- Email: [email protected]
Binding efficacy and kinetics of chitosan with DNA duplex: The effects of deacetylation degree and nucleotide sequences
Accepted Manuscript Title: Binding Efficacy and Kinetics of Chitosan with DNA Duplex: The Effects of Deacetylation Degree and Nucleotide Sequences Authors: Yanmei Yang, Meng Guo, Rui Qian, Chang Liu, Xumin Zong, Yong-Qiang Li, Weifeng Li PII: DOI: Reference:
S0144-8617(17)30429-0 http://dx.doi.org/doi:10.1016/j.carbpol.2017.04.040 CARP 12228
To appear in: Received date: Revised date: Accepted date:
21-12-2016 13-4-2017 18-4-2017
Please cite this article as: Yang, Yanmei., Guo, Meng., Qian, Rui., Liu, Chang., Zong, Xumin., Li, Yong-Qiang., & Li, Weifeng., Binding Efficacy and Kinetics of Chitosan with DNA Duplex: The Effects of Deacetylation Degree and Nucleotide Sequences.Carbohydrate Polymers http://dx.doi.org/10.1016/j.carbpol.2017.04.040 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Binding Efficacy and Kinetics of Chitosan with DNA Duplex: The Effects of Deacetylation Degree and Nucleotide Sequences Yanmei Yang1, Meng Guo2, Rui Qian3, Chang Liu1, Xumin Zong1, Yong-Qiang Li1* and Weifeng Li1* 1.
School for Radiological and Interdisciplinary Sciences (RAD-X) and Collaborative Innovation Center of Radiological Medicine of Jiangsu Higher Education Institutions, Soochow University, Suzhou 215123, China.
2.
Shandong Computer Science Center (National Supercomputer Centre in Jinan), Jinan 250101, P. R. China
3.
School of Biology and Basic Medical Sciences, Soochow University, Suzhou, 214123, China
* Corresponding authors. E-mail address: [email protected] (Y.-Q. Li) and [email protected] (W. F. Li)
Highlights
The binding kinetics between chitosan and DNA was studied at atomic-level through molecular dynamics simulations.
The GC-rich DNA was predicted to condensate easily by chitosan because its motion was more restrained than that of AT-rich DNA.
The chitosan binding caused more severe structural distortions to AT-rich DNA.
Abstract The binding process of DNA duplex with various types of chitosan polymers were studied at atomic level through molecular dynamics simulations. The interaction kinetics and binding strength, complex morphology and DNA structure evolution were systematically accessed. The binding efficacy of chitosan to DNA reduces (both in complexation speed and binding strength) when deacetylation degree is decreased, because protonated amine groups on chitosan backbone are more prone to bind with DNA, especially the phosphate oxygen, through coulomb interaction. The Watson Crick hydrogen bonds of A-T base pairs are more easily to break because chitosan is capable to form competitive hydrogen bonds with them. It is surprising to find that the G-C nucleotides have highly restrained kinetic motion than that of A-T nucleotides, which would be important for DNA-chitosan complexation and condensation to happen at the microscopic level. From our current results, the degree of chitosan deacetylation is found to play a certain role in regulating the DNA-chitosan
complexation process, but is not as important as being believed before. Other types of chemical functionalization that can tune the chitosan’s hydrophobicity should deserve more attentions in the experiment. Keywords: Chitosan; ; ; ; , Chitin, Deacetylation Degree, DNA Duplex, Molecular Dynamics Simulation
1. Introduction Chitosan is one important natural and biodegradable polysaccharide derived by deacetylation of chitin which is rich in the exoskeleton of crustaceans (crabs, shrimp, etc.) and cell walls of fungi(Borchard, 2001; Onishi & Machida, 1999; Ravi Kumar, 2000; Sannan, Kurita & Iwakura, 1976). Structurally, this co-polymer is composed of repeating D-glucosamine and N-acetyl-D-glucosamine (NAG) units linked via (1–4) glycosidic bonds(Onishi & Machida, 1999). The term chitosan is usually used to describe a series of polysaccharides with degree of deacetylation being higher than 40%(Sannan, Kurita & Iwakura, 1976). Chitosan possesses several advanced features – cheap, biocompatible, biodegradable and principally non-toxic – that are important for applications in biological and medical related areas(Borchard, 2001; Cui & Mumper, 2001; Ilium, 1998; Illum, Jabbal-Gill, Hinchcliffe, Fisher & Davis, 2001; Köping-Höggård et al., 2001; Kumar, Muzzarelli, Muzzarelli, Sashiwa & Domb, 2004; Lavertu, Methot, Tran-Khanh & Buschmann, 2006; Leong, Mao, Truong-Le, Roy, Walsh & August, 1998; Li et al., 2011; Lim, Martin, Berry & Brown, 2000; Mao et al., 2001; Monck et al., 2000; Mumper, Wang, Claspell & Rolland, 1995; Pack, Hoffman, Pun & Stayton, 2005; Roy, Mao, Huang & Leong, 1999; Sato, Ishii & Okahata, 2001). In the agricultural and pharmaceutical industries, chitosan has been widely used as a dietary supplement, wound healing biomaterial and pharmaceutical excipient (Ilium, 1998; Kumar, Muzzarelli, Muzzarelli, Sashiwa & Domb, 2004). In drug delivery, chitosan has found applications in direct tablet compression, tablet disintegrant, and production of gels and micro-nanoparticles for controlled drug release or for the improvement of drug as dissolution(Borchard, 2001; Cui & Mumper, 2001; Ilium, 1998; Illum, Jabbal-Gill, Hinchcliffe, Fisher & Davis, 2001; Köping-Höggård et al., 2001; Kumar, Muzzarelli, Muzzarelli, Sashiwa & Domb, 2004; Lavertu, Methot, Tran-Khanh & Buschmann, 2006; Leong, Mao, Truong-Le, Roy, Walsh & August, 1998; Mao et al., 2001; Monck et al., 2000; Mumper, Wang, Claspell & Rolland, 1995; Pack, Hoffman, Pun & Stayton, 2005; Roy, Mao, Huang & Leong, 1999; Sato, Ishii & Okahata, 2001).
At physiological conditions, protonation of the primary amine groups of chitosan results in cationic chitosan chains, which demonstrates both antimicrobial activities(Li et al., 2011) and capability to form complexation with gene(Borchard, 2001; Cui & Mumper, 2001; Köping-Höggård et al., 2001; Leong, Mao, Truong-Le, Roy, Walsh & August, 1998; Mao et al., 2001; Mumper, Wang, Claspell & Rolland, 1995). In the recent decades, gene delivery research has attracted great research interest because of its huge potential as a promising therapeutic strategy in the treatment of inheritable or acquired diseases that needs defective gene replacement, missing gene substitution, or silencing of unwanted gene expression(Pack, Hoffman, Pun & Stayton, 2005; Panyam & Labhasetwar, 2003; Templeton, Lasic, Frederik, Strey, Roberts & Pavlakis, 1997; Wolff et al., 1990; Zufferey, Nagy, Mandel, Naldini & Trono, 1997). Gene transfection refers to the process of deliberately introducing genetic material into cells (eukaryotic or bacterial) by non-viral methods. Transfection can be carried out with chemical methods (using calcium phosphate, organic compounds, cationic liposomes and polymers) and non-chemical methods (by electroporation, cell squeezing, sonoporation). Among them, chitosan has gained increasing interest as one of the nonviral vectors for delivery of gene materials including oligonucleotides, plasmid DNA and siRNA, because of the intrinsic cationic nature and beneficial qualities including low toxicity, low immunogenicity, excellent biocompatibility(Borchard, 2001; Cui & Mumper, 2001; Ilium, 1998; Illum, Jabbal-Gill, Hinchcliffe, Fisher & Davis, 2001; Köping-Höggård et al., 2001; Mao et al., 2001; Panyam & Labhasetwar, 2003; Ravi Kumar, 2000; Roy, Mao, Huang & Leong, 1999; Sato, Ishii & Okahata, 2001). Chitosan is an important polycation for charge-switching because of the abundance of amine groups with a pKa value of 6.4. Hence, at pH below 6.4, chitosan is cationic and readily forms particle complexes with anionic nucleic acids which can be used as DNA and siRNA transfection vehicles(Agirre, Zarate, Ojeda, Puras, Desbrieres & Pedraz, 2014; Alameh et al., 2012). Chitosan functionalized silica particles have been demonstrated to extract RNA from cancer cells more efficiently than the bare silica particles(Hagan, Meier, Ferrance & Landers, 2009). Very recently, Pandit and coworkers have utilized chitosan for DNA direct amplification. The chitosan
macroparticles can capture DNA at a pH of 8.5 just as efficiently as at low pH. The captured DNA is still accessible by polymerase which enables direct amplification of DNA(Pandit, Nanayakkara, Cao, Raghavan & White, 2015). The complexation of DNA with chitosan have a greater protection for DNA from degradation by nuclease and thus raises great research interest in the development of vaccines(Cui & Mumper, 2001; Illum, Jabbal-Gill, Hinchcliffe, Fisher & Davis, 2001). Moreover, chitosan has been demonstrated to be able to destabilize the lipid membrane, thus facilitates cellular uptake(Fang, Chan, Mao & Leong, 2001). Previous studies indicated that the formulation parameters of chitosan are determinative for the binding affinity of chitosan to DNA as well as transfection efficiency of DNA-chitosan complexes, these include degree of deacetylation, molecular weight of chitosan, the charge ratio of amine (chitosan) to DNA phosphate (N/P ratio), the chitosan/DNA concentration, pH value of the transfection medium, cell type, preparation technique of DNA-chitosan nanoparticles and so on(Borchard, 2001; Köping-Höggård et al., 2001; Kiang, Wen, Lim & Leong, 2004; Lavertu, Methot, Tran-Khanh & Buschmann, 2006; Liu et al., 2005; Romøren, Pedersen, Smistad, Evensen & Thu, 2003; Sato, Ishii & Okahata, 2001; Strand, Danielsen, Christensen & Vårum, 2005). The first report of self-assembling of oligomeric DNA-chitosan complexes was in 1995 by mixing a solution of chitosan with plasmid DNA(Mumper, Wang, Claspell & Rolland, 1995). Despite the achieved flourishing experimental studies in the recent two decades of DNA-chitosan nanostructures for gene delivery, fundamental knowledge of how chitosan is complexed with DNA duplex is poorly documented. In sharp contrast to proteins which have well defined secondary and tertiary structures (determined by their sequences), the double-stranded DNAs uniformly adopt helical structure (B- or A-form) irrespective of their sequence. It is unknown whether chitosan binds to DNA in a specific binding manner or just homogeneously to all types of nucleotides. The computer molecular dynamics (MD) simulation studies, which is a powerful tool to understand the inter-molecule interactions at the atomic level, is sparse for the DNA-chitosan system. This is, to a certain extent, because of
lacking of an accurate model of hydrocarbons in MD simulations which lags behind the rapid process of the experiments. Recently, hydrocarbon models parameterized for chitosan and chitin have been developed to study the structural characterization of chitin and chitosan in aqueous solution taking the degrees of deacetylation into account(Franca, Freitas & Lins, 2011; Franca, Lins, Freitas & Straatsma, 2008). This makes MD simulations of DNA-chitosan possible and raises an urgent need for a systematic study on the structural and conformational behaviors of DNA-chitosan complex in solution that is quite essential for the design of efficient gene delivery platform. Here, we use the MD simulations to characterize the binding patterns and kinetics of chitosan interacting with DNA duplex. The influence of deacetylation degree of chitosan on the DNA binding efficacy, conformation and motion has been addressed. These findings are compared with experimental data and would provide a clear insight for the design and development of optimal chitosan platforms for gene delivery and other medical related applications. 2. Simulation Details The model to simulate the chitosan and chitin was a 10-mer polysaccharide chain. Following previous studies(Franca, Freitas & Lins, 2011; Franca, Lins, Freitas & Straatsma, 2008), we have considered three systems with different degrees of deacetylation: 1) CHS1.0, 100% deacetylation; 2) CHS0.6, 60% deacetylation and 3) CHT, 0% deacetylation (strictly, this should be classified as chitin). The specific sequences of the polysaccharides (glucosamine, protonated glucosamine and Nacetylglucosamine) can be found in Table 1. The backbone of chitosan (glucosamine units) is rich in primary amine groups (pKa ~ 6.3-6.5). The protonation state of chitosan is dependent on pH. At pH 5.5-5.7, around 90% of the amine groups are protonated(Mao et al., 2001). While at physiological pH, the degree of protonation is reduced. The protonation states of the amine groups for CHS1.0 and CHS0.6 were settled to be 50% following previous studies(Franca, Freitas & Lins, 2011; Franca,
Lins, Freitas & Straatsma, 2008). The details of the chitosan and chitin model are listed in Table 1. a
CHS, chitosan; CHT, chitin.
