. bernardii in heterotrophic culture conditions was significantly lower than that observed for photoautotrophic and mixotrophic culture conditions with light. At the same time, the glucose absorption rates of T. bernardii were also correlated with nitrogen concentrations, wherein the glucose absorption rate was significantly lower at low nitrogen concentrations than at high nitrogen concentrations. During the mixotrophic culture of many microalgae, the synergistic effects of photoautotrophic and heterotrophic metabolism result in an increase of biomass yields. The biomass yield of T. bernardii under mixotrophic culture conditions (18 mM nitrogen and 30 g L−1 glucose) was two-fold of that observed for photoautotrophic and heterotrophic

Table 4 Comparison of Tetradesmus bernardii with other microalgae under three different culture modes. Strain

Chlorella minutissima

Chlorella vulgaris UTEX 2714 Chlorella sorokiniana UTEX 1602 Marine Chlorella sp. Y81 Nannochloropsis sp.

Botryococcus braunii

Tetradesmus bernardii JNU15

Culture mode P H M P H M P H M P H M P H M P H M P H M

Biomass (g L−1) 0.07 0.14 0.38 0.4 0.75 1.4 0.47 2.78 4.57 0.22 0.17 0.45 0.37 0.38 1.20 1.14 1.75 2.46 5.27 10.4 10.82

Lipid content (% dry weight)

Reference

5.40 11.79 14.88 27.38 30.58 13.82 6.65 12.62 31.58 16.5 5.9 35.5 28.0 20.0 27.5 25.1 29.3 37.5 29.27 31.43 54.74

[44]

[39]

[12]

[45]

[46]

[47]

This study

Note: P, photoautotrophic culture; H, heterotrophic culture; M, mixotrophic culture. 71

Algal Research 37 (2019) 64–73

B. Gao et al.

Acknowledgments

on the carbon source, in addition to other properties. Liu et al. [48] reported that acetate could enhance the growth and neutral lipid content of C. pyrenoidosa in mixotrophic cultivation and improve its resilience against the stress from the high concentration of NH4+-N. In some mixotrophic cultures, the lipid content of algae was equivalent, or even lower than that obtained from cells during photoautotrophic growth (Table 4) [36,39,46]. In some algal strains and under certain culture conditions, mixotrophic growth did not significantly affect the lipid content of cells, and thus, increases in lipid productivity was primarily due to increases in biomass, as in C. vulgaris [38]. Under low nitrogen conditions (3 mM), the lipid content of mixotrophically grown T. bernardii was similar to that from photoautotrophic cultures. In contrast, the lipid content of mixotrophic T. bernardii cultures increased significantly with a high nitrogen concentration (18 mM). Specifically, the lipid content reached 54.74% of dry weight, which was even higher than the lipid content achieved in the low nitrogen treatment. In photoautotrophic cultures, nitrogen limitation was conducive to lipid accumulation, but inhibits cell growth. However, under mixotrophic conditions, biomass and lipid yields of T. bernardii increased simultaneously under high nitrogen concentrations. Hence, these processes lead to a higher lipid productivity for T. bernardii. Recently, the study of mixotrophic microalgae focused on the use of waste organic carbon source and wastewater remediation [1,5,36,37,44,49,50]. T. bernardii had flexible trophic modes, fast absorption rate of organic carbon source and nitrogen, which had great potential in application in N-rich wastewater treatment systems.

