- Email: [email protected]
Bioassay-guided fractionation and identification of wound healing active compound from Pistacia vera L. hull extract.
Journal Pre-proof Bioassay-guided fractionation and identification of wound healing active compound from Pistacia vera L. hull extract. Parisa Sarkhail, Latifeh Navidpour, Mahban Rahimifard, Negar Mohammad Hosseini, Effat Souri PII:
S0378-8741(19)30782-2
DOI:
https://doi.org/10.1016/j.jep.2019.112335
Reference:
JEP 112335
To appear in:
Journal of Ethnopharmacology
Received Date: 12 March 2019 Revised Date:
19 August 2019
Accepted Date: 22 October 2019
Please cite this article as: Sarkhail, P., Navidpour, L., Rahimifard, M., Hosseini, N.M., Souri, E., Bioassay-guided fractionation and identification of wound healing active compound from Pistacia vera L. hull extract., Journal of Ethnopharmacology (2019), doi: https://doi.org/10.1016/j.jep.2019.112335. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier B.V.
Bioassay guided fractiation of Pistacia vera hulls extract (MeOH 80%)
At concentration 200 μg/ml
Scratch-wound healing assay Migration Proliferation
Inflammation
Bioassay-guided fractionation and identification of wound healing active compound from Pistacia vera L. hull extract.
Parisa Sarkhail
a,b
*, Latifeh Navidpour c, Mahban Rahimifard d, Negar Mohammad Hosseini b,
Effat Souri c a
Medicinal Plants Research Center, Faculty of Pharmacy, Tehran University of Medical
Sciences, Tehran, Iran. b
Bioactive Natural Products Group, Pharmaceutical Sciences Research Center, Institute of
Pharmaceutical Sciences (TIPS). Tehran University of Medical Sciences, Tehran, Iran. c
Department of Medicinal Chemistry, Faculty of Pharmacy, Tehran University of Medical
Sciences, Tehran, Iran. d
Toxicology and Diseases Group, Pharmaceutical Sciences Research Center, Institute of
Pharmaceutical Sciences (TIPS), Tehran University of Medical Sciences, Tehran, Iran.
*Correspondence Dr. Parisa Sarkhail, Associated professor of Medicinal Plants Research Center, Faculty of Pharmacy, Tehran University of Medical Sciences, Tehran, Iran. 16th Azar St. Tehran, Iran, PO Box 14155-6451, Tel/Fax +98 2143850522, Email: [email protected] 1
Bioassay-guided fractionation and identification of wound healing active compound from Pistacia vera L. hull extract.
Abstract ETHNOPHARMACOLOGICAL RELEVANCE: Pistachio hull has traditionally been used to treat peptic ulcer, hemorrhoids, oral and cutaneous wounds. AIM OF THE STUDY: On the basis of its traditional uses and previous pharmacological reports, a bioassay guided fractionation procedures on pistachio (Pistacia vera L.) hulls was performed to define the fractions and bioactive compound that are responsible for wound healing activity of hulls. MATERIAL AND METHODS: A bioassay-guided fractionation of the total extract (MeOH 80%) of Pistacia vera L. hulls was carried out to evaluate wound healing activity by scratch assay on NIH/3T3 murine fibroblast cells. A combination of solvent-solvent partitioning, column chromatography, preparative thin layer chromatography and crystallization were used to obtain fractions/sub-fractions and pure compound. The wound healing potential of isolated compound was examined by fibroblasts migration and proliferation using scratch assay and CFSC dilution assay, respectively. In addition, we evaluated the gene expression of some inflammatory markers which are involved in healing process using Real Time PCR. Chemical structure of active compound was elucidated by spectrometric methods.
2
RESULTS: Due to the higher wound healing activity of CHCl3 fraction from P. vera hulls, it was fractionated by successive chromatographic techniques to yield the active compound. 3epimasticadienolic acid was isolated and crystallized as a white powder. This active compound (200 µg/ml) significantly increased the fibroblast proliferation and migration, resulting in reduction of the scratch area about 45%. It showed a strong inhibitory effect on gene expression of IL-6 and TNF-α, and a stimulation effect on NF-κB gene expression at the same dose. CONCLUSION: The present study supported the traditional uses of P. vera hulls for woundhealing and 3-epimasticadienolic acid showed significantly potent on wound repair.