b
d, glucosamine; p, protonated glucosamine; c, N-acetylglucosamine.
An isolated double-stranded 23-mer DNA (sequence: GGCGGCGGCGCGGCGTTTTTTGG)(Strauss & Maher, 1994) was adopted to interact with chitosan and chitin. The solvation statistics and stability of this DNA has been thoroughly studied in our previous study(Li, Nordenskiöld & Mu, 2011). The DNA structure was constructed by the Nucleic Acid Builder as implemented in Amber Tools package(D.A. Case, 2016). As shown in Fig. 1A, the DNA and chitosan were placed parallel to each other with an initial separation of ~ 1.5 nm. The complex was then solvated in a 10 × 10 × 10 nm3 cubic box with periodic boundary conditions applied in all directions. Since both chitosan (CHS1.0: +5 |e|, CHS0.6: +3 |e|) and DNA (-46 |e|) molecules carry net charges, Na+ counter-ions were firstly added in the simulation box to neutralize the simulation systems (41 Na+ for CHS1.0, 43 Na+ for CHS0.6 and 46 Na+ for CHT). In addition, 23 NaCl salt and ~32500 water (represented by SPC water model(Berendsen, Postma, van Gunsteren & Hermans, 1981)) were further added following our previous studies(Li, Nordenskiöld & Mu, 2011). The box contents can be found in in Table 1. The GROMOS 53A6 parameter set with extension to chitin and chitosan(Franca, Freitas & Lins, 2011; Franca, Lins, Freitas & Straatsma, 2008) was used. All the simulations were conducted using the GROMACS program(David Van Der, Erik, Berk, Gerrit, Alan & Herman, 2005). Each system was firstly energy minimized for 10,000 steps using the steepest descent method. After minimization, the solvent (including salt ions) was pre-equilibrated by performing 5 ns MD simulation at 300 K, while DNA and chitosan atoms are positionally restrained with a force constant of 1000 kJ ∙ mol-2 ∙ nm-1. Following the pre-equilibration, productive simulations were conducted for data collection. To enhance the sampling efficiency, five parallel trajectories (with different initial velocities) were generated for each chitosan model.
All the numerical data presented in the discussions are averaged over five trajectories for each case unless otherwise stated. All the simulations were conducted at constant pressure (1 atm) and constant temperature (300 K) by using a velocity-rescale thermostat(Bussi, Donadio & Parrinello, 2007) with a coupling coefficient of τT = 0.1 ps. The Particle Mesh Ewald (PME) method(Darden, York & Pedersen, 1993) was adopted to treat the long-range electrostatic interactions, whereas the van der Waals interactions (Lennard-Jones potential) were handled with a cutoff distance of 1.2 nm. The bond lengths involving hydrogen atoms were constrained with the LINCS algorithm(Berk, Henk, Herman & Johannes, 1997). For each trajectory, 100 ns dataproductive simulation was conducted. A time step of 2.0 fs was used for movement integration, and data were collected every 1.0 ps. 3. Results and Discussion Through simulations, the three chitosan models (CHS1.0, CHS0.6 and CHT) were found to be capable to bind to DNA duplex. Although the initial separation between chitosan and DNA was ~ 1.5 nm, the chitosan typically would find and touch DNA atoms within several nano-seconds (ns). The binding characteristics are first examined by monitoring the time evaluation of interaction patterns between chitosan and DNA in a representative trajectory (CHS1.0 with DNA, demonstrated in Fig. 1B). At the early stage of the simulation, the chitosan diffused freely in the solvent and touched the DNA backbone atoms at 1.5 ns after the simulation began. After onset of the initial contacting, a quick binding process happened until a stable binding has formed at around 3 ns. Along with chitosan binding, structural distortions were detected at DNA terminus, where the Watson Crick hydrogen bonds (H-bonds) began to break. Accompanied with the H-bond breaking, the released nucleotide bases bent back to form contacts with the chitosan chain (as seen in snapshots at 25 and 70 ns). At the end of the simulation, ultimate binding pattern between DNA and chitosan has formed, resulting in a compact DNA-chitosan complex at 100 ns. All the parallel trajectories reveal the similar binding behavior although difference in kinetics has been observed (detailed analyses of DNA-chitosan minimum distance from each
trajectory can be found in Fig. S1-S3 in the supporting information). This reflects the fact that the capability of chitosan to bind DNA is robust. The binding characteristics are quantitatively characterized by monitoring the intimate contacting atom pairs between DNA and chitosan with respect to simulation time. Here, two atoms (one from DNA and the other from chitosan, respectively) that are within 0.5 nm are treated as a contacting pair. The results are summarized in Fig. 2A. Among the three models, the formation of DNA-CHS1.0 complex was the quickest as the curve of contacting onset earlier and progresses faster (than DNACHS0.6 and DNA-CHT) after simulation began. For DNA-CHS0.6, relatively fewer contacts were formed than that of DNA-CHS1.0 during the whole simulation. The significant change happened for DNA-CHT, for which both the contacts’ formation speed and numbers were smaller than DNA-CHS1.0 and DNA-CHS0.6 during the first 40 ns simulation. These phenomena clearly reflect the fact that the degree of deacetylation is a determinative factor to regulate the DNA-chitosan binding kinetics. For chitosan with higher deacetylation degree, it has abundant protonated amine groups (positively charged) to attract DNA backbone (especially the negatively charged phosphate oxygen) through columbic interaction. For the naked chitin, the binding is relatively weak resulting in a slow binding process. Analyses of contacting from other trajectories can be found in Fig. S1-S3 in the supporting information. It is worth noticing that, although the three models (CHS1.0, CHS0.6 and CHT) demonstrate comparable DNA complexation capability at 100 ns, chitosan is generally better than chitin for DNA complexation because of its better solubility in water. Along with the formation of direct contacts, the total surface area of DNAchitosan complex decreases. As can be seen in Fig. 2B, the trends of the decrease of surface area are similar to that of formation of contacts in Fig. 2A: the surface collapse of DNA-CHS1.0 is the most significant from 108.2 to 96.4 nm2. On the contrary, the surface of DNA-CHT system decreased from 111.3 to 103.9 nm2 which has the largest surface after complexation. The surface collapse indicates that fewer
atoms are exposed to the solvent after chitosan binding, which should be important for DNA condensation (dehydration) to happen. As aforementioned, the demonstrative complexes in Fig. 1B revealed clear structural distortions of DNA duplex accompanied by the chitosan binding. The structures of DNA were then quantitatively characterized by calculating the root mean squared displacement (RMSD) of DNA heavy atoms with respect to a standard Bform DNA (Fig. 3A). The quick increase of RMSD in the first several ns from 0 to around 0.9 nm should be caused by the removal of position constraints that were used in pre-equilibrium simulations. Then the three RMSD curves underwent a slow increase to reach 1.2-1.3 nm. These RMSD values and surface area collapse as depicted in Fig. 2B, reveal the fact that chitosan binding would effectively affect the DNA stability and potentially cause condensation. To compare the three DNA-chitosan systems and evaluate the effect from chitosan deacetylation degrees, we have further conducted structure clustering analysis using the GROMOS algorithm(Daura, Gademann, Jaun, Seebach, van Gunsteren & Mark, 1999). In this technique, molecular dynamics structural data are clustered into distinct conformational families(Wolf & Kirschner, 2013). Cluster size is defined as the percentage of all structures present in one cluster and the top n clusters are the n largest clusters. The last 40 ns samplings of five parallel trajectories for each case were used for calculation. Two structures within a distance of 0.5 nm is classified in one cluster. The cluster sizes (in %) of the top 10 clusters are summarized in Fig. 3B. Generally, the cluster size decreases as the deacetylation degree of chitosan decreases. The total occupancies of the top 10 clusters over the whole structural pool are 51.2 % for DNA-CHS1.0, 46.4 % for DNA-CHS0.6 and 33.9 % for DNA-CHT, respectively. This reveals the fact that the DNA-CHS1.0 has more favored binding patterns. On the contrary, the DNA-CHS0.6 and DNA-CHT bindings are relatively disorganized. This is because global motion of DNA-chitosan is more severely restrained by chitosan with higher deacetylation degree. The central structures of top 5 clusters are summarized in Fig. 3C-3E, it can be seen that DNA
distortion, especially at the A-tract region, is a common feature. Moreover, Fig. 3C3E suggests that CHS1.0 is preferably bound at the central sections of DNA, whilst CHT tends to be bound at the more terminal A-tract. In most cases, all the chitosan polymers would formed direct contacts with the distorted region, indicating its role in regulating DNA structure. When DNA forms binding with chitosan, the DNA atoms would have restrained mobility. This is quite essential for condensation to happen. In order to provide an indepth description of the kinetics of DNA motions, we have further calculated the root mean squared fluctuations (RMSF) of each nucleotide. Here, the RMSF is a measurement of the spatial extent of kinetic motion of atoms, and a larger RMSF stands for a nucleotide with higher degree of freedom to diffuse (hardly to condensate). Nucleotides with restrained movements (small RMSF) favor to condensate at the macroscopic level. The results are summarized in Fig. 4. Generally, as the deacetylation degree of chitosan decreases, the RMSF curves are in a descending order; that is, DNA-CHT > DNA-CHS0.6 > DNA-CHS1.0. This is consistent with clustering analysis (Fig. 3B) and previous experimental findings that chitosan with higher degree of deacetylation has higher DNA binding capacity and cause condensation(Kiang, Wen, Lim & Leong, 2004; Lavertu, Methot, Tran-Khanh & Buschmann, 2006), which is quite important for the formation of gene delivery platforms. In addition, two features can be observed: 1) the end nucleotides uniformly have larger RMSF values; 2) near the A-tract segment (base 16-21), the RMSF is systematically larger than those of the GC-rich segment. This is attributed to the structural denaturation at these regions (detailed analysis is presented below). The rupture of hydrogen bonds at these these regions effectively release nucleotides to the solvent. The mobility of these “free” nucleotides becomes high. It is well known that the overall DNA structure is mainly maintained by the famous Watson Crick hydrogen bonds (H-bonds) between nucleotide bases. Form above structural analysis, structural distortions are detected for DNA duplex upon chitosan binding. To give a clearer explanation of the distinctive RMSF of the end