The research was supported by the following fundings: the Special Project of Application-oriented Technical Research and Development of Guangdong Province (No. 2015B020235007); the Natural Science Foundation of China (No. 31170337); the National High Technology Research and Development Program of China (863 Program) (No. 2013AA065805). We thank LetPub (www.letpub.com) for its linguistic assistance during the preparation of this manuscript. References [1] J. Lowrey, M.S. Brooks, P.J. McGinn, Heterotrophic and mixotrophic cultivation of microalgae for biodiesel production in agricultural wastewaters and associated challenges-a critical review, J. Appl. Phycol. 27 (2015) 1485–1498. [2] C. Yang, Q. Hua, K. Shimizu, Energetics and carbon metabolism during growth of microalgal cells under photoautotrophic, mixotrophic and cyclic light-autotrophic/ dark-heterotrophic conditions, Biochem. Eng. J. 6 (2000) 87–102. [3] J.C. Ogbonna, M.P. McHenry, Culture systems incorporating heterotrophic metabolism for biodiesel oil production by microalgae, Biomass and Biofuels From Microalgae, Springer, Cham, 2015, pp. 63–74. [4] Z. Zhang, B. Wang, Q. Hu, M. Sommerfeld, Y. Li, D. Han, A new paradigm for producing astaxanthin from the unicellular green alga Haematococcus pluvialis, Biotechnol. Bioeng. 113 (2016) 2088–2099. [5] Y. Cheng, W. Zhou, C. Gao, K. Lan, Y. Gao, Q. Wu, Biodiesel production from Jerusalem artichoke (Helianthus Tuberosus L.) tuber by heterotrophic microalgae Chlorella protothecoides, Soc. Chem. Ind. 84 (2009) 777–781. [6] F. Hillig, N. Porscha, S. Junne, P. Neubauer, Growth and docosahexaenoic acid production performance of the heterotrophic marine microalgae Crypthecodinium cohnii in the wave-mixed single-use reactor CELL-tainer, Eng. Life Sci. 14 (2014) 254–263. [7] O. Graverholt, N. Eriksen, Heterotrophic high cell-density fed-batch and continuous flow cultures of Galdieria sulphuraria and production of phycocyanin, Appl. Microbiol. Biotechnol. 77 (2007) 69–75. [8] D. Morales-Sanchez, R. Tinoco, J. Kyndt, A. Martinez, Heterotrophic growth of Neochloris oleoabundans using glucose as a carbon source, Biotechnol. Biofuels 6 (2013) 1–12. [9] O. Perez-Garcia, Y. Bashan, Microalgal heterotrophic and mixotrophic culturing for bio-refining: from metabolic routes to techno-economics, Algal Biorefineries, Springer, Cham, 2015, pp. 61–131. [10] M. Wan, P. Lie, J. Xia, J.N. Rosenberg, G.A. Oyler, M.J. Betenbaugh, Z. Nie, G. Qiu, The effect of mixotrophy on microalgal growth, lipid content, and expression levels of three pathway genes in Chlorella sorokiniana, Appl. Microbiol. Biotechnol. 91 (2011) 835–844. [11] Y.N. Liang, N. Sarkany, Y. Cui, Biomass and lipid productivities of Chlorella vulgaris under autotrophic, heterotrophic and mixotrophic growth conditions, Biotechnol. Lett. 31 (2009) 1043–1049. [12] T. Li, Y. Zheng, L. Yu, S. Chen, Mixotrophic cultivation of a Chlorella sorokiniana strain for enhanced biomass and lipid production, Biomass Bioenergy 66 (2014) 204–213. [13] Q. Hu, M. Sommerfeld, E. Jarvis, M. Ghirardi, M. Posewitz, M. Seibert, A. Darzins, Microalgal triacylglycerols as feedstocks for biofuel production: perspectives and advances, Plant J. 54 (2008) 621–639. [14] G. Prochazkova, I. Branyikova, V. Zachleder, T. Branyik, Effect of nutrient supply status on biomass composition of eukaryotic green microalgae, J. Appl. Phycol. 26 (2014) 1359–1377. [15] J.L. Johnson, M.W. Fawley, K.P. Fawley, The diversity of Scenedesmus and Desmodesmus (Chlorophyceae) in Itasca State Park, Minnesota, USA, Phycologia 46 (2007) 214–229. [16] B. Gao, J. Yang, X. Lei, S. Xia, A. Li, C. Zhang, Characterization of cell structural change, growth, lipid accumulation, and pigment profile of a novel oleaginous microalga, Vischeria stellata (Eustigmatophyceae), cultured with different initial nitrate supplies, J. Appl. Phycol. 28 (2016) 821–830. [17] I. Khozin-Goldberg, P. Shrestha, Z. Cohen, Mobilization of arachidonyl moieties from triacylglycerols into chloroplastic lipids following recovery from nitrogen starvation of the microalga Parietochloris incisa, Biochim. Biophys. Acta 1738 (2005) 63–71. [18] P.M. Tsarenko, D.M. John, Phylum Chlorophyta, Order Sphaeropleales sensu lato, in: D.M. John, B.A. Whitton, A.J. Brook (Eds.), The Freshwater Algal Flora of the British Isles. An Identification Guide to Freshwater and Terrestrial Algae, second edition, Cambridge University Press, Cambridge, 2011, pp. 419–498. [19] E. Hegewald, C. Bock, L. Krienitz, A phylogenetic study on Scenedesmaceae with the description of a new species of Pectinodesmus and the new genera Verrucodesmus and Chodatodesmus (Chlorophyta, Chlorophyceae), Fottea 13 (2013) 14. [20] M.J. Wynne, J.K. Hallan, Reinstatement of Tetradesmus GM Smith (Sphaeropleales, Chlorophyta), Feddes Repertorium 126 (2015) 83–86. [21] B. Detelina, M. Rumen, Morphological variability in clonal cultures of Scenedesmus nygaardii Hub. Pest. and Scenedesmus bernardii G. M. Smith (Chlorophyta), Arch. Hydrobiologie Suppl. 142 (2002) 123–138. [22] M.J. Griffiths, R.P. van Hille, S.T.L. Harrison, The effect of nitrogen limitation on lipid productivity and cell composition in Chlorella vulgaris, Appl. Microbiol. Biotechnol. 98 (2014) 2345–2356.