Abbreviations CC, column chromatography; CFSC, carboxyfluorescein diacetate succinimidyl ester; DMEM; Dulbecco’s Modified Eagle’s Medium, EC50, half maximal effective concentration; EIMS, electron ionization mass spectrometry; FBS, Fetal Bovine Serum; GAPDH, glyceraldehyde 3phosphate
dehydrogenase;
IL-6,
interleukine-6;
MTT,
3-4,5
dimethylthiazol-2-yl-2,5-
diphenyltetrazolium bromide; NF-κB, nuclear factor kappa light chain enhancer of activated B cells; NMR, nuclear magnetic resonance; PTLC, preparative thin layer chromatography; RTPCR, Real-time reverse transcription polymerase chain reaction; TNf-α, tumor necrosis factor alpha. Keywords: Pistachio hull; bioassay-guided fractionation; fibroblast cells; scratch-wound healing assay; proliferation; migration; inflammation.
3
1. Introduction In Iran, the Pistacia genus from the Anacardiaceae family includes three species: P. vera, P. atlantica and P. khinjuk species. Pistacia vera L. is a dioecious tree or shrub that is economically the most important species in this genus. It probably originated in Central Asia and the Middle East and also is dispersed all over the Mediterranean basin. From the sixth millennium BC, it has been found in both Afghanistan and southeastern Iran (Whitehouse 1957; Salas-Salvado et al., 2011; Bozorgi et al., 2013). The tree produces edible seeds that are considerable commercial importance especially in Iran. In folk medicine, seed pistachio has been proven effective for treatment of blood clotting, poor circulation, dyspepsia, asthma, jaundice, diarrhea and renal stones. Pistachio hulls and gum are traditionally used in remedy of toothache and other periodontal ailments, oral and cutaneous wounds, stomach problems and hemorrhoids as an anti-inflammatory, antibacterial, antiviral and wound healing agent (Alma et al., 2004; Orhan et al., 2006; Tsokou et al., 2007; Bozorgi et al., 2013). In addition, people use smoke of pistachio mastic in rapid healing of deep wound, and chew pistachio hull for gum stiffness and elimination bad breath. The edible nut and hull are also a rich source of anthocyanidins, proanthocyanidins, isoflavones and phytosterols (Tsokou et al., 2007; Mahjoub et al., 2018). Previous pharmacological studies confirmed that pistachio resin is able to improve wound healing through increasing vascular endothelial growth factor (VEGF) and hydroxyproline, reducing malondialdehyde levels and antioxidant activity (Shahouzehi et al., 2018; Shahouzehi et al., 2019). The ointment from P. atlantica hull improved wound healing process by promoting angiogenesis, fibroblast proliferation, increasing mast cells distribution and infiltration (Farahpour et al., 2015; Minaiyan et al., 2015; Shahouzehi et al., 2018). Recently, anti4
melanogenic activity of P. vera hull extract (Sarkhail et al. 2017) and P. atlantica unripe fruits have been reported (Eghbali-Feriz et al., 2018). In addition, differentl applications have been known for pistachio hulls such as a feed additive (Behgar et al., 2009), raw source for biofuel and biogas generation (Demiral et al., 2008; Çelik and Demirer, 2015) and absorbent for contaminated water (Moussavi and Khosravi, 2010). In this way, nowadays, the value of pistachio hull is rising as a source of novel biologically active agents that can used in new formulation drugs (Orhan et al., 2006; Rajaei et al., 2010; Tomaino et al., 2010; Varzakas et al., 2016). Wound healing is a dynamic process and normal biological response to the injury which occurs through different overlapping phases including inflammation, proliferation and maturation. There are many inflammatory markers such as, pro-inflammatory cytokines (tumor necrosis factor alpha, interleukins, nuclear factor kappa B), growth factors, extracellular matrix (ECM), and different type cells that regulate wound healing process. Key to this healing process is proliferation, migration and other functions in fibroblasts and keratinocytes. Prolonged inflammation can interfere with the whole healing process, as the inflammatory response inhibits skin cell proliferation and differentiation (Gio and Dipietro., 2010; Tsala et al., 2013; Muthusamy and Piva , 2010; warner and Grosse, 2003). To date, many herbal medicines have been reported to show wound healing activity via several mechanisms (Nagori and Solanki, 2011). On the basis of pistachio hull’s traditional uses and previous pharmacological reports, for the first time, we evaluated the wound healing activity of Pestacia vera L. hulls through bioassay guided fractionation procedures to define active fractions and compound which are responsible for this effect on murine embryonic fibroblast cell line. In the present study, we used the scratch-wound assay as a simple and valid assay for the 5
evaluation of the wound healing activity of fibroblast cells in the mechanical wound (SevimliGür et al., 2011). In addition, we investigated the effect of the active isolated compound on the cellular proliferation and gene expression of three main inflammatory markers, including IL-6, TNf-α and NF-κB1 for scientific support.
