Binge-like intake of HFD attenuates alcohol intake in rats

    Binge-like intake of HFD attenuates alcohol intake in rats Sunil Sirohi, Arriel Van Cleef, Jon F. Davis PII: DOI: Reference:

S0031-9384(16)30599-6 doi:10.1016/j.physbeh.2016.10.006 PHB 11516

To appear in:

Physiology & Behavior

Received date: Revised date: Accepted date:

1 August 2016 7 October 2016 11 October 2016

Please cite this article as: Sirohi Sunil, Van Cleef Arriel, Davis Jon F., Bingelike intake of HFD attenuates alcohol intake in rats, Physiology & Behavior (2016), doi:10.1016/j.physbeh.2016.10.006

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT

MA

NU

SC

RI

PT

Binge-Like Intake of HFD Attenuates Alcohol Intake in Rats.

D

Abbreviated title: A palatable diet selectively attenuates alcohol consumption

AC CE P

*Corresponding Author:

TE

Number of words: Abstract 264, Total word count 3996, Figures 6

Jon F. Davis, PhD Department of Integrative Physiology and Neuroscience College of Veterinary Medicine Washington State University 1815 Ferdinand’s Lane Pullman, WA, 99164 Tel (Office): 509-335-8163 E-mail: - [email protected]

Keywords: Alcohol Drinking, High-Fat Diet, Palatable Food, Anxiety

AC CE P

TE

D

MA

NU

SC

RI

PT

ACCEPTED MANUSCRIPT

AC CE P

TE

D

MA

NU

SC

RI

PT

ACCEPTED MANUSCRIPT

ACCEPTED MANUSCRIPT ABSTRACT Binge eating and binge alcohol intake are behavioral manifestations of pathological feeding and alcohol

PT

use disorder (AUD), respectively. Binge-feeding and AUD have high comorbidity with other psychiatric

RI

disorders such as depression, which could have important implications for the management of these conditions. Importantly, these behaviors share many common features suggesting a singular etiology.

SC

However, the nature by which binge-feeding affects the development or maintenance of AUD is unclear.

NU

The present study examined the impact of a binge-feeding from a nutritionally complete high-fat diet (HFD) on initiation and maintenance of alcohol intake, anxiolytic behavior and central genetic changes in

MA

brain regions that control alcohol-reinforced behaviors. To do this, male Long Evans rats received chow (controls) or HFD every three days (HFD-3D) or every day (HFD-ED) for 5 weeks. Rodent chow and

D

water were available ad-libitum to all groups throughout the experiment. Following 5 weeks of HFD

TE

cycling, 20.0% ethanol or 2.0% sucrose intake was evaluated. In addition, anxiety-like behavior was measured using a light-dark box apparatus. Both HFD-3D and -ED group of rats consumed significantly

AC CE P

large amount of food during 2hr HFD access sessions and reduced their chow intake in the next 22 hrs. Surprisingly, binge-fed rats displayed attenuated acquisition of alcohol intake whereas sucrose consumption was unaffected. Rats exposed to HFD spent more time in the light side compared to chow controls, indicating that binge-feeding induced anxiolytic effects. In addition, alterations in the brain neurotensin system were observed following HFD exposure. These data indicate that binge-feeding behavior induces behavioral and genetic changes that help explain how alcohol intake is influenced by comorbid eating disorders.

ACCEPTED MANUSCRIPT INTRODUCTION The United States spends $224 billion annually to combat alcohol use disorder (AUD) [1,2]. AUD and

PT

disordered feeding behaviors frequently co-occur in the presence of other psychiatric disorders [3–7]. Binge eating, characterized by eating a large amount of food in short period of time, and loss of control

RI

over feeding, is a behavioral manifestation common to many forms of disordered feeding [8]. Some

SC

individuals that binge eat develop AUD, metabolic complications, obesity, and depressive-like symptoms over the course of time [9–13] thus exacerbating overall health risk for these patients.

NU

Binge eating is defined by uncontrolled hyperphagia (which has both subjective and objective

MA

components, respectively) and based on DSM criteria. Importantly, various rodent models have emerged to model binge eating behavior [14,15]. However, no model can exactly mimic all dimensions of human

D

binge feeding. Time-limited access to a palatable food has been shown to induce repeated episodes of

TE

hyperphagia and has been suggested a helpful rodent model to study binge eating [14,16–18]. We have previously utilized similar limited access paradigm, which induced repeated alternations between caloric

AC CE P

overconsumption and voluntary calorie restriction to study binge-like feeding in rodents [16]. In the current study, we did not observe escalation of HFD intake over the two-hour access period in HFD-3D rats relative to HFD–ED rats, a comparison previously used to operationally define binge-like feeding in rats [14]. Despite the lack of HFD escalation, we contend that alternations between caloric overconsumption and voluntary caloric restriction as observed in our model are pertinent events that model binge feeding clinically and allow us to evaluate these binge-like effects on alcohol intake in nondependent Long Evans rats. It is now well appreciated that food and alcohol intake are controlled by a shared set of neuronal substrates [20,21] and like drugs of abuse, palatable foods are capable of activating brain reward circuitry [22,23]. In this context, feeding peptides generated by the gut and brain have proven to be critical factors that control feeding, food reinforced behavior, alcohol intake and alcohol seeking [24–28]. Moreover, feeding peptides are released during anticipation of scheduled meals, following ingestion of calories, and

ACCEPTED MANUSCRIPT in response to caloric restriction or environmental stressors [29–35]. Furthermore, feeding peptides regulate ingestive and addictive behavior by acting on brain reward circuits [24,36], a process capable of

PT

influencing mood, emotional behaviors and AUD [24,37–39]. Therefore, the effect of binge feeding on alcohol intake could be controlled by any of these physiological processes. Neurotensin is one such

RI

neuropeptide, which is expressed heavily in the corticostriatal-limbic circuitry [40] and has been

SC

implicated in mediating a wide range of actions, including regulation of feeding, alcohol intake and anxiety like behavior [24,41–44]. In addition, ingestion of fat has been shown to alter both peripheral and

NU

central neurotensin levels [45,46] which in turn can regulate ethanol intoxication and consumption

MA

[47,48]. However, currently the nature by which binge-intake of HFD, or the central signaling mechanisms that control this response, affects development or maintenance of AUDs is unclear. Here, we hypothesized that binge-like intake of HFD would lead to escalated alcohol consumption in non-

TE

D

dependent rats. To test this contention, we investigated alcohol intake following exposure to an intermittent access feeding paradigm that induces a binge-like pattern of feeding in non-dependent Long

AC CE P

Evans rats. Using this model, we investigated alcohol intake, sucrose intake, anxiolytic behavior, and central genetic expression of neurotensin and neurotensin-1 receptor in brain regions that control alcohol intake and alcohol reinforced behaviors, respectively.

METHODS and MATERIALS Animals

Male Long-Evans rats (Harlan, IN) were housed in an environmentally controlled vivarium on a reverse light cycle (lights off at 7 a.m.). Food and water was available ad libitum and animals were handled gently for one week prior to any experimental manipulation. All work adhered to National Research Council’s Guide for the Care and Use of Laboratory and Institutional Animal Care and Use Committee guidelines at Washington State University, WA. Diets

ACCEPTED MANUSCRIPT All groups of rats had ad libitum access to chow (Teklad, 3.41 kcal/g, 0.51 kcal/g from fat) throughout. In addition, rats in the experimental group received intermittent access to a nutritionally complete high-fat

PT

diet (HFD) (Research Diets #D03082706, New Brunswick, NJ, 4.54 kcal/g, 1.71 kcal/g from fat). Detailed dietary composition of standard rodent chow and HFD has been described previously [16].