base-pairs and A-tract region than the GC-rich segments, we systematically calculated the residual H-bond ratio projected on each base pair. Here a value of 1 represents an ideal situation that all the inter-base H-bonds are maintained (3 H-bonds for G-C pairs, and 2 H-bonds for A-T pairs), while a value of 0 stands for complete rupture of inter-base H-bonds. The results are summarized in Fig. 5. The denaturation of the DNA uniformly onset at the end base pairs together with the A-tract segment, which is consistent with the above RMSF analyses. On the contrary, the GC-rich segment (roughly base 3-14) has a well maintained H-bond network, this results in an H-bonds surviving ratio of near 2/3 for the three systems. In addition, the H-bonds of base 2022 demonstrated a slightly more stable characteristic (which survived for a longer time especially in DNA-CHS0.6 and DNA-CHT cases). This is attributed to the existence of two G-C base pairs at this terminal which is less affected by the chitosan binding. The distinct stability of GC-rich segment is mainly caused by the overall interbase H-bonds. The Guanine (G) and Cytosine (C) form three H-bonds while Adenine (A) and Thymine (T) can only form two H-bonds while. Thus A-T pairs are easily to be disturbed by the environment. Upon H-bond breaking, some base pair atoms, especially the H-bond donors and acceptors, are capable to form new H-bonds with chitosan. As shown in Fig. 6A, the DNA-chitosan H-bonds increased from zero at simulation beginning to around 8-10 at 100 ns. It is worth noticing that the characteristics of the curves are similar to the formation of contacts (Fig. 2A), where the DNA-CHT system is lowest. However, the maximum numbers of DNA-chitosan H-bonds do not differ too much between the three chitosan models. Thus, the competitive H-bond formation of chitosan to DNA is not expected to play a major role in the DNA denaturation. At last, to provide a mechanism explanation of the DNA-chitosan interactions, we examined the underlying energetic characteristics that govern the binding. The inter-molecular energy terms between DNA and chitosan were calculated, and the Coulombic (Coul) and Lennard-Jones (LJ) parts were calculated separately. As
illustrated in Fig. 6B, the Coul part is highly dependent on the specifics of chitosan. The DNA-CHS1.0 has the largest Coul part which reaches -353.34 ± 10.03 kJ/mol, while the DNA-CHS0.6 has a smaller value of -315.43 ± 11.17 kJ/mol. For DNACHT, the Coul part further decreases to -272.98 ± 10.69 kJ/mol. The Coul interaction between chitosan and DNA increases as deacetylation degree increases because protonated amines of chitosan facilitate its binding to the negatively charged backbone of DNA. On the contrary, the LJ part is less dependent on the specifics of chitosan, which are -213.727 ± 3.84 kJ/mol for DNA-CHS1.0, -198.42 ± 8.50 kJ/mol for DNA-CHS0.6 and -224.31 ± 3.91 kJ/mol for DNA-CHT, respectively. Overall, the trend of DNA-chitosan total interaction strength (Coul + LJ) is consistent with the number of contacts analysis (Fig. 2A) because stronger interactions would induce a quicker binding kinetics. The stronger binding also results in the restrained DNA motions (Fig. 4). Because of the cationic nature of chitosan and anionic nature of DNA, the binding constant is intuitively believed to be pH-dependent and is greater at lower pH because of increased electrostatic attraction to DNA when chitosan becomes highly charged(Ma, Lavertu, Winnik & Buschmann, 2009). From present study, the difference for the three chitosan models is not significant, as the strongest DNACHS1.0 binding is only ~14% stronger in energy than the DNA-CHT case, accordingly chitosan with various deacetylation degrees can uniformly bind to DNA. This is consistent with a recent experimental work by Pandit and co-workers where the chitosan microparticles are still robust to capture DNA at high pH of 8.5(Pandit, Nanayakkara, Cao, Raghavan & White, 2015). The binding of chitosan with anionic phospholipid vesicles also demonstrates the similar phenomenon. As reported by Mertins et al., deprotonated chitosan chains at high pH still bind to the negativecharged vesicle surface. Further deprotonation of chitosan does not lead to weaker affinity(Mertins & Dimova, 2013). Thus the chemical functionalization of chitosan such as changing the hydrophobicity(Li et al., 2011), other than controlling the deacetylation degree, would also be an important approach to reach chitosan’s ultimate function in the biomedicine research.
4. Conclusion Through MD simulations, the binding kinetics and stable patterns of chitosan polymer to DNA duplex were systematically studied. The chitosan with high degree of deacetylation would bind to DNA in a quicker manner than that with low deacetylation degree, and form more stable complex. Upon chitosan binding, the DNA duplex can transform into a relatively compact structure with distortions happened for the native structure. Through energy decomposition analyses, the columbic energy term between chitosan and DNA is found to play a major (but not dominant) role in the binding, and becomes weaker when degree of deacetylation decreases. The van der Waals interaction part plays a minor role and is almost independent to the deacetylation degree. It is important to find that the GC-rich segment displays a restrained diffusion than that of AT-rich segment, and the Watson Crick hydrogen bonds between G - C nucleotides demonstrate higher stability than those of A - T with the existence of chitosan. Thus DNA duplexes that are rich in G and C nucleotides are expected to easily condensate at the macroscopic level. The protonation of the amino groups plays a limited role in regulating the DNA-chitosan binding, which reflects the fact that chemical functionalization of chitosan to change the hydrophobicity would be an alternative solution to optimize its functions. Limited by computing power resources, short segment models for chitosan (DP 10) and DNA (23 base pairs) were adopted in the current study, while in the experiment, the chitosan and DNA molecular weights are rather large. The overall complexation structures should also depend on the molecular weight. Generally, the binding kinetics and characteristics between chitosan and DNA revealed from current studies can still be extrapolated to guide future experimental chitosan sutdies in biological and medical related applications. Acknowledgement This work is financially supported by the National Natural Science Foundation of China (21405108, 11304214 and 31500802), China Postdoctoral Science Foundation (2015M581852, 2016T90487 and 2016M601875) and the Natural Science Foundation
of Jiangsu Province (BK20150350). W. F. Li thanks the support from Jiangsu Provincial Key Laboratory of Radiation Medicine and Protection and A Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD). Reference Agirre, M., Zarate, J., Ojeda, E., Puras, G., Desbrieres, J., & Pedraz, J. (2014). Low Molecular Weight Chitosan (LMWC)-based Polyplexes for pDNA Delivery: From Bench to Bedside. Polymers, 6(6), 1727. Alameh, M., DeJesus, D., Jean, M., Darras, V., Thibault, M., Lavertu, M., Buschmann, M. D., & Merzouki, A. (2012). Low molecular weight chitosan nanoparticulate system at low N: P ratio for nontoxic polynucleotide delivery. Int J Nanomedicine, 7, 1399-1414. Berendsen, H. J. C., Postma, J. P. M., van Gunsteren, W. F., & Hermans, J. (1981). Interaction Models for Water in Relation to Protein Hydration. In B. Pullman (Ed.). Intermolecular Forces: Proceedings of the Fourteenth Jerusalem Symposium on Quantum Chemistry and Biochemistry Held in Jerusalem, Israel, April 13–16, 1981 (pp. 331-342). Dordrecht: Springer Netherlands. Berk, H., Henk, B., Herman, J. C. B., & Johannes, G. E. M. F. (1997). LINCS: A linear constraint solver for molecular simulations. Journal of Computational Chemistry, 18(12), 1463-1472. Borchard, G. (2001). Chitosans for gene delivery. Advanced Drug Delivery Reviews, 52(2), 145-150. Bussi, G., Donadio, D., & Parrinello, M. (2007). Canonical sampling through velocity rescaling. The Journal of Chemical Physics, 126(1), 014101. Cui, Z., & Mumper, R. J. (2001). Chitosan-based nanoparticles for topical genetic immunization. Journal of Controlled Release, 75(3), 409-419. D.A. Case, R. M. B., W. Botello-Smith, D.S. Cerutti, T.E. Cheatham, III, T.A. Darden, R.E. Duke, T.J. Giese, H. Gohlke, A.W. Goetz, N. Homeyer, S. Izadi, P. Janowski, J. Kaus, A. Kovalenko, T.S. Lee, S. LeGrand, P. Li, C. Lin, T. Luchko, R. Luo, B. Madej, D. Mermelstein, K.M. Merz, G. Monard, H. Nguyen, H.T. Nguyen, I. Omelyan, A. Onufriev, D.R. Roe, A. Roitberg, C. Sagui, C.L. Simmerling, J. Swails, R.C. Walker, J. Wang, R.M. Wolf, X. Wu, L. Xiao, D.M. York and P.A. Kollman. (2016). AMBER 16. University of California, San Francisco. Darden, T., York, D., & Pedersen, L. (1993). Particle mesh Ewald: An N [center-dot] log(N) method for Ewald sums in large systems. The Journal of Chemical Physics, 98(12), 10089-10092. Daura, X., Gademann, K., Jaun, B., Seebach, D., van Gunsteren, W. F., & Mark, A. E. (1999). Peptide Folding: When Simulation Meets Experiment. Angewandte Chemie International Edition, 38(1-2), 236240. David Van Der, S., Erik, L., Berk, H., Gerrit, G., Alan, E. M., & Herman, J. C. B. (2005). GROMACS: Fast, flexible, and free. Journal of Computational Chemistry, 26(16), 1701-1718. Fang, N., Chan, V., Mao, H.-Q., & Leong, K. W. (2001). Interactions of phospholipid bilayer with chitosan: effect of molecular weight and pH. Biomacromolecules, 2(4), 1161-1168. Franca, E. F., Freitas, L. C. G., & Lins, R. D. (2011). Chitosan molecular structure as a function of Nacetylation. Biopolymers, 95(7), 448-460. Franca, E. F., Lins, R. D., Freitas, L. C. G., & Straatsma, T. P. (2008). Characterization of Chitin and Chitosan Molecular Structure in Aqueous Solution. Journal of Chemical Theory and Computation, 4(12), 21412149.