2. Materials and methods 2.1. Materials NIH/3T3 fibroblast cells were obtained from the cell bank of Pasteur Institute of Iran (NCBI). Dulbecco's modified eagle's medium (DMEM), fetal bovine serum (FBS), 3-4,5 dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT), carboxyfluorescein diacetate succinimidyl ester (CFSE), allantoein, dimethyl sulfoxide (DMSO) and DAPI (4′,6-Diamidino-2phenylindole dihydrochloride) were purchased from Sigma-Aldrich (Munich, Germany). Silica gel 60 G (70–230 mesh) were used as the stationary phase in CC and precoated silica gel plates (Merck, Kieselgel 60 F-254, 0.5 mm) were used for PTLC. Thin layer chromatography (TLC) was performed on silica gel F254 (Merck) precoated aluminum sheets. For gene expression investigation HiGene™ Total RNA Prep kit (Cat. No. RP101-100), (Cat. No. DQ383-40h), BioFact™ 5X RT Pre-Mix (Cat. No. BR441-096) and BioFACT™ 2X Real-Time PCR Master Mix (For SYBR Green I) were purchased from BioFact (Seoul, Korea). All other solvents and chemicals used in experiments were obtained from Merck (Germany).
2.2. Phytochemical study 6
2.2.1. Plant material and preparation of liquid–liquid partition Pistacia vera L. fruits (Anacardiaceae) were purchased from the local market in Tehran, Iran and validated by the corresponding author. A voucher specimen (No. 1391-3) was deposited at Pharmaceutical Sciences Research Center (PSRC) laboratory, Tehran University of Medicinal Sciences. Pink-purple hulls were separated from the fruits by hand and then dried at 40 °C. 20 grams crispy hulls were crushed with an electric blender and extracted with 80% aqueous MeOH using percolation apparatus three times at room temperature. After filtration, evaporation was performed under vacuum and concentrated with freeze dryer. The dried extract was stored at 4 °C for experimental studies. The dry total extract from hulls was successively partitioned to the chloroform, ethyl acetate and n-butanol fractions. Subsequently, these fractions were subjected to be tested for their viability and wound healing activity. 2.2.2. Bioassay-guided fractionation and compounds isolation Following bioassay-guided procedures on the total extract of P. vera hull, the chloroform fraction, as an active part on the scratch-wound healing assay, was fractionated by chromatographic techniques. One gram of CHCl3 fraction was fractionated using a glass column packed with silica gel and elution was performed with a stepwise gradient of hexane–CHCl3 (1:0 to 0:1 v/v) and then of CHCl3–EtOAc (1:0 to 1:4 v/v) to obtain 62 primary fractions. The collected fractions were grouped into five fractions (Fr1–Fr5) after monitoring by their thin layer chromatographic (TLC on silica gel 60 F 254) using hexane: ethyl acetate (3:1) as mobile phase. The spots were visualized under UV light (254 and 366 nm) and by spraying with vanillin/H2SO4 solution 1% (w/v) reagent and heating at 120 °C until maximum color formation. All fractions Fr1–Fr5 were screened for viability by the MTT assay and wound scratching method (see 7