RI

General Procedure

SC

Rats matched for body weight and food intake received 2hr access to chow (controls; n=10) or HFD every three days (HFD-3D; n=5) or every day (HFD-ED; n=5), at the onset of their subjective dark cycle, as

NU

described in Fig 1a. Standard chow and water were available ad libitum and never removed from the rat

MA

cages. Food intake was measured each day and body weight was recorded every fourth day, except on alcohol and sucrose intake days, when rats were weighed daily. Following five weeks of intermittent cycling of HFD, all rats underwent a series of test while still maintained on intermittent HFD paradigm,

TE

D

unless noted otherwise. Since the primary goal of the present study was to evaluate the impact of bingelike feeding on alcohol intake, we first examined 20.0% ethanol consumption on multiple separate alcohol

AC CE P

intake sessions. Since, rats in both HFD-3D and HFD-ED groups were restricting calories following HFD exposure, the observed decreases in alcohol intake could be a reflection of this phenomenon or impaired reward-related ingestive behavior following HFD exposure. Therefore, next 2.0% sucrose consumption was evaluated in the same set of controls, HFD-3D, and HFD-ED rats under identical conditions (on the following days of HFD exposure) over two separate occasions. Alcohol and sugar solution were always presented at the onset of dark cycle on the following day of HFD exposure. Next, we examined if bingelike paradigm impacted anxiety-like behavior. For this, a separate group of rats (n=5-6/group) underwent a similar intermittent HFD paradigm as explained above and were subsequently tested for anxiety-like behavior in the Light and Dark box. Finally, this set of rats, that had no exposure to alcohol, were sacrificed for gene expression analysis. Alcohol and Sugar Solution Drinking Procedure Following 5 weeks of patterned feeding, 20.0% ethanol intake was examined on six separate 2hr alcohol drinking sessions while rats were still maintained on the binge-like feeding schedule. Next, in order to

ACCEPTED MANUSCRIPT examine if abstinence from HFD would impact alcohol consumption in HFD-3D or HFD-ED rats, HFD access was suspended for 5 days and all groups of rats were allowed to drink 20.0% ethanol on two

PT

separate sessions after this five-day period. During these tests (days 7 & 8), alcohol intake was measured following 2hr and 12 hr. Following these two intake tests, rats resumed binge-feeding for 2 additional

RI

weeks (Fig 1a); no alcohol testing occurred during this time period. Two weeks after binge exposure, we

SC

again measured alcohol intake on two separate days (9 & 10) while rats were still maintained on the intermittent HFD schedule.

NU

On testing days, which occurred one day following HFD exposure, rats received unsweetened alcohol

MA

drinking using a two-bottle choice paradigm [49]. During these tests, rats received alcohol at the same time of day that HFD was presented. Briefly, on alcohol testing days each rat received one bottle of 20% alcohol and one bottle of water at the onset of dark cycle. Position of alcohol and water bottles were

TE

D

alternated across sessions to account for conditioning effects on drinking behavior. All bottles were gently removed weighed following each session to evaluate alcohol consumption. Alcohol intake is expressed as

AC CE P

intake per kilogram of body weight (g/kg). We also tested sucrose preference under identical conditions. All rats were allowed to drink sugar solution (2% in tap water) using same two bottle choice paradigm. Anxiety-like Behavior Testing

A separate cohort of rats (n=5-6/group) were exposed to an similar binge-feeding regimen as described above (Fig 1a) and were tested for anxiety-like behavior using a light dark box apparatus [50,51]. To do this, rats in each group were gently introduced in the light-side (600 lux) facing dark-side (4 lux) of the box and allowed to freely explore between compartments for 10 min. These testing occurred on the following day of HFD exposure. The total number of entries and time spent in the light-side were quantified. RTqPCR Following LD Box testing, rats maintained on the binge-feeding regimen (Fig1a) were euthanized 1hr before HFD exposure. Brains were snap frozen and the medial-prefrontal cortex (mPFC) tissue, lateral hypothalamus (LH), and ventral tegmental area (VTA) were micro-dissected and stored until further

ACCEPTED MANUSCRIPT analysis. Total RNA was isolated using Qiagen RNeasy Micro Kit (Qiagen, CA) was quantified using Nano drop 2000c spectrophotometer. Complementary DNA (cDNA) was revere transcribed using High

PT

Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems, CA). The template cDNA was mixed with Fast SYBR® Green Master Mix (Applied Biosystems, CA) and assayed in

RI

triplicates on a 96 well plate with appropriate negative controls to detect contamination. The mRNA

SC

expression of rn45s (house-keeping gene), neurotensin, neurotensin receptor 1 and 2 was measured by real-time qPCR using ViiA 7 real-time PCR system (Life Technologies Corporation, NY). The primers

NU

(IDT, San Diego, CA, USA) used were as follow: rn45s, left-GTGGAGCGATTTGTCTGGTT and right-

MA

CGCTGAGCCAGTTCAGTGTA; neurotensin (Nrtn), left-GAGAGCTCCTTCCGTGTCTG and rightTTCCTTTGCTGACCTTCGAT; neurotensin receptor-1 (Nrtn-R1), leftGAGAAGCCCCCAAAATTCTC and right-CAAGGACCCAGTGCAGGTAT; neurotensin receptor 2

TE

D

(Nrtn-R2), left-CCAGCCTGGGAGAAATACAA and right-AGGCCACGGTTCC TATTCTT. All qPCR runs included a melt curve analysis to ensure the specificity of the primers. Relative quantification of the

AC CE P

amount of target transcript was done using 2‑ ΔCt method. Statistical Analysis

A univariate ANOVA compared body weight, daily energy intake and light and dark box data. Alcohol consumption and sucrose intake data were analyzed by mixed-model two-way ANOVA, with post-hoc tests to compare within group effects. The within-subject variable was time intervals (time of measurements) and the between-groups variable was exposure (chow, HFD-3D or HFD-ED). RTqPCR data were analyzed by one-way ANOVA. All statistical comparisons were conducted at 0.05 α level with power >0.8 (β=0.2). RESULTS Limited HFD Access Induced a Pattern of Binge/Compensate Feeding Rats in both groups (i.e., HFD-3D and -ED) receiving limited access to HFD (Fig 1a) displayed a pattern of feeding that included caloric overconsumption followed by voluntary caloric restriction without

ACCEPTED MANUSCRIPT impacting body weight (Fig 1b). Specifically, rats in the HFD-3D group displayed alternating cycles of caloric overconsumption (24 hr chow + HFD intake) followed by compensatory restriction, whereas rats

PT

in the HFD-ED group displayed significant increases in total caloric intake (24hr chow + HFD intake) at various time points across the HFD exposure, an effect that dissipated by the end of the study period (Fig

RI

2a). A univariate ANOVA identified the main effect (F2.0, 17 = 64.19, p= 0.000, power=1.0) of HFD

SC

exposure, which was further confirmed by post-hoc analysis that 2hr caloric intake in both groups of rats (HFD-3D and -ED) was significantly (p<0.000) higher compared to chow controls (Fig 2b). In addition, a

NU

significant (F2.0, 17 = 29.92, p= 0.000, power=1.0) main effect of HFD access on reduced food intake over

MA

the 22h following HFD exposure was also observed for both HFD groups (p<0.000) (Fig 2c), as revealed by a univariate ANOVA.