Hagan, K. A., Meier, W. L., Ferrance, J. P., & Landers, J. P. (2009). Chitosan-coated silica as a solid phase for RNA purification in a microfluidic device. Analytical Chemistry, 81(13), 5249-5256. Ilium, L. (1998). Chitosan and Its Use as a Pharmaceutical Excipient. Pharmaceutical Research, 15(9), 1326-1331. Illum, L., Jabbal-Gill, I., Hinchcliffe, M., Fisher, A. N., & Davis, S. S. (2001). Chitosan as a novel nasal delivery system for vaccines. Advanced Drug Delivery Reviews, 51(1–3), 81-96. Köping-Höggård, M., Tubulekas, I., Guan, H., Edwards, K., Nilsson, M., Vårum, K., & Artursson, P. (2001). Chitosan as a nonviral gene delivery system. Structure–property relationships and characteristics compared with polyethylenimine in vitro and after lung administration in vivo. Gene Therapy, 8, 11081121. Kiang, T., Wen, J., Lim, H. W., & Leong, K. W. (2004). The effect of the degree of chitosan deacetylation on the efficiency of gene transfection. Biomaterials, 25(22), 5293-5301. Kumar, M. N. V. R., Muzzarelli, R. A. A., Muzzarelli, C., Sashiwa, H., & Domb, A. J. (2004). Chitosan Chemistry and Pharmaceutical Perspectives. Chemical Reviews (Washington, DC, United States), 104(12), 6017-6084. Lavertu, M., Methot, S., Tran-Khanh, N., & Buschmann, M. D. (2006). High efficiency gene transfer using chitosan/DNA nanoparticles with specific combinations of molecular weight and degree of deacetylation. Biomaterials, 27(27), 4815-4824. Leong, K. W., Mao, H. Q., Truong-Le, V. L., Roy, K., Walsh, S. M., & August, J. T. (1998). DNA-polycation nanospheres as non-viral gene delivery vehicles. Journal of Controlled Release, 53(1–3), 183-193. Li, P., Poon, Y. F., Li, W., Zhu, H.-Y., Yeap, S. H., Cao, Y., Qi, X., Zhou, C., Lamrani, M., Beuerman, R. W., Kang, E.-T., Mu, Y., Li, C. M., Chang, M. W., Jan Leong, S. S., & Chan-Park, M. B. (2011). A polycationic antimicrobial and biocompatible hydrogel with microbe membrane suctioning ability. Nature Materials, 10(2), 149-156. Li, W., Nordenskiöld, L., & Mu, Y. (2011). Sequence-Specific Mg2+–DNA Interactions: A Molecular Dynamics Simulation Study. The Journal of Physical Chemistry B, 115(49), 14713-14720. Lim, S. T., Martin, G. P., Berry, D. J., & Brown, M. B. (2000). Preparation and evaluation of the in vitro drug release properties and mucoadhesion of novel microspheres of hyaluronic acid and chitosan. Journal of Controlled Release, 66(2–3), 281-292. Liu, W., Sun, S., Cao, Z., Zhang, X., Yao, K., Lu, W. W., & Luk, K. (2005). An investigation on the physicochemical properties of chitosan/DNA polyelectrolyte complexes. Biomaterials, 26(15), 27052711. Ma, P. L., Lavertu, M., Winnik, F. M., & Buschmann, M. D. (2009). New Insights into chitosan− DNA interactions using isothermal titration microcalorimetry. Biomacromolecules, 10(6), 1490-1499. Mao, H.-Q., Roy, K., Troung-Le, V. L., Janes, K. A., Lin, K. Y., Wang, Y., August, J. T., & Leong, K. W. (2001). Chitosan-DNA nanoparticles as gene carriers: synthesis, characterization and transfection efficiency. Journal of Controlled Release, 70(3), 399-421. Mertins, O., & Dimova, R. (2013). Insights on the interactions of chitosan with phospholipid vesicles. part i: Effect of polymer deprotonation. Langmuir, 29(47), 14545-14551. Monck, M., Mori, A., Lee, D., Tam, P., Wheeler, J., Cullis, P., & Scherrer, P. (2000). Stabilized plasmid–lipid particles: pharmacokinetics and plasmid delivery to distal tumors following intravenous injection. Journal of Drug Targeting, 7(6), 439-452. Mumper, R. J., Wang, J., Claspell, J. M., & Rolland, A. P. (1995). Novel polymeric condensing carriers for gene delivery. Proc. Int. Sym. Controlled Release. Bioactive Mater., 22, 178-179.
Onishi, H., & Machida, Y. (1999). Biodegradation and distribution of water-soluble chitosan in mice. Biomaterials, 20(2), 175-182. Pack, D. W., Hoffman, A. S., Pun, S., & Stayton, P. S. (2005). Design and development of polymers for gene delivery. Nat Rev Drug Discov, 4(7), 581-593. Pandit, K. R., Nanayakkara, I. A., Cao, W., Raghavan, S. R., & White, I. M. (2015). Capture and direct amplification of DNA on chitosan microparticles in a single PCR-optimal solution. Analytical Chemistry, 87(21), 11022-11029. Panyam, J., & Labhasetwar, V. (2003). Biodegradable nanoparticles for drug and gene delivery to cells and tissue. Advanced Drug Delivery Reviews, 55(3), 329-347. Ravi Kumar, M. N. V. (2000). A review of chitin and chitosan applications. Reactive and Functional Polymers, 46(1), 1-27. Romøren, K., Pedersen, S., Smistad, G., Evensen, Ø., & Thu, B. J. (2003). The influence of formulation variables on in vitro transfection efficiency and physicochemical properties of chitosan-based polyplexes. International Journal of Pharmaceutics, 261(1), 115-127. Roy, K., Mao, H.-Q., Huang, S. K., & Leong, K. W. (1999). Oral gene delivery with chitosan-DNA nanoparticles generates immunologic protection in a murine model of peanut allergy. Natural Medicines, 5(4), 387-391. Sannan, T., Kurita, K., & Iwakura, Y. (1976). Studies on chitin, 2. Effect of deacetylation on solubility. Die Makromolekulare Chemie, 177(12), 3589-3600. Sato, T., Ishii, T., & Okahata, Y. (2001). In vitro gene delivery mediated by chitosan. Effect of pH, serum, and molecular mass of chitosan on the transfection efficiency. Biomaterials, 22(15), 2075-2080. Strand, S. P., Danielsen, S., Christensen, B. E., & Vårum, K. M. (2005). Influence of chitosan structure on the formation and stability of DNA-chitosan polyelectrolyte complexes. Biomacromolecules, 6(6), 33573366. Strauss, J. K., & Maher, L. J., 3rd. (1994). DNA bending by asymmetric phosphate neutralization. Science, 266(5192), 1829-1834. Templeton, N. S., Lasic, D. D., Frederik, P. M., Strey, H. H., Roberts, D. D., & Pavlakis, G. N. (1997). Improved DNA: liposome complexes for increased systemic delivery and gene expression. Nat Biotech, 15(7), 647-652. Wolf, A., & Kirschner, K. N. (2013). Principal component and clustering analysis on molecular dynamics data of the ribosomal L11•23S subdomain. Journal of Molecular Modeling, 19(2), 539-549. Wolff, J., Malone, R., Williams, P., Chong, W., Acsadi, G., Jani, A., & Felgner, P. (1990). Direct gene transfer into mouse muscle in vivo. Science, 247(4949), 1465-1468. Zufferey, R., Nagy, D., Mandel, R. J., Naldini, L., & Trono, D. (1997). Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat Biotech, 15(9), 871-875.
Figure 1. (A) Demonstration of the simulation model; (B) A representative binding process of chitosan to DNA.
Figure 2. Time evaluation of (A) number of contacts between DNA and chitosan; (B) Surface area of DNA-chitosan complex.
Figure 3. (A) Root mean squared displacement of DNA heavy atoms (excluding hydrogen atoms) with respect to standard B-form DNA; (B) Cluster sizes (number of structures in one cluster/total number of structures, in %) of the top 10 clusters (10 largest clusters) of DNAchitosan complex from clustering analysis; (C) Central structures of the top 5 clusters. The Atract region (base 16-21) is highlighted in purple.
Figure 4. (A, B) Root mean squared fluctuations (RMSF) of DNA nucleotides from two strands; data was collected from the last 40 ns of the simulations. (C) The demonstrative topology of the DNA duplex.
Figure 5. Time evolutions of residual Watson Crick H-bond ratios of DNA duplex upon binding with (A) CHS1.0, (B) CHS0.6 and (C) CHT.