below). The bioactive fraction Fr4 was subjected to further preparative chromatography on glass plates with silica gel using hexane: ethyl acetate (7:3 v/v) as the mobile phase. Three subfractions namely Fr4.I, Fr4.II and Fr4.III were obtained. From the sub-fraction Fr4.III (108 mg), one major compound was isolated and purified by crystallization from MeOH and identified by mass spectrometry, 1H and 13C-NMR, DEPT-135. This compound showed purple color spot after spraying with vanillin-H2SO4, in TLC, with Rf of 0.33 (hexane: EtOAc, 7:3 v/v). The fractionation procedure of pistachio hull is shown in Fig. 1. 2.2.3. Structure elucidation of the active compound The NMR spectra were obtained on a Varian 500 spectrometer using tetramethylsilane as internal standard. Chemical shifts are given in δ-scale. Melting point was determined on a Reichert-Jung hot-stage microscope and EI-MS spectra were recorded on a mass spectrometer (Agilent Technologies) with electron ionization at 70 eV and quadruple analyzer. 2.2.3.1. 3α-Hydroxytirucalla-7, 24Z-dien-26-oic acid (3-epimasticadienolic acid or schinol). This compound was obtained as white amorphous powders, mp l48-150 °C with molecular weight of 456 (C30H48O3): EI-MS m/z 456 [M]+, 441 [M+- CH3], 423 [M+-CH3-H2O], 187, 175, 147,135, 119, 107, 95, 81, 69, 55. 1H-NMR (CDCl3), δ/ppm: 6.09 (1H, brt, J = 7.1 Hz, H-24), 5.25 (1H, brs, H-7), 3.46 (1H, bt, J = 2.9 Hz, H-3), 2.56 (1H, m, H-9), 2.45 (2H, m, H23), 2.31 (2H, m, H-2), 2.20 (3H, s, H-27), 1.4-2.0 (17H, m, H-1, H-5, H-6, H-11, H-12, H-15, H-16, H-17, H-20, H-22), 1.26 (3H, s, H-30), 0.97 (3H, s, H-28), 0.94 (3H ,s, H-29), 0.96 (3H, d, J = 6.35 Hz, H-21), 0.82 (3H, s, H-18), 0.77 (3H, s, H-19).Its 1H-NMR spectrum indicated five tertiary methyl group at δ 1.9 (s), 1.26 (s), 0.97 (s), 0.94 (s), 0.82 (s), and 0.77 (s), a secondary methyl group at δ 0.96 (d, J = 6.35 Hz). One oxymethine proton signal at δ 3.46 (bt, J = 2.9 Hz) 8
is characteristic of the proton geminal to the 3α-axial hydroxyl in tirucallane-type triterpenes. The 1H NMR also detected two olefinic signals at δ 6.09 (t, 1H, J = 7.1 Hz) and 5.25 (brs, 1H). 13
C-NMR (CDCl3), δ/ppm: 172.0 (C-26), 146.9 (CH-24), 146.13 (Cq-8), 125.6 (Cq-25), 117.9
(CH-7), 76.1 (CH-3), 52.8 (CH-17), 51.2 (Cq-14), 48.7 (CH-9), 44.8 (CH-5), 43.5 (Cq-13), 36.1 (CH-20), 35.9 (Cq-4), 35.7 (CH2-22), 34.7 (CH2-10), 34.0 (CH2-15), 33.8 (C-12), 31.3 (CH2-1), 28.2 (CH2-16), 27.8 (CH3-28), 27.3 (CH3-30), 26.9 (CH2-2), 25.4 (CH2-23), 23.9 (CH2-6), 21.9 (CH3-29), 21.8 (CH3-18), 20.5 (CH3-27), 18.3 (CH3-21), 18.0 (CH2-11), 13.0 (CH3-19). The I3CNMR spectrum of this compound showed 30 carbon atoms. Its 13C-NMR spectrum displayed one carbonyl signal at δ 172.0, four signals at δ 146.9 (CH-24), 146.13 (Cq-8), 125.6 (Cq-25), 117.9 (CH-7) represented two double bond. The DEPT 135 experiment confirmed the existence of one oxygenated signal at δ 76.1, and six methyls, nine methylenes and five methanes in the structure of compound. On the basis of the above evidence and by comparison of the spectroscopic data with the previous reports (Konno et al., 1981; Mulholland and Nair, 1994; Camacho et al., 2000; Morais et al., 2014).the structure of this compound was determined to be 3α-Hydroxytirucalla7,24Z-dien-26-oic acid (Fig. 2). 2.3. Biological activity evaluation 2.3.1. Cell culture and Cell viability assay
To investigate safety of samples, the NIH-3T3 murine embryonic fibroblast cell line viability was assessed using MTT assay. The fibroblast cells were cultured in complete DMEM supplemented with 10% FBS, 100 IU/ml penicillin, and 100 µg/ml streptomycin at 37°C under 5% CO2. Cells were cultured at 104 cells/well into a 96-well plate. Then they treated with varying concentrations of the fractions/sub-fractions (0.02 - 200 µg/ml) that prepared in DMSO 9