D

Alcohol Consumption was Attenuated Following Binge-like Feeding

TE

Following five weeks of intermittent HFD cycling, all groups of rats were exposed to a 20% alcohol

AC CE P

solution using a 2-bottle-choice drinking paradigm as described in methods. Similar to the HFD access time duration, rats were allowed to drink alcohol for 2hr on the following day of HFD exposure and data were analyzed by a mixed-model two-way ANOVA. Initially, alcohol intakes were negligible, meaning that intakes in all rats were not significantly different from zero (days 1-6) (Fig 3a). When alcohol testing (days 7 and 8) occurred following feeding regimen release, a non-significant decrease in alcohol intake was observed in both HFD-3D and -ED groups of rats at both 2hr (Fig 3a) and 12 hr (Fig 3b) time points compared to chow controls. Statistical significant (p<0.05) difference was only evident at 8th day of alcohol testing as revealed by one-way ANOVA. 2 weeks after continued binge-exposure, a mixed-model two-way ANOVA identified a main effect of HFD exposure (F2, 17 = 15.627, p= 0.000, power=1.0) on alcohol consumption (Fig 3a), (days 9 and 10), suggesting that binge-feeding attenuated alcohol intake. We further analyzed 2hr alcohol drinking data across all testing sessions to evaluate if the acquisition of drinking differed between groups. For control rats, a significant (p<0.05; when compared to zero) increase in alcohol drinking was observed on day 5 and onwards, whereas in case of HFD-3D or -ED

ACCEPTED MANUSCRIPT group of rats this significant increase in alcohol drinking was not apparent until day 8. Furthermore, linear regression analysis revealed that slopes were also significantly different (F2, 181 = 11.47, p= 0.000)

PT

between groups, suggesting that binge-like intake of HFD attenuated the acquisition of alcohol intake.

RI

Binge Exposure did not Impact Sucrose Intake

SC

Next, we examined 2.0 % sucrose solution intake in both HFD-3D and -ED groups. We evaluated sucrose intake over two consecutive test sessions. Notably, no significant differences were observed between

NU

chow and HFD rats (Fig 4).

MA

Binge-Feeding Induced Anxiolytic-like Behavioral Effects

To determine if limited HFD access impacted anxiety-like behavior, rats from controls (chow), HFD-3D

D

and HFD-ED groups were tested for the time spent in the light side of the light and dark box. A univariate

TE

ANOVA identified a main effect of HFD exposure (F2, 14 = 5.44, p= 0.018, power=0.75). Post-hoc analysis further confirmed that rats in the HFD-ED group spent significantly more time in the light side of

AC CE P

the light and dark box compared to the HFD-3D (p<0.05) group and controls (p<0.01) (Fig 5). The total number of entries into the light side was not statistically significant between chow (8.50 ± 0.43), HFD-3D (10.60 ± 1.5) or HFD-ED (10.17 ± 1.54) rats. These data suggest that limited daily HFD exposure induced an anxiolytic state.

Binge-Feeding Altered Central Neurotensin Receptor mRNA Expression Finally, we measured neurotensin and its receptors mRNA in the medial prefrontal cortex (mPFC), lateral hypothalamus and ventral tegmental area (VTA) of controls and HFD groups. One-way ANOVA revealed a main effect (F2, 9 = 7.024, p= 0.015) of HFD exposure on Neurotensin receptor 1 (Nrtn R1) mRNA expression. Post hoc analysis further identified that Neurotensin receptor 1 mRNA expression was significantly (p<0.01) increased in the mPFC of HFD-3D group compared to chow controls (Fig 6a). In addition, a main effect (F2, 12 = 7.915, p= 0.006) of HFD exposure was also seen in case of Neurotensin receptor 2 (Nrtn R2) mRNA expression in the mPFC and post-hoc analysis further confirmed that

ACCEPTED MANUSCRIPT Neurotensin receptor 2 mRNA expression was significantly (p<0.05) decreased in the mPFC of HFD-ED group compared to controls (Fig 6b).

PT

DISCUSSION

RI

The goal of the current manuscript was to characterize the impact of binge-like feeding behavior on

SC

alcohol consumption. From this effort several significant findings emerged. First, our limited access paradigm produced an alternating pattern of caloric overconsumption followed by voluntary restriction

NU

from standard rodent chow, events pertinent for study of binge-like feeding behavior in rodents [17,52]. Second, surprisingly binge-like feeding led to decreased alcohol intake that was contrary to our initial

MA

hypothesis. Importantly the nature of this effect seemed to reflect an attenuated deprivation-induced alcohol intake effect secondary to binge exposure, and was not accompanied by increased body weight

D

gain. Moreover, decreased alcohol intake was not due to an overall deficit in general reward deficits, a

TE

claim illustrated by equivalent voluntarily sucrose consumption across all experimental groups. In

AC CE P

addition, rats exposed to our binge-feeding paradigm displayed an anxiolytic behavioral phenotype, as opposed to anxiogenic states that drive alcohol intake. Finally, binge feeding led to changes in expression of neurotensin receptors-1 & 2 in brain regions that coordinate food intake, control risk-taking behavior, and regulate alcohol-reinforced behaviors. Overall, these data suggest that binge-like feeding attenuates alcohol intake, potentially through induction central genetic changes in brain regions that control anxiolytic behavior and alcohol intake. Intermittent access to sugar, high fat diet, or injection of dietary lipids have been shown to enhance acquisition of alcohol intake in rodents [53,54]. In contrast with these previous findings, our current data indicate that binge intake of HFD attenuates alcohol consumption in non-alcohol dependent rodents. It is necessary to point out here that several critical variables should be considered when comparing the present data with previous findings. For instance, observations of HFD enhancing alcohol intake were made in rats selected for their inherent propensity to consume HFD. By self-selecting rats that consume excess HFD, it is possible that this process isolated a phenotype of rats genetically prone to consume

ACCEPTED MANUSCRIPT more calories per se, independent of the source (i.e. from food or alcohol). In the present study, rats were not segregated based on HFD consumption prior to binge feeding, thus we are unable to directly evaluate

PT

this variable.

RI

It is equally important to note the conditions under which alcohol intake was evaluated. In our study, rats received alcohol exposure while maintained on the binge-feeding protocol and after removal from this

SC

feeding regimen. After 5 weeks of cycling on the binge-feeding regimen, rats were released from the

NU

feeding regimen and alcohol intake measured on two separate days. At this point, we detected a nonsignificant decrease in alcohol intake. Following this observation, rats were returned to the binge-feeding

MA

schedule for two additional weeks (14days) and 2hr alcohol intake was measured on two separate 2hr drinking sessions. Under these conditions, we observed a significant decrease in 2hr alcohol intakes.

D

When considering the implication of this finding, it is worth noting when we observed decreased alcohol

TE

intake. Overall, after observing the acquisition of drinking behavior during 2hr alcohol drinking sessions, it appeared that binge-like feeding might have impacted the acquisition of alcohol intake. In order to test

AC CE P

this, we further analyzed 2hr alcohol drinking data across all testing sessions. For control rats, a significant (p<0.05; when compared to zero) increase in alcohol drinking was observed on day 5 and onwards, whereas in case of HFD-3D or -ED group of rats this significant increase in alcohol drinking was not observed until day 8. Previous studies indicate that Long Evans rats can voluntarily consume significant amount of alcohol over the first 5-6 alcohol drinking session without initiation procedures [34]. Furthermore, these cycles of alcohol intake and abstinence increase alcohol preference and shortterm deprivation followed by intermittent alcohol exposure is capable of producing alcohol deprivation effect (ADE; pronounced increase in alcohol intake and preference following abstinence)[40]. It is important to note that there was a 2-week period between 8th and 9th alcohol testing session, during which rats did not receive alcohol. Therefore, pronounced increase in alcohol intake observed in the control group on the 9th and 10th day in the present study could be a result of ADE. Interestingly, this effect was significantly low in the HFD-3D and HFD-ED groups of rats suggesting that intermittent or

ACCEPTED MANUSCRIPT daily restricted access to HFD attenuated ADE induced escalation of alcohol intake. Furthermore, linear regression analysis revealed that slopes were also significantly different between groups. These data

PT

suggest that binge-like intake of HFD impacted the acquisition of alcohol intake (defined as increased intake from initial exposure to day 8 & 9). Interestingly, when evaluated over a 12hr period, alcohol