Figure 6. (A) Time evolutions of numbers of hydrogen bonds between DNA and chitosan polymers; (B) DNA-chitosan pairwise interaction energy deposited into columbic (Coul) and Lennard-Jones (LJ) parts. Values are calculated from the last 40 ns simulations of five parallel trajectories for each case.
Table 1. Structural parameters of three chitosan models and simulation box contents.
Systema
Molecular
Degree of
Weight
Deacetylation
Simulation box contents Sequenceb DNA
Ions
Water
64 Na+ CHS1.0
1634.64
100%
d-p-d-p-d-p-d-p-d-p
1
23 Cl-
32511
66 Na+ CHS0.6
1800.77
60%
d-c-p-d-c-p-c-d-p-c
1
CHT
2049.97
0%
c-c-c-c-c-c-c-c-c-c
1
23 Cl-
32489
69 Na+ 23 Cl-
32485
S0144-8617(17)30429-0 http://dx.doi.org/doi:10.1016/j.carbpol.2017.04.040 CARP 12228
To appear in: Received date: Revised date: Accepted date:
21-12-2016 13-4-2017 18-4-2017
Please cite this article as: Yang, Yanmei., Guo, Meng., Qian, Rui., Liu, Chang., Zong, Xumin., Li, Yong-Qiang., & Li, Weifeng., Binding Efficacy and Kinetics of Chitosan with DNA Duplex: The Effects of Deacetylation Degree and Nucleotide Sequences.Carbohydrate Polymers http://dx.doi.org/10.1016/j.carbpol.2017.04.040 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Binding Efficacy and Kinetics of Chitosan with DNA Duplex: The Effects of Deacetylation Degree and Nucleotide Sequences Yanmei Yang1, Meng Guo2, Rui Qian3, Chang Liu1, Xumin Zong1, Yong-Qiang Li1* and Weifeng Li1* 1.
School for Radiological and Interdisciplinary Sciences (RAD-X) and Collaborative Innovation Center of Radiological Medicine of Jiangsu Higher Education Institutions, Soochow University, Suzhou 215123, China.
2.
Shandong Computer Science Center (National Supercomputer Centre in Jinan), Jinan 250101, P. R. China
3.
School of Biology and Basic Medical Sciences, Soochow University, Suzhou, 214123, China
* Corresponding authors. E-mail address: [email protected] (Y.-Q. Li) and [email protected] (W. F. Li)
Highlights
The binding kinetics between chitosan and DNA was studied at atomic-level through molecular dynamics simulations.
The GC-rich DNA was predicted to condensate easily by chitosan because its motion was more restrained than that of AT-rich DNA.
The chitosan binding caused more severe structural distortions to AT-rich DNA.
Abstract The binding process of DNA duplex with various types of chitosan polymers were studied at atomic level through molecular dynamics simulations. The interaction kinetics and binding strength, complex morphology and DNA structure evolution were systematically accessed. The binding efficacy of chitosan to DNA reduces (both in complexation speed and binding strength) when deacetylation degree is decreased, because protonated amine groups on chitosan backbone are more prone to bind with DNA, especially the phosphate oxygen, through coulomb interaction. The Watson Crick hydrogen bonds of A-T base pairs are more easily to break because chitosan is capable to form competitive hydrogen bonds with them. It is surprising to find that the G-C nucleotides have highly restrained kinetic motion than that of A-T nucleotides, which would be important for DNA-chitosan complexation and condensation to happen at the microscopic level. From our current results, the degree of chitosan deacetylation is found to play a certain role in regulating the DNA-chitosan
complexation process, but is not as important as being believed before. Other types of chemical functionalization that can tune the chitosan’s hydrophobicity should deserve more attentions in the experiment. Keywords: Chitosan; ; ; ; , Chitin, Deacetylation Degree, DNA Duplex, Molecular Dynamics Simulation
1. Introduction Chitosan is one important natural and biodegradable polysaccharide derived by deacetylation of chitin which is rich in the exoskeleton of crustaceans (crabs, shrimp, etc.) and cell walls of fungi(Borchard, 2001; Onishi & Machida, 1999; Ravi Kumar, 2000; Sannan, Kurita & Iwakura, 1976). Structurally, this co-polymer is composed of repeating D-glucosamine and N-acetyl-D-glucosamine (NAG) units linked via (1–4) glycosidic bonds(Onishi & Machida, 1999). The term chitosan is usually used to describe a series of polysaccharides with degree of deacetylation being higher than 40%(Sannan, Kurita & Iwakura, 1976). Chitosan possesses several advanced features – cheap, biocompatible, biodegradable and principally non-toxic – that are important for applications in biological and medical related areas(Borchard, 2001; Cui & Mumper, 2001; Ilium, 1998; Illum, Jabbal-Gill, Hinchcliffe, Fisher & Davis, 2001; Köping-Höggård et al., 2001; Kumar, Muzzarelli, Muzzarelli, Sashiwa & Domb, 2004; Lavertu, Methot, Tran-Khanh & Buschmann, 2006; Leong, Mao, Truong-Le, Roy, Walsh & August, 1998; Li et al., 2011; Lim, Martin, Berry & Brown, 2000; Mao et al., 2001; Monck et al., 2000; Mumper, Wang, Claspell & Rolland, 1995; Pack, Hoffman, Pun & Stayton, 2005; Roy, Mao, Huang & Leong, 1999; Sato, Ishii & Okahata, 2001). In the agricultural and pharmaceutical industries, chitosan has been widely used as a dietary supplement, wound healing biomaterial and pharmaceutical excipient (Ilium, 1998; Kumar, Muzzarelli, Muzzarelli, Sashiwa & Domb, 2004). In drug delivery, chitosan has found applications in direct tablet compression, tablet disintegrant, and production of gels and micro-nanoparticles for controlled drug release or for the improvement of drug as dissolution(Borchard, 2001; Cui & Mumper, 2001; Ilium, 1998; Illum, Jabbal-Gill, Hinchcliffe, Fisher & Davis, 2001; Köping-Höggård et al., 2001; Kumar, Muzzarelli, Muzzarelli, Sashiwa & Domb, 2004; Lavertu, Methot, Tran-Khanh & Buschmann, 2006; Leong, Mao, Truong-Le, Roy, Walsh & August, 1998; Mao et al., 2001; Monck et al., 2000; Mumper, Wang, Claspell & Rolland, 1995; Pack, Hoffman, Pun & Stayton, 2005; Roy, Mao, Huang & Leong, 1999; Sato, Ishii & Okahata, 2001).
At physiological conditions, protonation of the primary amine groups of chitosan results in cationic chitosan chains, which demonstrates both antimicrobial activities(Li et al., 2011) and capability to form complexation with gene(Borchard, 2001; Cui & Mumper, 2001; Köping-Höggård et al., 2001; Leong, Mao, Truong-Le, Roy, Walsh & August, 1998; Mao et al., 2001; Mumper, Wang, Claspell & Rolland, 1995). In the recent decades, gene delivery research has attracted great research interest because of its huge potential as a promising therapeutic strategy in the treatment of inheritable or acquired diseases that needs defective gene replacement, missing gene substitution, or silencing of unwanted gene expression(Pack, Hoffman, Pun & Stayton, 2005; Panyam & Labhasetwar, 2003; Templeton, Lasic, Frederik, Strey, Roberts & Pavlakis, 1997; Wolff et al., 1990; Zufferey, Nagy, Mandel, Naldini & Trono, 1997). Gene transfection refers to the process of deliberately introducing genetic material into cells (eukaryotic or bacterial) by non-viral methods. Transfection can be carried out with chemical methods (using calcium phosphate, organic compounds, cationic liposomes and polymers) and non-chemical methods (by electroporation, cell squeezing, sonoporation). Among them, chitosan has gained increasing interest as one of the nonviral vectors for delivery of gene materials including oligonucleotides, plasmid DNA and siRNA, because of the intrinsic cationic nature and beneficial qualities including low toxicity, low immunogenicity, excellent biocompatibility(Borchard, 2001; Cui & Mumper, 2001; Ilium, 1998; Illum, Jabbal-Gill, Hinchcliffe, Fisher & Davis, 2001; Köping-Höggård et al., 2001; Mao et al., 2001; Panyam & Labhasetwar, 2003; Ravi Kumar, 2000; Roy, Mao, Huang & Leong, 1999; Sato, Ishii & Okahata, 2001). Chitosan is an important polycation for charge-switching because of the abundance of amine groups with a pKa value of 6.4. Hence, at pH below 6.4, chitosan is cationic and readily forms particle complexes with anionic nucleic acids which can be used as DNA and siRNA transfection vehicles(Agirre, Zarate, Ojeda, Puras, Desbrieres & Pedraz, 2014; Alameh et al., 2012). Chitosan functionalized silica particles have been demonstrated to extract RNA from cancer cells more efficiently than the bare silica particles(Hagan, Meier, Ferrance & Landers, 2009). Very recently, Pandit and coworkers have utilized chitosan for DNA direct amplification. The chitosan
macroparticles can capture DNA at a pH of 8.5 just as efficiently as at low pH. The captured DNA is still accessible by polymerase which enables direct amplification of DNA(Pandit, Nanayakkara, Cao, Raghavan & White, 2015). The complexation of DNA with chitosan have a greater protection for DNA from degradation by nuclease and thus raises great research interest in the development of vaccines(Cui & Mumper, 2001; Illum, Jabbal-Gill, Hinchcliffe, Fisher & Davis, 2001). Moreover, chitosan has been demonstrated to be able to destabilize the lipid membrane, thus facilitates cellular uptake(Fang, Chan, Mao & Leong, 2001). Previous studies indicated that the formulation parameters of chitosan are determinative for the binding affinity of chitosan to DNA as well as transfection efficiency of DNA-chitosan complexes, these include degree of deacetylation, molecular weight of chitosan, the charge ratio of amine (chitosan) to DNA phosphate (N/P ratio), the chitosan/DNA concentration, pH value of the transfection medium, cell type, preparation technique of DNA-chitosan nanoparticles and so on(Borchard, 2001; Köping-Höggård et al., 2001; Kiang, Wen, Lim & Leong, 2004; Lavertu, Methot, Tran-Khanh & Buschmann, 2006; Liu et al., 2005; Romøren, Pedersen, Smistad, Evensen & Thu, 2003; Sato, Ishii & Okahata, 2001; Strand, Danielsen, Christensen & Vårum, 2005). The first report of self-assembling of oligomeric DNA-chitosan complexes was in 1995 by mixing a solution of chitosan with plasmid DNA(Mumper, Wang, Claspell & Rolland, 1995). Despite the achieved flourishing experimental studies in the recent two decades of DNA-chitosan nanostructures for gene delivery, fundamental knowledge of how chitosan is complexed with DNA duplex is poorly documented. In sharp contrast to proteins which have well defined secondary and tertiary structures (determined by their sequences), the double-stranded DNAs uniformly adopt helical structure (B- or A-form) irrespective of their sequence. It is unknown whether chitosan binds to DNA in a specific binding manner or just homogeneously to all types of nucleotides. The computer molecular dynamics (MD) simulation studies, which is a powerful tool to understand the inter-molecule interactions at the atomic level, is sparse for the DNA-chitosan system. This is, to a certain extent, because of
lacking of an accurate model of hydrocarbons in MD simulations which lags behind the rapid process of the experiments. Recently, hydrocarbon models parameterized for chitosan and chitin have been developed to study the structural characterization of chitin and chitosan in aqueous solution taking the degrees of deacetylation into account(Franca, Freitas & Lins, 2011; Franca, Lins, Freitas & Straatsma, 2008). This makes MD simulations of DNA-chitosan possible and raises an urgent need for a systematic study on the structural and conformational behaviors of DNA-chitosan complex in solution that is quite essential for the design of efficient gene delivery platform. Here, we use the MD simulations to characterize the binding patterns and kinetics of chitosan interacting with DNA duplex. The influence of deacetylation degree of chitosan on the DNA binding efficacy, conformation and motion has been addressed. These findings are compared with experimental data and would provide a clear insight for the design and development of optimal chitosan platforms for gene delivery and other medical related applications. 2. Simulation Details The model to simulate the chitosan and chitin was a 10-mer polysaccharide chain. Following previous studies(Franca, Freitas & Lins, 2011; Franca, Lins, Freitas & Straatsma, 2008), we have considered three systems with different degrees of deacetylation: 1) CHS1.0, 100% deacetylation; 2) CHS0.6, 60% deacetylation and 3) CHT, 0% deacetylation (strictly, this should be classified as chitin). The specific sequences of the polysaccharides (glucosamine, protonated glucosamine and Nacetylglucosamine) can be found in Table 1. The backbone of chitosan (glucosamine units) is rich in primary amine groups (pKa ~ 6.3-6.5). The protonation state of chitosan is dependent on pH. At pH 5.5-5.7, around 90% of the amine groups are protonated(Mao et al., 2001). While at physiological pH, the degree of protonation is reduced. The protonation states of the amine groups for CHS1.0 and CHS0.6 were settled to be 50% following previous studies(Franca, Freitas & Lins, 2011; Franca,
Lins, Freitas & Straatsma, 2008). The details of the chitosan and chitin model are listed in Table 1. a
CHS, chitosan; CHT, chitin.