(0.5% v/v). After 48 hours of incubation, the medium was washed twice with phosphate buffer and 50 µL of MTT (0.5 mg/ml) was added. Then cells were incubated for another 3 hours at 37°C. In the next step, purple crystal of formazan was dissolved in dimethyl sulfoxide (DMSO) for 30 min and the absorption was read using ELISA reader (Synergy, BioTek Instruments Inc., Germany) at 570 nm. The background absorbance at 690 nm was subtracted from 570 nm. Data is represented as percent of control (Mosmann, 1883). Finally, EC50 of each fraction on the NIH fibroblast cells was calculated and reported. 2.3.2. In vitro scratch-wound healing assay The ability of migration of NIH fibroblast cells into the wounded area was assessed using scratch assay method. Cells were seeded at 2×105 cells/well in 24-well cell culture dishes along with DMEM. For monolayer formation with approximate 75% confluency, 24-hour incubation at 37 °C was done. Then, with a sterile 100µL pipette tip, a linear scratch was created. Then, cells were washed using PBS in order to remove residues and then exposed to EC50 of fractions/subfractions and different concentrations of active compound (0.2-200 µg/ml) for 48 hours (Bayrami et al., 2018). Allantoin was used as a positive control at 50 µg/ml concentration (Muniandy et al., 2018). In the following, the fixation of cells with 4% paraformaldehyde for 15 min and staining by DAPI for 1 min were conducted. Finally, images were taken using fluorescence microscope (Olympus BX51, Japan) and the changes in wound area were analyzed using “imageJ” software. 2.3.3. Cell proliferation assay Cell proliferation of isolated compound determined by carboxyfluorescein diacetate succinimidyl ester (CFSE) cytoplasmic proliferation dye assay flow cytometry experiment based on a previously described protocol (Badr et al., 2012). The cells were harvested and washed two 10
times in PBS and stained with 5 µM CFSE for 8 min at room temperature and then CFSE inactivate by FBS. Residual CFSE was removed by washing twice with PBS, and CFSE labeled cells were seeded in 6-well plates and grown in cell culture medium. Mitomicine C used as a negative control (5 µg/ml, for 2 h), allantoin as positive control (50 µg/ml) and 3α-HMA (200 µg/ml). The CFSE florescence intensity was measured by flow cytometry using FACS analysis after 5 days. Each peak represents a successive generation of cell division. 2.3.4. Real-time PCR Analysis The mRNA expressions of IL-6, TNF-α and NF-κB1 were analyzed by real-time PCR. After washing the cells in sterilized PBS and according to the manufacturer's suggested protocol, total RNA was extracted from the cells using the TRIZol@ reagent. The RNA concentration was measured via Thermo Scientific NanoDrop 2000c UV–Vis spectrophotometer (Thermo Scientific, USA). The ratio between the readings at 260 nm and 280 nm (OD260/OD280) was used to provide an estimate of the purity of the nucleic acid, and the ratio ranged between 1.7 and 2.0. DNase-I and RNase-free kits were used to remove genomic DNA, while cDNA was a reverse transcript by iScript cDNA synthesis kit. As reference gene, primer pairs were selected with GAPDH. Quantitative RT-PCR evaluation was done using Light Cycler 96 system (Roche) by SYBR green master mix. Comparative cycle threshold method was used to evaluate the relative gene expression (Wu et al., 2013). Table 1 indicates abbreviations, accession number, and sequence of the primers.