RI

intake was also decreased in rats exposed to our binge-feeding paradigm, however this trend did not reach

SC

statistical significance. These results suggest that binge-like intake of HFD attenuated initiation or

NU

acquisition of alcohol intake and potentially also influenced ADE induced escalation of alcohol intake. It is necessary to mention here that the main difference between HFD-3D and HFD-ED groups was the

MA

frequency of 2hr HFD access sessions. HFD-ED rats received 3x more exposure to HFD compared to HFD-3D rats. Therefore, it is not clear if HFD exposure or the frequency of HFD contributed to the

D

observed reductions in alcohol intake and future studies are required to examine the contribution of each

TE

to the observed effect. It is also important to note that HFD-induced obesity was not present in our study, could also lead to reduced alcohol intake. Previous work from our group indicates that HFD-induced

AC CE P

obesity or prolonged access to HFD reduces mesolimbic DA turnover, attenuates operant responding and amphetamine reward [56]. Thus frequency of HFD exposure and/or development of an obese phenotype are additional critical variables that could negate alcohol intake. Moreover, future studies that examine drinking microstructure can help determine the timing and duration of binge-like effects on reduced alcohol intake.

Maintenance on HFD, that does not yield increases in body weight, attenuates amphetamine place preference, operant responding for sucrose, and leads to reduced dopamine turnover in the nucleus accumbens [56]. Exposure to HFD also leads to decreased dopamine transporter, and decreased psychostimulant-evoked dopamine release in the ventral striatum [57]. This combination of results indicates that prolonged exposure to palatable food may decrease overall brain reward function. Because rats in the current study were maintained on HFD for 5 weeks, the decreased alcohol intake we observed following binge-like feeding may have been due to a general decrease in reward-related behavior. To test

ACCEPTED MANUSCRIPT this contention, we measured sucrose intake in binge-fed and control rats over two separate testing sessions. Interestingly, binge-fed rats consumed equivalent volumes of sucrose when compared to chow

RI

was not explained by an overall decrease in reward-related behavior.

PT

fed controls at each testing session, suggesting that the observed decrease in alcohol intake we observed

Previous studies examining alcohol stimulatory effects following sugar or HFD evaluated alcohol

SC

consumption once the dietary manipulation had been released. In this context, removal from intermittent

NU

sugar or fat access produces fundamentally different behavioral states [58]. Rats given intermittent access to sugar experience withdrawal like symptoms [59,60]; importantly, withdrawal or negative affective

MA

states precipitate future bouts of alcohol intake [61–63]. Although, we detected decreased alcohol intake when rats were maintained on HFD, we also detected similar decreases once rats were removed from

D

HFD. Therefore, it is possible that removal from HFD may have altered anxiety-like behavior, and

TE

alcohol intake. Thus, we investigated anxiety-like behavior following the HFD binge-feeding regimen in the light/dark box apparatus. When using the light/dark box test, time spent in the light side is a surrogate

AC CE P

marker for risk-taking or anxiolytic behavior. In contrast to withdrawal from sugar, rats in the HFD-ED group spent significantly more time in the light side of the apparatus, indicating that restricted exposure to HFD induces anxiolytic behavior. These data are consistent with prior work examining withdrawal-like symptoms following HFD withdrawal in rodents [64] and suggest that withdrawal from binge-feeding in the current study potentially induces anxiolytic behavior, an opposite observation to that reported during withdrawal from sugar or alcohol [58,59,65]. There was no difference in the time spent in the light between chow and HFD-3D rats. Notably, the length and exposure history of a palatable food can induce fundamentally opposite behavioral outcomes [66,67]. For example, ad libitum access to HFD for 6 weeks has been shown to develop obesity and increase in anxiety-like behavior [68]. Therefore, our observation that HFD-ED rats displayed increased anxiolytic behavior could be due to the length and frequency of HFD exposure. Nevertheless, our results suggest that daily limited access to HFD is capable of influencing anxiety-like behavior without development of obesity.

ACCEPTED MANUSCRIPT Alcohol intake is controlled by multiple brain regions and signaling systems. To gain better insight into the neurobiological processes that may have driven the observed decrease in alcohol intake, we measured

PT

central genetic changes in brain regions that control palatable food and alcohol intake: the medial Prefrontal Cortex (mPFC), lateral hypothalamus (LH) and the ventral tegmental area (VTA). In these

RI

experiments, we focused on expression of neurotensin (Nrtn), a GI and brain-derived peptide, that

SC

influences both feeding and alcohol intake [44,69]. Central administration of neurotensin attenuates food intake [70] and rodents devoid of NR1 display hyperphagic feeding and gain excess body weight when

NU

maintained on a high fat diet [71]. Together, these findings indicate that neurotensin signaling negates

MA

palatable food intake and subsequent body weight gain in an obeseogenic environment. The LH is a brain region appreciated for its ability to coordinate metabolic need into behavioral action for food [72]. However, it is unclear, if LH neurotensin neurons participate in alcohol-related behaviors or if

TE

D

neurotensin signaling within the LH may control binge-like feeding effects on alcohol intake. In the present study, alternating bouts of caloric overconsumption and voluntary restriction HFD exposure

AC CE P

(HFD-3D rats) led to decreased neurotensin mRNA levels in the LH, however this effect did not reach statistical significance (p=0.09).

Once released, Nrtn binds the neurotensin-1 and -2 receptor subtypes [73]. Notably, activation of Nrtn R1 & Nrtn NR2 regulates sensitivity to alcohol and alcohol intake in rodents [74,75]. Specifically, mice devoid of Nrtn NR1 display enhanced alcohol intake and decreased sensitivity to the ataxic effects of alcohol [74]. In addition, central activation of Nrtn NR1 in wild-type mice leads to increased sensitivity to alcohol [74]. Together these observations suggest that endogenous activity of Nrtn NR1 attenuates alcohol intake. Interestingly, deletion of the Nrtn NR2 gene in mice leads to increased alcohol consumption and enhanced preference for alcohol [75]. When viewed collectively, these results indicate that Nrtn R1/2 signaling may serve a process in place to reduce alcohol intake. In the present study, we observed increased Nrtn NR1 mRNA expression in the mPFC of rats that displayed alternating bouts of caloric overconsumption and voluntary restriction (HFD-3D). Importantly we made this observation is

ACCEPTED MANUSCRIPT rats that were only exposed to the binge-feeding regimen, but not alcohol, which allowed us to isolate effects of HFD exposure. We suggest that decreased Nrtn R1 is a compensatory change leading to

PT

reduced alcohol intake in this group of rats. We also detected decreased mPFC Nrtn R2 expression in HFD-ED rats that displayed multiple bouts of caloric overconsumption and decreased alcohol intake. It is

RI

presently unclear if this change signifies an effect of feeding or alcohol intake. The key difference in

SC

HFD-3D and HFD-ED rats was the amount of HFD exposure, where HFD-ED rats received 3x more HFD exposure than HFD-3D rats. It is possible that decreased Nrtn R2 expression in HFD-ED rats

NU

reflects a desensitization of Nrtn signaling in the mPFC, a contention that warrants further investigation.

MA

Surprisingly, we detected no changes in Nrtn, or Nrtn R1/2 in the VTA, a brain region noted for its role in both food and alcohol intake.

D

However, it is of relevance to note that activation of Nrtn R1 in the medial Prefrontal Cortex (mPFC)

TE

increases extracellular - aminobutryic acid (GABA) levels [76]. Importantly, alcohol-drinking behavior is regulated by brain GABA release. For example, alcohol acts directly on ligand gated ion channels that

AC CE P

release GABA and alcohol consumption is reduced when GABA antagonists are applied to various brain regions involved in alcohol-reinforced behavior [77]. In addition to GABA release, alcohol increases mPFC neuronal activity, which presumably regulates behavioral effects produced secondary to alcohol intake [78,79]. Therefore, it is possible that Nrtn R1/NR2 activity within the mPFC reduces alcohol intake by increasing GABA release and enhancing sensitivity to the intoxicating effects of alcohol. This contention aligns well with the observation of decreased alcohol intake and increased Nrtn R1 expression in binge-fed rats but requires further experimental validation.