5. Conclusions The novel T. bernardii isolate described here exhibited various nutritional modes allowing growth in photoautotrophic, heterotrophic, and mixotrophic culture conditions. The isolate is a new oleaginous microalga that can accumulate high biomass yields and lipid contents, and exhibited a maximum lipid content of > 65% of dry weight. Mixotrophic cultivation of T. bernardii achieved maximum lipid productivity under high nitrogen treatment due to the ability to synchronously accumulate lipids and biomass. The glucose absorption rate of T. bernardii under mixotrophic culture conditions with light also decreased compared to heterotrophic cultures in dark conditions. These results indicate that light has a certain inhibitory effect on the absorption of glucose. However, the cellular growth rate under mixotrophic culture conditions was higher than in photoautotrophic and heterotrophic culture conditions. These observations, when taken together, suggest that T. bernardii simultaneously conducts photoautotrophic and heterotrophic metabolisms during mixotrophic cultivation. The glucose absorption rate was also correlated with nitrogen concentrations, wherein the glucose absorption rate was significantly lower at low nitrogen concentrations than at high nitrogen concentrations. The fatty acid composition of T. bernardii comprised > 70% saturated fatty acids (i.e., palmitic acid (C16:0), stearic acid (C18:0)) and monounsaturated fatty acids (i.e., palmitoleic acid (C16:1), oleic acid (C18:1)). Declaration of author contributions Ideation and design of experiment was done by Chengwu Zhang and Baoyan Gao; development and optimization of experimental methods was done by Baoyan Gao and Luodong Huang; collection of experiment data was done by Baoyan Gao and Ailing Chen. preparation and writing of the manuscript was done by Baoyan Gao, Feifei Wang and Chengwu Zhang. The authors declare no potential financial or other interests that could be perceived to influence the outcomes of the research. No conflicts, informed consent, human or animal rights applicable. All authors agree to authorship and submission of the manuscript for peer review. 72

Algal Research 37 (2019) 64–73

B. Gao et al.

[23] Y. Li, F. Han, H. Xu, J. Mu, D. Chen, B. Feng, H. Zeng, Potential lipid accumulation and growth characteristic of the green alga Chlorella with combination cultivation mode of nitrogen (N) and phosphorus (P), Bioresour. Technol. 174 (2014) 24–32. [24] C. Adams, V. Godfrey, B. Wahlen, L. Seefeldt, B. Bugbee, Understanding precision nitrogen stress to optimize the growth and lipid content tradeoff in oleaginous green microalgae, Bioresour. Technol. 131 (2013) 188–194. [25] G.Q. Chen, F. Chen, Growing phototrophic cells without light, Biotechnol. Lett. 28 (2006) 607–616. [26] O. Perez-Garcia, F.M.E. Escalante, L.E. de-Bashan, Y. Bashan, Heterotrophic cultures of microalgae: metabolism and potential products, Water Res. 45 (2011) 11–36. [27] J. Fan, Y. Cui, Y. Zhou, M. Wan, W. Wang, J. Xie, Y. Li, The effect of nutrition pattern alteration on Chlorella pyrenoidosa growth, lipid biosynthesis-related gene transcription, Bioresour. Technol. 164 (2014) 214–220. [28] H. Xu, X. Miao, Q. Wu, High quality biodiesel production from microalga Chlorella protothecoides by heterotrophic growth in fermenters, J. Biotechnol. 126 (2006) 499–507. [29] M. Azma, M.S. Mohamed, R. Mohamad, R.A. Rahim, A.B. Ariff, Improvement of medium composition for heterotrophic cultivation of green microalgae, Tetraselmis suecica, using response surface methodology, Biochem. Eng. J. 53 (2011) 187–195. [30] X.L. Miao, Q. Wu, Biodiesel production from heterotrophic microalgal oil, Bioresour. Technol. 97 (2006) 841–846. [31] R.N. Jimenez, G.M.D.C. Ceron, M.A. Sanchez, H.E.H. Belarbi, C.F. García, G.E. Molina, Lipids accumulation in Chlorella protothecoides through mixotrophic and heterotrophic cultures for biodiesel production, New Biotechnol. 25 (2009) S266. [32] H. Read, S. Reads, B. Park, The estimation of algal yield parameters associated with mixotrophic and photoheterotrophic growth under batch cultivation, Biomass 18 (1989) 153–160. [33] J.M. Fernandez Sevilla, M.C. Ceron Garcia, A. Sanchez Miron, E. Belarbi, F. Garcia Camacho, E. Molina Grima, Pilot plant-scale outdoor mixotrophic cultures of Phaeodactylum tricornutum using glycerol in vertical bubble column and airlift photobioreactors: studies in fed-batch mode, Biotechnol. Prog. 20 (2004) 728–736. [34] A. Kamiya, W. Kowallik, Photoinhibition of glucose uptake in Chlorella, Plant Cell Physiol. 28 (1987) 611–619. [35] A. Kamiya, T. Saitoh, Blue-light-control of the uptake of amino acids and of ammonia in Chlorella mutants, Physiol. Plant. 116 (2002) 248–254. [36] K.C. Park, C. Whitney, J.C. McNichol, K.E. Dickinson, S. MacQuarrie, B.P. Skrupski, J. Zou, K.E. Wilson, S.J.B. O'Leary, P.J. McGinn, Mixotrophic and photoautotrophic cultivation of 14 microalgae isolates from Saskatchewan, Canada: potential applications for wastewater remediation for biofuel production, J. Appl. Phycol. 24 (2012) 339–348. [37] A. Bhatnagar, S. Chinnasamy, M. Singh, Renewable biomass production by