2.4. Statistics
11
Data obtained within the groups were expressed as mean ± SEM for triplicate independent experiments. The statistical significance of the data was analyzed with a one-way ANOVA followed by Tukey’s HSD using SPSS program (Version 11.5, SPSS Inc., Chicago, IL) and the significance level was set at P ≤ 0.05. Flow cytometry data were analyzed by FlowJo software.
3. Results and Discussion In traditional medicines worldwide, a large number of plants and plant extracts have been used for treatment of wounds. A number of medicinal plants have been reported to repair wounds by promoting blood fighting against infection and accelerating wound healing. In the present study, we evaluated the wound healing property of Pistacia vera hull on the basis of traditional Iranian medicine and the latest pharmacological reports about pistachio species hull (Tsokou et al., 2007; Bozorgi et al., 2013). The bioassay-guided fractionation of P. vera hull, was carried out using the scratchwound healing assay on NIH-3T3 fibroblast cells. Although the scratch-wound healing assay cannot substitute in vivo studies as a final proof for efficacy in wound healing, it is useful for gaining the first insights into the potential of the extract and compound to wound healing. Generally, this assay is applied to consider the second phase of wound healing process which is characterized by migration of fibroblast or keratinocytes. The total extract of P. vera hull was fractionated (as shown in Fig. 1) and the effect of fractions/sub-fractions on viability of NIH-3T3 fibroblast cells, at a different concentrations, was evaluated by MTT assay to select the best samples concentration (EC50) as seen in Fig. 2a. The CHCl3, EtOAc and n-BuOH fractions at a concentration range of 0.02–20 µg/ml showed no toxic effect on NIH fibroblast cells. The 12
effective concentrations (EC50) values for CHCl3, EtOAc and n-BuOH fractions were determined as 0.02, 0.04 and 0.2 µg/ml, respectively. Consequently, the EC50 value of each fraction was chosen for in vitro wound scratching assay on NIH/3T3 fibroblast cells. Fibroblast migration rates were considered at a time period of 48 h after in vitro wound induction in the groups. Among the fractions, as shown in Figure 2b, treated cells with CHCl3 fraction showed the most cell migration rate. Wound area of that group significantly (P<0.01) decreased down to 50.63% of control group (Fig. 2c). The yield of CHCl3, EtOAc and n-BuOH fractions from P. vera hull total extract and their effects on fibroblast cell viability and migration was listed in Table 2. Due to the higher wound healing activity of CHCl3 fraction, following investigations were carried out on its sub-fractions. The yield of five chloroform sub-fractions (Fr1-Fr5) was presented in Table 3. In Fig 3ac the viability and wound healing activity of Fr1-Fr5 on the cells were shown. According to the results listed in Table 3, Fr2 with an EC50 value of 169 µg/ml and Fr4 at EC50 value of 0.02 µg/ml were able to decrease significantly (P<0.001) the wound area of fibroblast cells scratch within 48 hours down to 38.4% and 32.8% of control, respectively. The TLC examination of CHCl3 sub-fractions displayed the presence of terpenoids in Fr2 and Fr4 after spraying vanillinsulfuric acid reagent and heating (120 °C) (Fig.4). Due to the higher yield of Fr4 in comparison with Fr2, it was selected for further bioassays. The active Fr4 was subjected to fractionation by PTLC technique and were grouped into three sub-fractions (Fr4.I-Fr4.III) based on their chemical fingerprinting on TLC examination. In the MTT assay, the EC50 values of Fr4.I, Fr4.II and Fr4.III were estimated at 12, 16 and 0.01 µg/ml, respectively (Fig. 5a). As Fig. 5b and c is shown the Fr4.III has the best effect on migration of the cells and can reduce wound area down to 23.36%. Delayed wound healing processes were observed especially in the control group 13
compared to the other groups. From fraction Fr4.III one major compound was purified by crystallization from MeOH and identified by mass spectrometry, 1H and (Supplementary
Fig.