CONCLUSION To summarize, the present data indicate that binge intake of palatable food leads to decreases in alcohol intake in non-dependent rodents, an effect that occurs when rats are bingeing or once binge intake of HFD has ceased. The observation of decreased alcohol intake is unexplained by reduction in overall hedonic state or induction of negative affective state. Moreover, the data we present here suggest that changes in

ACCEPTED MANUSCRIPT central neurotensin signaling may play an integral role in regulating the effects of feeding on alcohol intake. Collectively, these data highlight the complexity with which the brain integrates metabolic

PT

information to control behavior. These observations provide fundamental insights that may help explain how feeding behavior can influence alcohol intake. Future studies are warranted to investigate Nrtn

NU

SC

to probe this mechanism across the varying phases of AUD.

RI

signaling in the frontal cortex as a potential mechanisms regulating caloric control of alcohol intake and

MA

ACKNOWLEDGEMENTS:

This work was supported by an Alcohol and Drug Abuse Research Program (ADARP) grant to JFD,

AC CE P

TE

Authors report no conflict of interest.

D

ADARP JFD FY 2015.

ACCEPTED MANUSCRIPT REFERENCES: B.F. Grant, D.A. Dawson, F.S. Stinson, S.P. Chou, M.C. Dufour, R.P. Pickering, The 12-month prevalence and trends in DSM-IV alcohol abuse and dependence: United States, 1991-1992 and 2001-2002., Drug Alcohol Depend. 74 (2004) 223–34. doi:10.1016/j.drugalcdep.2004.02.004.

[2]

E.E. Bouchery, H.J. Harwood, J.J. Sacks, C.J. Simon, R.D. Brewer, Economic costs of excessive alcohol consumption in the U.S., 2006., Am. J. Prev. Med. 41 (2011) 516–24. doi:10.1016/j.amepre.2011.06.045.

[3]

R.S. and S.S.O. Carlos M. Grilo, Eating Disorders and Alcohol Use Disorders, NIAAA Publ. (2002).

[4]

A.H. Conason, A. Brunstein Klomek, L. Sher, Recognizing alcohol and drug abuse in patients with eating disorders., QJM. 99 (2006) 335–9. doi:10.1093/qjmed/hcl030.

[5]

F. Laghi, R. Baiocco, F. Liga, A. Lonigro, E. Baumgartner, Binge eating and binge drinking behaviors: individual differences in adolescents’ identity styles., J. Health Psychol. 19 (2014) 333– 43. doi:10.1177/1359105312470851.

[6]

C.M. Bulik, K.L. Klump, L. Thornton, A.S. Kaplan, B. Devlin, M.M. Fichter, K.A. Halmi, M. Strober, D.B. Woodside, S. Crow, J.E. Mitchell, A. Rotondo, M. Mauri, G.B. Cassano, P.K. Keel, W.H. Berrettini, W.H. Kaye, Alcohol use disorder comorbidity in eating disorders: a multicenter study., J. Clin. Psychiatry. 65 (2004) 1000–6. http://www.ncbi.nlm.nih.gov/pubmed/15291691 (accessed October 1, 2014).

[7]

E.C. Dunn, M.E. Larimer, C. Neighbors, Alcohol and drug-related negative consequences in college students with bulimia nervosa and binge eating disorder., Int. J. Eat. Disord. 32 (2002) 171–8. doi:10.1002/eat.10075.

[8]

R.C. Kessler, P.A. Berglund, W.T. Chiu, A.C. Deitz, J.I. Hudson, V. Shahly, S. Aguilar-Gaxiola, J. Alonso, M.C. Angermeyer, C. Benjet, R. Bruffaerts, G. de Girolamo, R. de Graaf, J. Maria Haro, V. Kovess-Masfety, S. O’Neill, J. Posada-Villa, C. Sasu, K. Scott, M.C. Viana, M. Xavier, The prevalence and correlates of binge eating disorder in the World Health Organization World Mental Health Surveys., Biol. Psychiatry. 73 (2013) 904–14. doi:10.1016/j.biopsych.2012.11.020.

[9]

K.R. Sonneville, N.J. Horton, N. Micali, R.D. Crosby, S.A. Swanson, F. Solmi, A.E. Field, Longitudinal associations between binge eating and overeating and adverse outcomes among adolescents and young adults: does loss of control matter?, JAMA Pediatr. 167 (2013) 149–55. doi:10.1001/2013.jamapediatrics.12.

[10]

C.C. Holderness, J. Brooks-Gunn, M.P. Warren, Co-morbidity of eating disorders and substance abuse review of the literature., Int. J. Eat. Disord. 16 (1994) 1–34. http://www.ncbi.nlm.nih.gov/pubmed/7920577 (accessed October 5, 2014).

[11]

H.H. Skinner, J. Haines, S.B. Austin, A.E. Field, A prospective study of overeating, binge eating, and depressive symptoms among adolescent and young adult women., J. Adolesc. Health. 50 (2012) 478–83. doi:10.1016/j.jadohealth.2011.10.002.

[12]

D.L. Franko, D.J. Dorer, P.K. Keel, S. Jackson, M.P. Manzo, D.B. Herzog, How do eating disorders and alcohol use disorder influence each other?, Int. J. Eat. Disord. 38 (2005) 200–7. doi:10.1002/eat.20178.

[13]

D.L. Franko, P.K. Keel, Suicidality in eating disorders: occurrence, correlates, and clinical

AC CE P

TE

D

MA

NU

SC

RI

PT

[1]

ACCEPTED MANUSCRIPT implications., Clin. Psychol. Rev. 26 (2006) 769–82. doi:10.1016/j.cpr.2006.04.001. R.L.W. Corwin, R.K. Babbs, Rodent models of binge eating: are they models of addiction?, ILAR J. 53 (2012) 23–34. http://www.ncbi.nlm.nih.gov/pubmed/23520597 (accessed October 6, 2014).

[15]

B.E. Wolfe, C.W. Baker, A.T. Smith, S. Kelly-Weeder, Validity and utility of the current definition of binge eating., Int. J. Eat. Disord. 42 (2009) 674–86. doi:10.1002/eat.20728.

[16]

J.F. Davis, S.J. Melhorn, J.D. Shurdak, J.U. Heiman, M.H. Tschöp, D.J. Clegg, S.C. Benoit, Comparison of hydrogenated vegetable shortening and nutritionally complete high-fat diet on limited access-binge behavior in rats., Physiol. Behav. 92 (2007) 924–30. doi:10.1016/j.physbeh.2007.06.024.

[17]

M. Perello, S. Valdivia, G. García Romero, J. Raingo, Considerations about rodent models of binge eating episodes., Front. Psychol. 5 (2014) 372. doi:10.3389/fpsyg.2014.00372.

[18]

L.A. Berner, N.M. Avena, B.G. Hoebel, Bingeing, self-restriction, and increased body weight in rats with limited access to a sweet-fat diet., Obesity (Silver Spring). 16 (2008) 1998–2002. doi:10.1038/oby.2008.328.

[19]

H. Zheng, L.M. Patterson, H.-R. Berthoud, Orexin signaling in the ventral tegmental area is required for high-fat appetite induced by opioid stimulation of the nucleus accumbens., J. Neurosci. 27 (2007) 11075–82. doi:10.1523/JNEUROSCI.3542-07.2007.