b
d, glucosamine; p, protonated glucosamine; c, N-acetylglucosamine.
An isolated double-stranded 23-mer DNA (sequence: GGCGGCGGCGCGGCGTTTTTTGG)(Strauss & Maher, 1994) was adopted to interact with chitosan and chitin. The solvation statistics and stability of this DNA has been thoroughly studied in our previous study(Li, Nordenskiöld & Mu, 2011). The DNA structure was constructed by the Nucleic Acid Builder as implemented in Amber Tools package(D.A. Case, 2016). As shown in Fig. 1A, the DNA and chitosan were placed parallel to each other with an initial separation of ~ 1.5 nm. The complex was then solvated in a 10 × 10 × 10 nm3 cubic box with periodic boundary conditions applied in all directions. Since both chitosan (CHS1.0: +5 |e|, CHS0.6: +3 |e|) and DNA (-46 |e|) molecules carry net charges, Na+ counter-ions were firstly added in the simulation box to neutralize the simulation systems (41 Na+ for CHS1.0, 43 Na+ for CHS0.6 and 46 Na+ for CHT). In addition, 23 NaCl salt and ~32500 water (represented by SPC water model(Berendsen, Postma, van Gunsteren & Hermans, 1981)) were further added following our previous studies(Li, Nordenskiöld & Mu, 2011). The box contents can be found in in Table 1. The GROMOS 53A6 parameter set with extension to chitin and chitosan(Franca, Freitas & Lins, 2011; Franca, Lins, Freitas & Straatsma, 2008) was used. All the simulations were conducted using the GROMACS program(David Van Der, Erik, Berk, Gerrit, Alan & Herman, 2005). Each system was firstly energy minimized for 10,000 steps using the steepest descent method. After minimization, the solvent (including salt ions) was pre-equilibrated by performing 5 ns MD simulation at 300 K, while DNA and chitosan atoms are positionally restrained with a force constant of 1000 kJ ∙ mol-2 ∙ nm-1. Following the pre-equilibration, productive simulations were conducted for data collection. To enhance the sampling efficiency, five parallel trajectories (with different initial velocities) were generated for each chitosan model.
All the numerical data presented in the discussions are averaged over five trajectories for each case unless otherwise stated. All the simulations were conducted at constant pressure (1 atm) and constant temperature (300 K) by using a velocity-rescale thermostat(Bussi, Donadio & Parrinello, 2007) with a coupling coefficient of τT = 0.1 ps. The Particle Mesh Ewald (PME) method(Darden, York & Pedersen, 1993) was adopted to treat the long-range electrostatic interactions, whereas the van der Waals interactions (Lennard-Jones potential) were handled with a cutoff distance of 1.2 nm. The bond lengths involving hydrogen atoms were constrained with the LINCS algorithm(Berk, Henk, Herman & Johannes, 1997). For each trajectory, 100 ns dataproductive simulation was conducted. A time step of 2.0 fs was used for movement integration, and data were collected every 1.0 ps. 3. Results and Discussion Through simulations, the three chitosan models (CHS1.0, CHS0.6 and CHT) were found to be capable to bind to DNA duplex. Although the initial separation between chitosan and DNA was ~ 1.5 nm, the chitosan typically would find and touch DNA atoms within several nano-seconds (ns). The binding characteristics are first examined by monitoring the time evaluation of interaction patterns between chitosan and DNA in a representative trajectory (CHS1.0 with DNA, demonstrated in Fig. 1B). At the early stage of the simulation, the chitosan diffused freely in the solvent and touched the DNA backbone atoms at 1.5 ns after the simulation began. After onset of the initial contacting, a quick binding process happened until a stable binding has formed at around 3 ns. Along with chitosan binding, structural distortions were detected at DNA terminus, where the Watson Crick hydrogen bonds (H-bonds) began to break. Accompanied with the H-bond breaking, the released nucleotide bases bent back to form contacts with the chitosan chain (as seen in snapshots at 25 and 70 ns). At the end of the simulation, ultimate binding pattern between DNA and chitosan has formed, resulting in a compact DNA-chitosan complex at 100 ns. All the parallel trajectories reveal the similar binding behavior although difference in kinetics has been observed (detailed analyses of DNA-chitosan minimum distance from each
trajectory can be found in Fig. S1-S3 in the supporting information). This reflects the fact that the capability of chitosan to bind DNA is robust. The binding characteristics are quantitatively characterized by monitoring the intimate contacting atom pairs between DNA and chitosan with respect to simulation time. Here, two atoms (one from DNA and the other from chitosan, respectively) that are within 0.5 nm are treated as a contacting pair. The results are summarized in Fig. 2A. Among the three models, the formation of DNA-CHS1.0 complex was the quickest as the curve of contacting onset earlier and progresses faster (than DNACHS0.6 and DNA-CHT) after simulation began. For DNA-CHS0.6, relatively fewer contacts were formed than that of DNA-CHS1.0 during the whole simulation. The significant change happened for DNA-CHT, for which both the contacts’ formation speed and numbers were smaller than DNA-CHS1.0 and DNA-CHS0.6 during the first 40 ns simulation. These phenomena clearly reflect the fact that the degree of deacetylation is a determinative factor to regulate the DNA-chitosan binding kinetics. For chitosan with higher deacetylation degree, it has abundant protonated amine groups (positively charged) to attract DNA backbone (especially the negatively charged phosphate oxygen) through columbic interaction. For the naked chitin, the binding is relatively weak resulting in a slow binding process. Analyses of contacting from other trajectories can be found in Fig. S1-S3 in the supporting information. It is worth noticing that, although the three models (CHS1.0, CHS0.6 and CHT) demonstrate comparable DNA complexation capability at 100 ns, chitosan is generally better than chitin for DNA complexation because of its better solubility in water. Along with the formation of direct contacts, the total surface area of DNAchitosan complex decreases. As can be seen in Fig. 2B, the trends of the decrease of surface area are similar to that of formation of contacts in Fig. 2A: the surface collapse of DNA-CHS1.0 is the most significant from 108.2 to 96.4 nm2. On the contrary, the surface of DNA-CHT system decreased from 111.3 to 103.9 nm2 which has the largest surface after complexation. The surface collapse indicates that fewer
atoms are exposed to the solvent after chitosan binding, which should be important for DNA condensation (dehydration) to happen. As aforementioned, the demonstrative complexes in Fig. 1B revealed clear structural distortions of DNA duplex accompanied by the chitosan binding. The structures of DNA were then quantitatively characterized by calculating the root mean squared displacement (RMSD) of DNA heavy atoms with respect to a standard Bform DNA (Fig. 3A). The quick increase of RMSD in the first several ns from 0 to around 0.9 nm should be caused by the removal of position constraints that were used in pre-equilibrium simulations. Then the three RMSD curves underwent a slow increase to reach 1.2-1.3 nm. These RMSD values and surface area collapse as depicted in Fig. 2B, reveal the fact that chitosan binding would effectively affect the DNA stability and potentially cause condensation. To compare the three DNA-chitosan systems and evaluate the effect from chitosan deacetylation degrees, we have further conducted structure clustering analysis using the GROMOS algorithm(Daura, Gademann, Jaun, Seebach, van Gunsteren & Mark, 1999). In this technique, molecular dynamics structural data are clustered into distinct conformational families(Wolf & Kirschner, 2013). Cluster size is defined as the percentage of all structures present in one cluster and the top n clusters are the n largest clusters. The last 40 ns samplings of five parallel trajectories for each case were used for calculation. Two structures within a distance of 0.5 nm is classified in one cluster. The cluster sizes (in %) of the top 10 clusters are summarized in Fig. 3B. Generally, the cluster size decreases as the deacetylation degree of chitosan decreases. The total occupancies of the top 10 clusters over the whole structural pool are 51.2 % for DNA-CHS1.0, 46.4 % for DNA-CHS0.6 and 33.9 % for DNA-CHT, respectively. This reveals the fact that the DNA-CHS1.0 has more favored binding patterns. On the contrary, the DNA-CHS0.6 and DNA-CHT bindings are relatively disorganized. This is because global motion of DNA-chitosan is more severely restrained by chitosan with higher deacetylation degree. The central structures of top 5 clusters are summarized in Fig. 3C-3E, it can be seen that DNA
distortion, especially at the A-tract region, is a common feature. Moreover, Fig. 3C3E suggests that CHS1.0 is preferably bound at the central sections of DNA, whilst CHT tends to be bound at the more terminal A-tract. In most cases, all the chitosan polymers would formed direct contacts with the distorted region, indicating its role in regulating DNA structure. When DNA forms binding with chitosan, the DNA atoms would have restrained mobility. This is quite essential for condensation to happen. In order to provide an indepth description of the kinetics of DNA motions, we have further calculated the root mean squared fluctuations (RMSF) of each nucleotide. Here, the RMSF is a measurement of the spatial extent of kinetic motion of atoms, and a larger RMSF stands for a nucleotide with higher degree of freedom to diffuse (hardly to condensate). Nucleotides with restrained movements (small RMSF) favor to condensate at the macroscopic level. The results are summarized in Fig. 4. Generally, as the deacetylation degree of chitosan decreases, the RMSF curves are in a descending order; that is, DNA-CHT > DNA-CHS0.6 > DNA-CHS1.0. This is consistent with clustering analysis (Fig. 3B) and previous experimental findings that chitosan with higher degree of deacetylation has higher DNA binding capacity and cause condensation(Kiang, Wen, Lim & Leong, 2004; Lavertu, Methot, Tran-Khanh & Buschmann, 2006), which is quite important for the formation of gene delivery platforms. In addition, two features can be observed: 1) the end nucleotides uniformly have larger RMSF values; 2) near the A-tract segment (base 16-21), the RMSF is systematically larger than those of the GC-rich segment. This is attributed to the structural denaturation at these regions (detailed analysis is presented below). The rupture of hydrogen bonds at these these regions effectively release nucleotides to the solvent. The mobility of these “free” nucleotides becomes high. It is well known that the overall DNA structure is mainly maintained by the famous Watson Crick hydrogen bonds (H-bonds) between nucleotide bases. Form above structural analysis, structural distortions are detected for DNA duplex upon chitosan binding. To give a clearer explanation of the distinctive RMSF of the end