1a
to
d)
as
13
C-NMR, DEPT-135
3α-hydroxytirucalla-7,24Z-dien-26-oic
acid
(3-
epimasticadienolic acid, schinol). The chemical structure of compound was shown in Fig. 6. 3α-hydroxymasticadienolic acid (3α-HMA) as a pentacyclic triterpene compound has been found in Pistacia spp. resins and galls (Paraschos et al., 2007; Bozorgi et al., 2013) but it is the first time that isolated from P. vera hull. The results showed that 3α-HMA at the concentrations between 20 and 200 µg/ml significantly (P < 0.05 to P< 0.001) increased the rate of wound closure compared with the control group during 48h in a dose-dependent manner (Fig, 7). This finding confirmed that the treatment of 3α-HMA improved the migration and wound closure of NIH/3T3 fibroblast cells better than allantoein. Regarding the significant reduction with highest concentration of 3α-HMA (200 µg/ml) on the scratch wound area (about 45%, P< 0.001), it was used for further bioassays. The ability of 3α-HMA on the proliferation fibroblast cells was investigated through the CFSE dilution flow cytometry assay which is an effective method to monitor cell division by measuring the corresponding decrease in cell fluorescence (Lyons et al., 2000). We found that after being treated with 200 µg/ml of 3α-HMA, the percentage of proliferating cells was markedly increased from 60% in untreated cells to 75.4% in treatedcompound cells and was similar to the results obtained in treated cells with allantoin as a positive control (50 µg/ml) (Fig. 8) Wound healing is characterized by the different process of reepithelization that is associated with proliferation, growth, and migration. Fibroblasts along with several mediators at the cellular and molecular are the most important components of granulation tissue that involved 14
in wound closure mechanism (Wagner and Wehrmann, 2007; Wang et al., 2012). The secretions of pro-inflammatory cytokines by the cells, particularly IL-6 and TNf-α and also NF-κB pathway play key roles in the regulation of inflammation, fibroblast proliferation and migration. In the inflammatory phase, NF-κB is a key transcription factor of M1 macrophages and has an important role in regulating the expressions of inflammatory genes such as IL-6 and TNf-α. The high levels of IL-6 and TNF-α can interfere with one or more phases in wound healing process and cause prolonged inflammation that leading to further tissue injury. In the proliferation phase of wound healing, macrophage undergo a differentiation into activate anti-inflammatory phenotypes (M2 macrophage) that stimulate fibroblast proliferation and migration as well as proliferation of extracellular matrix (ECM) which are responsible in wound closure (Sorg et al., 2017; Liu et al., 2017). NF-κB is composed of five structurally related members, including NFκB1 (p50), NF-κB2 (p52), RelA (p65), RelB, c-Rel, which mediates transcription of various inflammatory genes. NF-κB1, one of the most common NF-κB heterodimers, is not only a key regulator of inflammation and innate immunity, but also induces the expression of anti-apoptotic genes to accelerate cell growth and proliferation cells. In this study, we evaluated the expression of IL-6, TNF-α and NF-κB1 genes using Real Time PCR. We confirmed that the expression level of IL-6 and TNF-α significantly (P<0.05 and P<0.001, respectively) decreased in cells treated with 3α-HMA at concentration 200 µg/ml, while this compound at the same concentration significantly (P<0.001) increased the expression level of NF-κB1 in the cells more than untreated cell (Fig. 9). Based on this data, we can suggested the wound healing process in fibroblast cells using 3α-HMA effectively enhanced through the anti-inflammatory effect of NFκB signaling pathways by a reduction of associated mediators cytokines such as IL-6 and TNF-α levels and probably other inflammatory factors was not tested in these study (Tan et al., 2019). 15
Several evidences showed that many triterpenoids and polyphenolics from Pistacia spp. play an important role in reducing inflammation. Pistacia chinensis methanolic extract showed anti-inflammatory and antioxidant activity through influencing redox-sensitive signal transduction pathways, therefore modulating NF-κB activity and finally inhibited mRNA expressions of inducible nitric oxide synthase (iNOS), cyclooxygenase 2 (COX-2), tumor necrosis factor (TNF)-α and interleukin (IL)-6 (Yayeh et al., 2012; Grace et al., 2016). Some previous studies have revealed that the essential oils, galls and resins from Pistacia spp. can accelerate the wound healing process that generally is due to promoting angiogenesis, fibroblast proliferation, increasing mast cells distribution, infiltration and RNA stability, antimicrobial and anti-inflammatory activity (Bozorgi et al., 2013; Farahpour et al., 2015; Minaiyan et al., 2015; Shahouzehi et al., 2018). Resin and gall of these species are rich of tetracyclic triterpenes such as masticadienonic acid, masticadienolic acid and 3α-hydroxymasticadienonic acid that seem to be responsible for its anti-inflammatory activity (Giner-Larza et al., 2002; Arrieta et al., 2003; Alma et al., 2004) and gastro-protective effects (Rosas-Acevedo et al., 2011) through inhibition of phospholipase A2, leukotriene B4 generation and NO production (Jain et al., 1995; Arrieta et al., 2003; Oviedo-Chávez et al., 2004). Pentacyclic triterpenoids have been found to have many functions, for example, masticadienonic acid, masticadienolic acid and morolic acid showed efficiency on the mouse ear inflammation (Giner-Larza et al., 2002). In this study, we showed that the wound healing activity of P. vera hull can be due to the presence of triterpenoids such as 3-epimasticadienolic acid in which play a significant role in fibroblast cell proliferation, migration and modulation of inflammatory markers such as IL-6, TNF-α and NF-κB1.