[20]

J.R. Barson, S.F. Leibowitz, Hypothalamic neuropeptide signaling in alcohol addiction., Prog. Neuropsychopharmacol. Biol. Psychiatry. (2015). doi:10.1016/j.pnpbp.2015.02.006.

[21]

J.R. Barson, I. Morganstern, S.F. Leibowitz, Similarities in hypothalamic and mesocorticolimbic circuits regulating the overconsumption of food and alcohol., Physiol. Behav. 104 (2011) 128–37. doi:10.1016/j.physbeh.2011.04.054.

[22]

D. Tomasi, N.D. Volkow, Striatocortical pathway dysfunction in addiction and obesity: differences and similarities., Crit. Rev. Biochem. Mol. Biol. 48 (2013) 1–19. doi:10.3109/10409238.2012.735642.

[23]

N.D. Volkow, G.J. Wang, J.S. Fowler, D. Tomasi, R. Baler, Food and drug reward: overlapping circuits in human obesity and addiction., Curr. Top. Behav. Neurosci. 11 (2012) 1–24. doi:10.1007/7854_2011_169.

[24]

C.A. Vadnie, J.H. Park, N. Abdel Gawad, A.M.C. Ho, D.J. Hinton, D.-S. Choi, Gut-brain peptides in corticostriatal-limbic circuitry and alcohol use disorders., Front. Neurosci. 8 (2014) 288. doi:10.3389/fnins.2014.00288.

[25]

R.H. Shirazi, S.L. Dickson, K.P. Skibicka, Gut peptide GLP-1 and its analogue, Exendin-4, decrease alcohol intake and reward., PLoS One. 8 (2013) e61965. doi:10.1371/journal.pone.0061965.

[26]

E. Egecioglu, J.A. Engel, E. Jerlhag, The Glucagon-Like Peptide 1 Analogue Exendin-4 Attenuates the Nicotine-Induced Locomotor Stimulation, Accumbal Dopamine Release, Conditioned Place Preference as well as the Expression of Locomotor Sensitization in Mice, PLoS One. 8 (2013) e77284. doi:10.1371/journal.pone.0077284.

[27]

E. Egecioglu, J.A. Engel, E. Jerlhag, The Glucagon-Like Peptide 1 Analogue, Exendin-4, Attenuates the Rewarding Properties of Psychostimulant Drugs in Mice, PLoS One. 8 (2013) e69010. doi:10.1371/journal.pone.0069010.

AC CE P

TE

D

MA

NU

SC

RI

PT

[14]

ACCEPTED MANUSCRIPT E. Egecioglu, P. Steensland, I. Fredriksson, K. Feltmann, J.A. Engel, E. Jerlhag, The glucagon-like peptide 1 analogue Exendin-4 attenuates alcohol mediated behaviors in rodents, Psychoneuroendocrinology. 38 (2013) 1259–1270. doi:10.1016/j.psyneuen.2012.11.009.

[29]

D.P. Begg, S.C. Woods, The endocrinology of food intake., Nat. Rev. Endocrinol. 9 (2013) 584– 97. doi:10.1038/nrendo.2013.136.

[30]

H.-R. Berthoud, Interactions between the “cognitive” and “metabolic” brain in the control of food intake, Physiol. Behav. 91 (2007) 486–498. doi:10.1016/j.physbeh.2006.12.016.

[31]

G.A. Bray, Afferent signals regulating food intake, Proc. Nutr. Soc. 59 (2000) 373–384. doi:10.1017/S0029665100000422.

[32]

D.E. Cummings, J. Overduin, Gastrointestinal regulation of food intake., J. Clin. Invest. 117 (2007) 13–23. doi:10.1172/JCI30227.

[33]

A.P. Coll, I.S. Farooqi, S. O’Rahilly, The hormonal control of food intake., Cell. 129 (2007) 251– 62. doi:10.1016/j.cell.2007.04.001.

[34]

A. Asakawa, A. Inui, T. Kaga, H. Yuzuriha, T. Nagata, M. Fujimiya, G. Katsuura, S. Makino, M.A. Fujino, M. Kasuga, A role of ghrelin in neuroendocrine and behavioral responses to stress in mice., Neuroendocrinology. 74 (2001) 143–7. doi:54680.

[35]

S.J. Spencer, L. Xu, M.A. Clarke, M. Lemus, A. Reichenbach, B. Geenen, T. Kozicz, Z.B. Andrews, Ghrelin regulates the hypothalamic-pituitary-adrenal axis and restricts anxiety after acute stress., Biol. Psychiatry. 72 (2012) 457–65. doi:10.1016/j.biopsych.2012.03.010.

[36]

S.J. Konturek, J.W. Konturek, T. Pawlik, T. Brzozowski, Brain-gut axis and its role in the control of food intake., J. Physiol. Pharmacol. 55 (2004) 137–54. http://www.ncbi.nlm.nih.gov/pubmed/15082874 (accessed September 13, 2016).

[37]

O.M. Farr, M.A. Tsoukas, C.S. Mantzoros, Leptin and the brain: influences on brain development, cognitive functioning and psychiatric disorders., Metabolism. 64 (2015) 114–30. doi:10.1016/j.metabol.2014.07.004.

[38]

M. Nollet, S. Leman, Role of Orexin in the Pathophysiology of Depression: Potential for Pharmacological Intervention, CNS Drugs. 27 (2013) 411–422. doi:10.1007/s40263-013-0064-z.

[39]

I. Morganstern, J.R. Barson, S.F. Leibowitz, Regulation of drug and palatable food overconsumption by similar peptide systems., Curr. Drug Abuse Rev. 4 (2011) 163–73. http://www.ncbi.nlm.nih.gov/pubmed/21999690 (accessed October 7, 2014).

[40]

P.J. Manberg, W.W. Youngblood, C.B. Nemeroff, M.N. Rossor, L.L. Iversen, A.J. Prange, J.S. Kizer, Regional Distribution of Neurotensin in Human Brain, J. Neurochem. 38 (1982) 1777– 1780. doi:10.1111/j.1471-4159.1982.tb06664.x.

[41]

F. St-Gelais, C. Jomphe, L.-E. Trudeau, The role of neurotensin in central nervous system pathophysiology: what is the evidence?, J. Psychiatry Neurosci. 31 (2006) 229–45. http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1488904&tool=pmcentrez&rendertype =abstract (accessed December 10, 2015).

[42]

C.L. Ehlers, C. Somes, T.-K. Li, L. Lumeng, B. Kinkead, M.J. Owens, C.B. Nemeroff, Neurotensin studies in alcohol naive, preferring and non-preferring rats, Neuroscience. 93 (1999) 227–236. doi:10.1016/S0306-4522(99)00113-X.

[43]

P.D. Shilling, D. Feifel, The neurotensin-1 receptor agonist PD149163 blocks fear-potentiated

AC CE P

TE

D

MA

NU

SC

RI

PT

[28]

ACCEPTED MANUSCRIPT startle., Pharmacol. Biochem. Behav. 90 (2008) 748–52. doi:10.1016/j.pbb.2008.05.025. J.H. Cooke, M. Patterson, S.R. Patel, K.L. Smith, M.A. Ghatei, S.R. Bloom, K.G. Murphy, Peripheral and central administration of xenin and neurotensin suppress food intake in rodents., Obesity (Silver Spring). 17 (2009) 1135–43. doi:10.1038/oby.2008.652.

[45]

B. Beck, A. Stricker-Krongrad, A. Burlet, J.P. Nicolas, C. Burlet, Changes in hypothalamic neurotensin concentrations and food intake in rats fed a high fat diet., Int. J. Obes. Relat. Metab. Disord. 16 (1992) 361–6. http://www.ncbi.nlm.nih.gov/pubmed/1319971 (accessed September 14, 2016).