[38]

[39]

[40]

[41]

[42]

[43]

[44]

[45]

[46]

[47]

[48]

[49]

[50]

73

mixotrophic algae in the presence of various carbon sources and wastewaters, Appl. Energy 88 (2011) 3425–3431. W. Kong, H. Song, Y. Cao, H. Yang, S. Hua, C. Xia, The characteristics of biomass production, lipid accumulation and chlorophyll biosynthesis of Chlorella vulgaris under mixotrophic cultivation, Afr. J. Biotechnol. 10 (2011) 11620–11630. T. Heredia-Arroyo, W. Wei, R. Ruan, B. Hu, Mixotrophic cultivation of Chlorella vulgaris and its potential application for the oil accumulation from non-sugar materials, Biomass Bioenergy 35 (2011) 2245–2253. X.J. Liu, S. Duan, A. Li, Z. Cai, Z. Hu, Effects of carbon sources on growth, photosynthesis and respiration of Phaeodactylum tricornutum, J. Appl. Phycol. 21 (2009) 239–246. J.C. Ogbonna, E. Ichige, H. Tanaka, Interactions between photoautotrophic and heterotrophic metabolism in photoheterotrophic culture of Euglena gracilis, Appl. Microbiol. Biotechnol. 58 (2002) 532–538. J.C. Ogbonna, E. Ichige, H. Tanaka, Regulating the ratio of photoautotrophic to heterotrophic metabolic activities in photoheterotrophic culture of Euglena gracilis and its application to αtocopherol production, Biotechnol. Lett. 24 (2002) 953–958. S.K. Ratha, S. Babu, N. Renuka, R. Prasanna, R. Badari, N. Prasad, A.K. Saxena, Exploring nutritional modes of cultivation for enhancing lipid accumulation in microalgae, J. Basic Microbiol. 53 (2013) 440–450. A. Bhatnagar, M. Bhatnagar, S. Chinnasamy, K.C. Das, Chlorella minutissima—a promising fuel alga for cultivation in municipal wastewaters, Appl. Biochem. Biotechnol. 161 (2010) 523–536. T.S. Lin, J.Y. Wu, Effect of carbon sources on growth and lipid accumulation of newly isolated microalgae cultured under mixotrophic condition, Bioresour. Technol. 184 (2015) 100–107. B. Cheirsilp, S. Torpee, Enhanced growth and lipid production of microalgae under mixotrophic culture condition: effect of light intensity, glucose concentration and fed-batch cultivation, Bioresour. Technol. 110 (2012) 510–516. C. Yeesang, B. Cheirsilp, Low-cost production of green microalga Botryococcus braunii biomass with high lipid content through mixotrophic and photoautotrophic cultivation, Appl. Biochem. Biotechnol. 174 (2014) 116–129. L. Liu, Y. Zhao, X. Jiang, X. Wang, W. Liang, Lipid accumulation of Chlorella pyrenoidosa under mixotrophic cultivation using acetate and ammonium, Bioresour. Technol. 262 (2018) 342–346. S. Chaiprapat, T. Sasibunyarat, B. Charnnok, B. Cheirsilp, Intensifying clean energy production through cultivating mixotrophic microalgae from digestates of biogas systems: effects of light intensity, medium dilution, and cultivating time, BioEnergy Res. 10 (2017) 103–114. I.K. Engin, D. Cekmecelioglu, A.M. Yücel, H.A. Oktem, Evaluation of heterotrophic and mixotrophic cultivation of novel Micractinium sp. ME05 on vinasse and its scale up for biodiesel production, Bioresour. Technol. 251 (2018) 128–134.