base-pairs and A-tract region than the GC-rich segments, we systematically calculated the residual H-bond ratio projected on each base pair. Here a value of 1 represents an ideal situation that all the inter-base H-bonds are maintained (3 H-bonds for G-C pairs, and 2 H-bonds for A-T pairs), while a value of 0 stands for complete rupture of inter-base H-bonds. The results are summarized in Fig. 5. The denaturation of the DNA uniformly onset at the end base pairs together with the A-tract segment, which is consistent with the above RMSF analyses. On the contrary, the GC-rich segment (roughly base 3-14) has a well maintained H-bond network, this results in an H-bonds surviving ratio of near 2/3 for the three systems. In addition, the H-bonds of base 2022 demonstrated a slightly more stable characteristic (which survived for a longer time especially in DNA-CHS0.6 and DNA-CHT cases). This is attributed to the existence of two G-C base pairs at this terminal which is less affected by the chitosan binding. The distinct stability of GC-rich segment is mainly caused by the overall interbase H-bonds. The Guanine (G) and Cytosine (C) form three H-bonds while Adenine (A) and Thymine (T) can only form two H-bonds while. Thus A-T pairs are easily to be disturbed by the environment. Upon H-bond breaking, some base pair atoms, especially the H-bond donors and acceptors, are capable to form new H-bonds with chitosan. As shown in Fig. 6A, the DNA-chitosan H-bonds increased from zero at simulation beginning to around 8-10 at 100 ns. It is worth noticing that the characteristics of the curves are similar to the formation of contacts (Fig. 2A), where the DNA-CHT system is lowest. However, the maximum numbers of DNA-chitosan H-bonds do not differ too much between the three chitosan models. Thus, the competitive H-bond formation of chitosan to DNA is not expected to play a major role in the DNA denaturation. At last, to provide a mechanism explanation of the DNA-chitosan interactions, we examined the underlying energetic characteristics that govern the binding. The inter-molecular energy terms between DNA and chitosan were calculated, and the Coulombic (Coul) and Lennard-Jones (LJ) parts were calculated separately. As
illustrated in Fig. 6B, the Coul part is highly dependent on the specifics of chitosan. The DNA-CHS1.0 has the largest Coul part which reaches -353.34 ± 10.03 kJ/mol, while the DNA-CHS0.6 has a smaller value of -315.43 ± 11.17 kJ/mol. For DNACHT, the Coul part further decreases to -272.98 ± 10.69 kJ/mol. The Coul interaction between chitosan and DNA increases as deacetylation degree increases because protonated amines of chitosan facilitate its binding to the negatively charged backbone of DNA. On the contrary, the LJ part is less dependent on the specifics of chitosan, which are -213.727 ± 3.84 kJ/mol for DNA-CHS1.0, -198.42 ± 8.50 kJ/mol for DNA-CHS0.6 and -224.31 ± 3.91 kJ/mol for DNA-CHT, respectively. Overall, the trend of DNA-chitosan total interaction strength (Coul + LJ) is consistent with the number of contacts analysis (Fig. 2A) because stronger interactions would induce a quicker binding kinetics. The stronger binding also results in the restrained DNA motions (Fig. 4). Because of the cationic nature of chitosan and anionic nature of DNA, the binding constant is intuitively believed to be pH-dependent and is greater at lower pH because of increased electrostatic attraction to DNA when chitosan becomes highly charged(Ma, Lavertu, Winnik & Buschmann, 2009). From present study, the difference for the three chitosan models is not significant, as the strongest DNACHS1.0 binding is only ~14% stronger in energy than the DNA-CHT case, accordingly chitosan with various deacetylation degrees can uniformly bind to DNA. This is consistent with a recent experimental work by Pandit and co-workers where the chitosan microparticles are still robust to capture DNA at high pH of 8.5(Pandit, Nanayakkara, Cao, Raghavan & White, 2015). The binding of chitosan with anionic phospholipid vesicles also demonstrates the similar phenomenon. As reported by Mertins et al., deprotonated chitosan chains at high pH still bind to the negativecharged vesicle surface. Further deprotonation of chitosan does not lead to weaker affinity(Mertins & Dimova, 2013). Thus the chemical functionalization of chitosan such as changing the hydrophobicity(Li et al., 2011), other than controlling the deacetylation degree, would also be an important approach to reach chitosan’s ultimate function in the biomedicine research.
4. Conclusion Through MD simulations, the binding kinetics and stable patterns of chitosan polymer to DNA duplex were systematically studied. The chitosan with high degree of deacetylation would bind to DNA in a quicker manner than that with low deacetylation degree, and form more stable complex. Upon chitosan binding, the DNA duplex can transform into a relatively compact structure with distortions happened for the native structure. Through energy decomposition analyses, the columbic energy term between chitosan and DNA is found to play a major (but not dominant) role in the binding, and becomes weaker when degree of deacetylation decreases. The van der Waals interaction part plays a minor role and is almost independent to the deacetylation degree. It is important to find that the GC-rich segment displays a restrained diffusion than that of AT-rich segment, and the Watson Crick hydrogen bonds between G - C nucleotides demonstrate higher stability than those of A - T with the existence of chitosan. Thus DNA duplexes that are rich in G and C nucleotides are expected to easily condensate at the macroscopic level. The protonation of the amino groups plays a limited role in regulating the DNA-chitosan binding, which reflects the fact that chemical functionalization of chitosan to change the hydrophobicity would be an alternative solution to optimize its functions. Limited by computing power resources, short segment models for chitosan (DP 10) and DNA (23 base pairs) were adopted in the current study, while in the experiment, the chitosan and DNA molecular weights are rather large. The overall complexation structures should also depend on the molecular weight. Generally, the binding kinetics and characteristics between chitosan and DNA revealed from current studies can still be extrapolated to guide future experimental chitosan sutdies in biological and medical related applications. Acknowledgement This work is financially supported by the National Natural Science Foundation of China (21405108, 11304214 and 31500802), China Postdoctoral Science Foundation (2015M581852, 2016T90487 and 2016M601875) and the Natural Science Foundation
of Jiangsu Province (BK20150350). W. F. Li thanks the support from Jiangsu Provincial Key Laboratory of Radiation Medicine and Protection and A Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD). Reference Agirre, M., Zarate, J., Ojeda, E., Puras, G., Desbrieres, J., & Pedraz, J. (2014). Low Molecular Weight Chitosan (LMWC)-based Polyplexes for pDNA Delivery: From Bench to Bedside. Polymers, 6(6), 1727. Alameh, M., DeJesus, D., Jean, M., Darras, V., Thibault, M., Lavertu, M., Buschmann, M. D., & Merzouki, A. (2012). Low molecular weight chitosan nanoparticulate system at low N: P ratio for nontoxic polynucleotide delivery. Int J Nanomedicine, 7, 1399-1414. Berendsen, H. J. C., Postma, J. P. M., van Gunsteren, W. F., & Hermans, J. (1981). Interaction Models for Water in Relation to Protein Hydration. In B. Pullman (Ed.). Intermolecular Forces: Proceedings of the Fourteenth Jerusalem Symposium on Quantum Chemistry and Biochemistry Held in Jerusalem, Israel, April 13–16, 1981 (pp. 331-342). Dordrecht: Springer Netherlands. Berk, H., Henk, B., Herman, J. C. B., & Johannes, G. E. M. F. (1997). LINCS: A linear constraint solver for molecular simulations. Journal of Computational Chemistry, 18(12), 1463-1472. Borchard, G. (2001). Chitosans for gene delivery. Advanced Drug Delivery Reviews, 52(2), 145-150. Bussi, G., Donadio, D., & Parrinello, M. (2007). Canonical sampling through velocity rescaling. The Journal of Chemical Physics, 126(1), 014101. Cui, Z., & Mumper, R. J. (2001). Chitosan-based nanoparticles for topical genetic immunization. Journal of Controlled Release, 75(3), 409-419. D.A. Case, R. M. B., W. Botello-Smith, D.S. Cerutti, T.E. Cheatham, III, T.A. Darden, R.E. Duke, T.J. Giese, H. Gohlke, A.W. Goetz, N. Homeyer, S. Izadi, P. Janowski, J. Kaus, A. Kovalenko, T.S. Lee, S. LeGrand, P. Li, C. Lin, T. Luchko, R. Luo, B. Madej, D. Mermelstein, K.M. Merz, G. Monard, H. Nguyen, H.T. Nguyen, I. Omelyan, A. Onufriev, D.R. Roe, A. Roitberg, C. Sagui, C.L. Simmerling, J. Swails, R.C. Walker, J. Wang, R.M. Wolf, X. Wu, L. Xiao, D.M. York and P.A. Kollman. (2016). AMBER 16. University of California, San Francisco. Darden, T., York, D., & Pedersen, L. (1993). Particle mesh Ewald: An N [center-dot] log(N) method for Ewald sums in large systems. The Journal of Chemical Physics, 98(12), 10089-10092. Daura, X., Gademann, K., Jaun, B., Seebach, D., van Gunsteren, W. F., & Mark, A. E. (1999). Peptide Folding: When Simulation Meets Experiment. Angewandte Chemie International Edition, 38(1-2), 236240. David Van Der, S., Erik, L., Berk, H., Gerrit, G., Alan, E. M., & Herman, J. C. B. (2005). GROMACS: Fast, flexible, and free. Journal of Computational Chemistry, 26(16), 1701-1718. Fang, N., Chan, V., Mao, H.-Q., & Leong, K. W. (2001). Interactions of phospholipid bilayer with chitosan: effect of molecular weight and pH. Biomacromolecules, 2(4), 1161-1168. Franca, E. F., Freitas, L. C. G., & Lins, R. D. (2011). Chitosan molecular structure as a function of Nacetylation. Biopolymers, 95(7), 448-460. Franca, E. F., Lins, R. D., Freitas, L. C. G., & Straatsma, T. P. (2008). Characterization of Chitin and Chitosan Molecular Structure in Aqueous Solution. Journal of Chemical Theory and Computation, 4(12), 21412149.