[46]

E.J. Draviam, J.R. Upp, G.H. Greeley, C.M. Townsend, J.C. Thompson, Effect of oral fat on plasma levels of neurotensin and neurotensin fragments in humans. Characterization by highpressure liquid chromatography., Dig. Dis. Sci. 35 (1990) 200–4. http://www.ncbi.nlm.nih.gov/pubmed/2302977 (accessed September 14, 2016).

[47]

V.G. Erwin, B.C. Jones, Comparison of neurotensin levels, receptors and actions in LS/Ibg and SS/Ibg mice., Peptides. 10 (n.d.) 435–40. http://www.ncbi.nlm.nih.gov/pubmed/2547208 (accessed September 14, 2016).

[48]

C.B. Nemeroff, G. Bissette, A.J. Prange, P.T. Loosen, T.S. Barlow, M.A. Lipton, Neurotensin: central nervous system effects of a hypothalamic peptide., Brain Res. 128 (1977) 485–96. http://www.ncbi.nlm.nih.gov/pubmed/406965 (accessed September 14, 2016).

[49]

J.A. Simms, P. Steensland, B. Medina, K.E. Abernathy, L.J. Chandler, R. Wise, S.E. Bartlett, Intermittent access to 20% ethanol induces high ethanol consumption in Long-Evans and Wistar rats., Alcohol. Clin. Exp. Res. 32 (2008) 1816–23. doi:10.1111/j.1530-0277.2008.00753.x.

[50]

M. Bourin, M. Hascoët, The mouse light/dark box test, Eur. J. Pharmacol. 463 (2003) 55–65. doi:10.1016/S0014-2999(03)01274-3.

[51]

T.D. Gould, ed., Mood and Anxiety Related Phenotypes in Mice, Humana Press, Totowa, NJ, 2009. doi:10.1007/978-1-60761-303-9.

[52]

B.-L.A. Corwin RL, Behavioral models of binge-type eating, Physiol Behav. 82 (2004) 123–130.

[53]

N.M. Avena, C.A. Carrillo, L. Needham, S.F. Leibowitz, B.G. Hoebel, Sugar-dependent rats show enhanced intake of unsweetened ethanol., Alcohol. 34 (2004) 203–9. http://www.ncbi.nlm.nih.gov/pubmed/15902914 (accessed October 7, 2014).

[54]

C.A. Carrillo, S.F. Leibowitz, O. Karatayev, B.G. Hoebel, A high-fat meal or injection of lipids stimulates ethanol intake., Alcohol. 34 (2004) 197–202. http://www.ncbi.nlm.nih.gov/pubmed/15902913 (accessed November 4, 2015).

[55]

R.I. Melendez, L.D. Middaugh, P.W. Kalivas, Development of an alcohol deprivation and escalation effect in C57BL/6J mice., Alcohol. Clin. Exp. Res. 30 (2006) 2017–25. doi:10.1111/j.1530-0277.2006.00248.x.

[56]

J.F. Davis, A.L. Tracy, J.D. Schurdak, M.H. Tschöp, J.W. Lipton, D.J. Clegg, S.C. Benoit, Exposure to elevated levels of dietary fat attenuates psychostimulant reward and mesolimbic dopamine turnover in the rat., Behav. Neurosci. 122 (2008) 1257–1263.

[57]

J.J. Cone, E.H. Chartoff, D.N. Potter, S.R. Ebner, M.F. Roitman. Prolonged High Fat Diet Reduces Dopamine Reuptake without Altering DAT Gene Expression, PLoS One. 8 (2013) e58251. doi:10.1371/journal.pone.0058251.

AC CE P

TE

D

MA

NU

SC

RI

PT

[44]

ACCEPTED MANUSCRIPT N.M. Avena, P. Rada, B.G. Hoebel, Sugar and fat bingeing have notable differences in addictivelike behavior., J. Nutr. 139 (2009) 623–8. doi:10.3945/jn.108.097584.

[59]

C. Colantuoni, P. Rada, J. McCarthy, C. Patten, N.M. Avena, A. Chadeayne, B.G. Hoebel, Evidence that intermittent, excessive sugar intake causes endogenous opioid dependence., Obes. Res. 10 (2002) 478–88. doi:10.1038/oby.2002.66.

[60]

N.M. Avena, Examining the addictive-like properties of binge eating using an animal model of sugar dependence., Exp. Clin. Psychopharmacol. 15 (2007) 481–91. doi:10.1037/10641297.15.5.481.

[61]

N.W. Gilpin, H.N. Richardson, L. Lumeng, G.F. Koob, Dependence-induced alcohol drinking by alcohol-preferring (P) rats and outbred Wistar rats., Alcohol. Clin. Exp. Res. 32 (2008) 1688–96. doi:10.1111/j.1530-0277.2008.00678.x.

[62]

J.L. Kissler, S. Sirohi, D.J. Reis, H.T. Jansen, R.M. Quock, D.G. Smith, B.M. Walker, The onetwo punch of alcoholism: role of central amygdala dynorphins/kappa-opioid receptors., Biol. Psychiatry. 75 (2014) 774–82. doi:10.1016/j.biopsych.2013.03.014.

[63]

S. Sirohi, G. Bakalkin, B.M. Walker, Alcohol-induced plasticity in the dynorphin/kappa-opioid receptor system., Front. Mol. Neurosci. 5 (2012) 95. doi:10.3389/fnmol.2012.00095.

[64]

M.E. Bocarsly, L.A. Berner, B.G. Hoebel, N.M. Avena, Rats that binge eat fat-rich food do not show somatic signs or anxiety associated with opiate-like withdrawal: implications for nutrientspecific food addiction behaviors., Physiol. Behav. 104 (2011) 865–72. doi:10.1016/j.physbeh.2011.05.018.

[65]

C.E. Van Skike, J.L. Diaz-Granados, D.B. Matthews, Chronic intermittent ethanol exposure produces persistent anxiety in adolescent and adult rats., Alcohol. Clin. Exp. Res. 39 (2015) 262– 71. doi:10.1111/acer.12617.

[66]

S. Krishna, Z. Lin, C.B. de La Serre, J.J. Wagner, D.H. Harn, L.M. Pepples, D.M. Djani, M.T. Weber, L. Srivastava, N.M. Filipov, Time-dependent behavioral, neurochemical, and metabolic dysregulation in female C57BL/6 mice caused by chronic high-fat diet intake., Physiol. Behav. (2016). doi:10.1016/j.physbeh.2016.02.007.

[67]

A.L. Tracy, C.J.M. Wee, G.E. Hazeltine, R.A. Carter, Characterization of attenuated food motivation in high-fat diet-induced obesity: Critical roles for time on diet and reinforcer familiarity., Physiol. Behav. 141 (2015) 69–77. doi:10.1016/j.physbeh.2015.01.008.

[68]

S. Sharma, M.F. Fernandes, S. Fulton, Adaptations in brain reward circuitry underlie palatable food cravings and anxiety induced by high-fat diet withdrawal, Int. J. Obes. 37 (2012) 1183–1191. doi:10.1038/ijo.2012.197.

[69]

C.L. Ehlers, C. Somes, T.K. Li, L. Lumeng, B. Kinkead, M.J. Owens, C.B. Nemeroff, Neurontensin studies in alcohol naive, preferring and non-preferring rats., Neuroscience. 93 (1999) 227–36. http://www.ncbi.nlm.nih.gov/pubmed/10430486 (accessed December 10, 2015).

[70]

A.S. Levine, J. Kneip, M. Grace, J.E. Morley, Effect of centrally administered neurotensin on multiple feeding paradigms., Pharmacol. Biochem. Behav. 18 (1983) 19–23. http://www.ncbi.nlm.nih.gov/pubmed/6131439 (accessed December 10, 2015).

[71]

D. Opland, A. Sutton, H. Woodworth, J. Brown, R. Bugescu, A. Garcia, L. Christensen, C. Rhodes, M. Myers, G. Leinninger, Loss of neurotensin receptor-1 disrupts the control of the mesolimbic dopamine system by leptin and promotes hedonic feeding and obesity., Mol. Metab. 2 (2013) 423–34. doi:10.1016/j.molmet.2013.07.008.

AC CE P

TE

D

MA

NU

SC

RI

PT

[58]

ACCEPTED MANUSCRIPT A.E. Kelley, B.A. Baldo, W.E. Pratt, A proposed hypothalamic-thalamic-striatal axis for the integration of energy balance, arousal, and food reward., J. Comp. Neurol. 493 (2005) 72–85. doi:10.1002/cne.20769.

[73]

J.-P. Vincent, J. Mazella, P. Kitabgi, J.-P. Vincent, J. Mazella, P. Kitabgi, P.R. Dobner, et al., Neurotensin and neurotensin receptors, Trends Pharmacol. Sci. 20 (1999) 302–309. doi:10.1016/S0165-6147(99)01357-7.

[74]

M.R. Lee, D.J. Hinton, J.Y. Song, K.W. Lee, C. Choo, H. Johng, S.S. Unal, E. Richelson, D.-S. Choi, Neurotensin receptor type 1 regulates ethanol intoxication and consumption in mice., Pharmacol. Biochem. Behav. 95 (2010) 235–41. doi:10.1016/j.pbb.2010.01.012.

[75]

M.R. Lee, D.J. Hinton, S.S. Unal, E. Richelson, D.-S. Choi, Increased ethanol consumption and preference in mice lacking neurotensin receptor type 2., Alcohol. Clin. Exp. Res. 35 (2011) 99– 107. doi:10.1111/j.1530-0277.2010.01326.x.

[76]

K.A. Petrie, D. Schmidt, M. Bubser, J. Fadel, R.E. Carraway, A.Y. Deutch, Neurotensin activates GABAergic interneurons in the prefrontal cortex., J. Neurosci. 25 (2005) 1629–36. doi:10.1523/JNEUROSCI.3579-04.2005.

[77]

G.F. Koob, A role for GABA mechanisms in the motivational effects of alcohol, Biochem. Pharmacol. 68 (2004) 1515–1525. doi:10.1016/j.bcp.2004.07.031.

[78]

Y. Tu, S. Kroener, K. Abernathy, C. Lapish, J. Seamans, L.J. Chandler, J.J. Woodward, Ethanol inhibits persistent activity in prefrontal cortical neurons., J. Neurosci. 27 (2007) 4765–75. doi:10.1523/JNEUROSCI.5378-06.2007.

[79]

K. Abernathy, L.J. Chandler, J.J. Woodward, Alcohol and the prefrontal cortex., Int. Rev. Neurobiol. 91 (2010) 289–320. doi:10.1016/S0074-7742(10)91009-X.

AC CE P

TE

D

MA

NU

SC

RI

PT

[72]

ACCEPTED MANUSCRIPT

FIGURE CAPTIONS: Figure 1. Schematic description of the binge-feeding protocol and body weight at the end of study.

PT

A) Rats received 2hr access to chow (controls) or HFD every third day (HFD-3D) or every day (HFD-ED)

RI

for five weeks. Normal chow was available to controls and all groups at all times. Food intake was

SC

measured daily, unless otherwise noted. Following five weeks of limited access cycling of HFD, 20.0% ethanol or 2.0% sucrose consumption was evaluated or behavioral testing occurred on the following day of

NU

HFD access. B) No significant body weight changes existed between groups when observed at the end of study.

MA

Figure 2. Daily energy consumption and body weight following 5 weeks of binge-feeding. A) Mean (±sem) total caloric intake (kcal) (chow + HFD) in control rats, HFD-3D and HFD-ED rats is presented.

D

Rats in the HFD-3D group displayed a significant (p<0.05) 24hr caloric overconsumption on HFD

TE

exposure days followed by voluntary restriction (p<0.05) the following day relative to control rats. Rats in

AC CE P

the HFD-ED group also significantly (p<0.05) increased their 24hr caloric intake on HFD exposure days; and this effect eventually dissipated by the end of HFD exposure period ***p<0.000, **p<0.01 and *p<0.05 relative to control rats. B) Both HFD-3D & ED rats displayed significant increases in caloric intake during the 2hr HFD exposure period exposure and C) significant voluntary restriction from chow 22hrs following HFD exposure ***p<0.000 compared to chow controls. Figure 3. Binge feeding reduces acquisition of alcohol intake. Data represent mean (±sem) alcohol (20% v/v) consumption (g/kg). A) When tested following 5 weeks of limited access to HFD, alcohol intake over the first six test sessions was negligible (not significantly higher than zero). A non-significant decrease in alcohol intake was observed in both HFD-3D and -ED rats at both 2hr (p=0.08) and (B) 12hr (p=0.158) relative to chow controls when alcohol intake was assessed following release from bingefeeding behavior (days 7 and 8). Following 2 weeks of binge-feeding, alcohol consumption was significantly attenuated (p<0.001) in both HFD-3D and HFD-ED groups of rats while maintained on the HFD feeding regimen (days 9 and 10). *p<0.05, ***p<0.001 a main effect of the exposure.

ACCEPTED MANUSCRIPT Figure 4. Binge-feeding does not alter sucrose intake. Data represent mean (±sem) sucrose (2.0% w/v) intake in HFD-3D, HFD-ED and chow controls following binge-like feeding. No significant difference in

PT

sucrose intake was detected between groups.

RI

Figure 5. Binge-access to HFD induces anxiety-like behavior. Data represent mean (±sem) time spent in the light side by chow, HFD-3D and HFD-ED groups of rats following binge-like feeding. An anxiolytic

SC

effect was observed in the binging rats as rats in this group spent significantly more time in the light side

NU

compared to chow controls. *p<0.05 main effect of HFD exposure.

Figure 6. Binge-feeding alters brain neurotensin receptor system mRNA expression. Mean (±sem)

MA

fold changes in neurotensin (Nrtn), neurotensin receptor (Nrtn-R) -1 and -2 mRNA expression in the mPFC, Hypothalamus and VTA following binge-like feeding compared to controls are presented. A

D

significant increase in the Nrtn-R1 (A) and a significant decrease in the Nrtn-R2 (B) mRNA expression

TE

was observed in the mPFC of HFD-3D and HFD-ED rats, respectively. No further significant changes

AC CE P

were observed. **p<0.01 and *p<0.05 relative to control rats, kp<0.05 relative to HFD-ED and p<0.01 relative to the HFD-3D, respectively.

NU

SC

RI

PT

ACCEPTED MANUSCRIPT

AC CE P

TE

D

MA

Fig. 1

Fig. 2

AC CE P

TE

D

MA

NU

SC

RI

PT

ACCEPTED MANUSCRIPT

NU

SC

RI

PT

ACCEPTED MANUSCRIPT

AC CE P

TE

D

MA

Fig. 3

Fig. 4

AC CE P

TE

D

MA

NU

SC

RI

PT

ACCEPTED MANUSCRIPT

Fig. 5

AC CE P

TE

D

MA

NU

SC

RI

PT

ACCEPTED MANUSCRIPT

Fig. 6

AC CE P

TE

D

MA

NU

SC

RI

PT

ACCEPTED MANUSCRIPT

ACCEPTED MANUSCRIPT HIGHLIGHTS 

Binge-feeding from a nutritionally complete high-fat diet (HFD) attenuated acquisition of alcohol

PT

intake, induced anxiolytic effects, and altered central genetic expression of the brain neurotensin

These data indicate that binge-feeding behavior induces behavioral and genetic changes that help

TE

D

MA

NU

SC

explain how alcohol intake is influenced by co-morbid eating disorders.

AC CE P



RI

system.