Hagan, K. A., Meier, W. L., Ferrance, J. P., & Landers, J. P. (2009). Chitosan-coated silica as a solid phase for RNA purification in a microfluidic device. Analytical Chemistry, 81(13), 5249-5256. Ilium, L. (1998). Chitosan and Its Use as a Pharmaceutical Excipient. Pharmaceutical Research, 15(9), 1326-1331. Illum, L., Jabbal-Gill, I., Hinchcliffe, M., Fisher, A. N., & Davis, S. S. (2001). Chitosan as a novel nasal delivery system for vaccines. Advanced Drug Delivery Reviews, 51(1–3), 81-96. Köping-Höggård, M., Tubulekas, I., Guan, H., Edwards, K., Nilsson, M., Vårum, K., & Artursson, P. (2001). Chitosan as a nonviral gene delivery system. Structure–property relationships and characteristics compared with polyethylenimine in vitro and after lung administration in vivo. Gene Therapy, 8, 11081121. Kiang, T., Wen, J., Lim, H. W., & Leong, K. W. (2004). The effect of the degree of chitosan deacetylation on the efficiency of gene transfection. Biomaterials, 25(22), 5293-5301. Kumar, M. N. V. R., Muzzarelli, R. A. A., Muzzarelli, C., Sashiwa, H., & Domb, A. J. (2004). Chitosan Chemistry and Pharmaceutical Perspectives. Chemical Reviews (Washington, DC, United States), 104(12), 6017-6084. Lavertu, M., Methot, S., Tran-Khanh, N., & Buschmann, M. D. (2006). High efficiency gene transfer using chitosan/DNA nanoparticles with specific combinations of molecular weight and degree of deacetylation. Biomaterials, 27(27), 4815-4824. Leong, K. W., Mao, H. Q., Truong-Le, V. L., Roy, K., Walsh, S. M., & August, J. T. (1998). DNA-polycation nanospheres as non-viral gene delivery vehicles. Journal of Controlled Release, 53(1–3), 183-193. Li, P., Poon, Y. F., Li, W., Zhu, H.-Y., Yeap, S. H., Cao, Y., Qi, X., Zhou, C., Lamrani, M., Beuerman, R. W., Kang, E.-T., Mu, Y., Li, C. M., Chang, M. W., Jan Leong, S. S., & Chan-Park, M. B. (2011). A polycationic antimicrobial and biocompatible hydrogel with microbe membrane suctioning ability. Nature Materials, 10(2), 149-156. Li, W., Nordenskiöld, L., & Mu, Y. (2011). Sequence-Specific Mg2+–DNA Interactions: A Molecular Dynamics Simulation Study. The Journal of Physical Chemistry B, 115(49), 14713-14720. Lim, S. T., Martin, G. P., Berry, D. J., & Brown, M. B. (2000). Preparation and evaluation of the in vitro drug release properties and mucoadhesion of novel microspheres of hyaluronic acid and chitosan. Journal of Controlled Release, 66(2–3), 281-292. Liu, W., Sun, S., Cao, Z., Zhang, X., Yao, K., Lu, W. W., & Luk, K. (2005). An investigation on the physicochemical properties of chitosan/DNA polyelectrolyte complexes. Biomaterials, 26(15), 27052711. Ma, P. L., Lavertu, M., Winnik, F. M., & Buschmann, M. D. (2009). New Insights into chitosan− DNA interactions using isothermal titration microcalorimetry. Biomacromolecules, 10(6), 1490-1499. Mao, H.-Q., Roy, K., Troung-Le, V. L., Janes, K. A., Lin, K. Y., Wang, Y., August, J. T., & Leong, K. W. (2001). Chitosan-DNA nanoparticles as gene carriers: synthesis, characterization and transfection efficiency. Journal of Controlled Release, 70(3), 399-421. Mertins, O., & Dimova, R. (2013). Insights on the interactions of chitosan with phospholipid vesicles. part i: Effect of polymer deprotonation. Langmuir, 29(47), 14545-14551. Monck, M., Mori, A., Lee, D., Tam, P., Wheeler, J., Cullis, P., & Scherrer, P. (2000). Stabilized plasmid–lipid particles: pharmacokinetics and plasmid delivery to distal tumors following intravenous injection. Journal of Drug Targeting, 7(6), 439-452. Mumper, R. J., Wang, J., Claspell, J. M., & Rolland, A. P. (1995). Novel polymeric condensing carriers for gene delivery. Proc. Int. Sym. Controlled Release. Bioactive Mater., 22, 178-179.
Onishi, H., & Machida, Y. (1999). Biodegradation and distribution of water-soluble chitosan in mice. Biomaterials, 20(2), 175-182. Pack, D. W., Hoffman, A. S., Pun, S., & Stayton, P. S. (2005). Design and development of polymers for gene delivery. Nat Rev Drug Discov, 4(7), 581-593. Pandit, K. R., Nanayakkara, I. A., Cao, W., Raghavan, S. R., & White, I. M. (2015). Capture and direct amplification of DNA on chitosan microparticles in a single PCR-optimal solution. Analytical Chemistry, 87(21), 11022-11029. Panyam, J., & Labhasetwar, V. (2003). Biodegradable nanoparticles for drug and gene delivery to cells and tissue. Advanced Drug Delivery Reviews, 55(3), 329-347. Ravi Kumar, M. N. V. (2000). A review of chitin and chitosan applications. Reactive and Functional Polymers, 46(1), 1-27. Romøren, K., Pedersen, S., Smistad, G., Evensen, Ø., & Thu, B. J. (2003). The influence of formulation variables on in vitro transfection efficiency and physicochemical properties of chitosan-based polyplexes. International Journal of Pharmaceutics, 261(1), 115-127. Roy, K., Mao, H.-Q., Huang, S. K., & Leong, K. W. (1999). Oral gene delivery with chitosan-DNA nanoparticles generates immunologic protection in a murine model of peanut allergy. Natural Medicines, 5(4), 387-391. Sannan, T., Kurita, K., & Iwakura, Y. (1976). Studies on chitin, 2. Effect of deacetylation on solubility. Die Makromolekulare Chemie, 177(12), 3589-3600. Sato, T., Ishii, T., & Okahata, Y. (2001). In vitro gene delivery mediated by chitosan. Effect of pH, serum, and molecular mass of chitosan on the transfection efficiency. Biomaterials, 22(15), 2075-2080. Strand, S. P., Danielsen, S., Christensen, B. E., & Vårum, K. M. (2005). Influence of chitosan structure on the formation and stability of DNA-chitosan polyelectrolyte complexes. Biomacromolecules, 6(6), 33573366. Strauss, J. K., & Maher, L. J., 3rd. (1994). DNA bending by asymmetric phosphate neutralization. Science, 266(5192), 1829-1834. Templeton, N. S., Lasic, D. D., Frederik, P. M., Strey, H. H., Roberts, D. D., & Pavlakis, G. N. (1997). Improved DNA: liposome complexes for increased systemic delivery and gene expression. Nat Biotech, 15(7), 647-652. Wolf, A., & Kirschner, K. N. (2013). Principal component and clustering analysis on molecular dynamics data of the ribosomal L11•23S subdomain. Journal of Molecular Modeling, 19(2), 539-549. Wolff, J., Malone, R., Williams, P., Chong, W., Acsadi, G., Jani, A., & Felgner, P. (1990). Direct gene transfer into mouse muscle in vivo. Science, 247(4949), 1465-1468. Zufferey, R., Nagy, D., Mandel, R. J., Naldini, L., & Trono, D. (1997). Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat Biotech, 15(9), 871-875.
Table 1. Structural parameters of three chitosan models and simulation box contents.
Systema
Molecular
Degree of
Weight
Deacetylation
Simulation box contents Sequenceb DNA
Ions
Water
64 Na+ CHS1.0
1634.64
100%
d-p-d-p-d-p-d-p-d-p
1
23 Cl-
32511
66 Na+ CHS0.6
1800.77
60%
d-c-p-d-c-p-c-d-p-c
1
CHT
2049.97
0%
c-c-c-c-c-c-c-c-c-c
1
23 Cl-
32489
69 Na+ 23 Cl-
32485