16
4. Conclusion The present study supported the traditional use of Pistacia vera hulls for wound-healing. Throughout bioassay-guided fractionation procedures, we proved that the non-polar extract was rich of bioactive components with wound healing effect and 3-epimasticadienolic acid was identified as, at least, one of the active compounds. In addition, this study is the first to provide scientific evidence that the potential wound healing effect of 3-epimasticadienolic acid due to a combination of fibroblast stimulation and inhibition of inflammatory markers production.
Acknowledgements The authors warmly thank Dr. Zahra Heydari (PhD student of Organic Chemistry at Tehran University) for NMR experiments. This study is supported by a grant from The Institute of Pharmaceutical Sciences (TIPS) (No. 95-04-45-33338).
Conflict of interest All of the authors claim that there is no conflict of interests among the authors.
References Alma, M.H., Nitz, S., Kollmannsberger, H., Digrak, M., Efe, F.T., Yilmaz, N., 2044. Chemical composition and antimicrobial activity of the essential oils from the gum of Turkish pistachio (Pistacia vera L.). J. Agric. Food. Chem. 52, 3911-3914.
17
Arrieta, J., Benitez, J., Flores, E., Carlos. C., 2003. Navarrete, Andres - Purification of Gastroprotective Triterpenoids from the Stem Bark of Amphipterygium adstringens; Role of prostaglandins, sulfhydryls, nitric oxide and capsaicin-sensitive neurons. Planta. Med. 69, 905-909. Badr, G., Al-Sadoon, M.K., Abdel-Maksoud, M.A., Rabah, D.M., El-Toni, A.M., 2012. Cellular and Molecular Mechanisms Underlie the Anti-Tumor Activities Exerted by Walterinnesia aegyptia Venom Combined with Silica Nanoparticles against Multiple Myeloma Cancer Cell Types. PLoS One. 7, e51661. Bayrami, Z., Hajiaghaee, R., Khalighi-Sigaroodi, F., Rahimi, R., Farzaei, M.H., Hodjat, M., Baeeri, M., Rahimifard, M., Navaei-Nigjeh, M., Abdollahi, M., 2018. Bio-guided fractionation and isolation of active component from Tragopogon graminifolius based on its wound healing property. J. Ethnopharmacol. 226, 48-55. Behgar, M., Valizadeh, R., Mirzaee, M., Naserian, A.A., Nasiri, M.R., 2009. Correlation between the physical and chemical properties of some forages and non-forage fiber. J. Anim. Vet. Advances. 8, 2280-2285. Benjamin J. C. Quah and Christopher R. Parish. 2010. The Use of Carboxyfluorescein Diacetate Succinimidyl Ester (CFSE) to Monitor Lymphocyte Proliferation J Vis Exp. 44, 2259doi: 10.3791/2259. Bozorgi, M., Memariani, Z., Mobli, M., Salehi Surmaghi, M.H., Shams-Ardekani, M.R., Rahimi, R., 2013. Five Pistacia species (P. vera, P. atlantica, P. terebinthus, P. khinjuk, and P.
18
lentiscus): a review of their traditional uses, phytochemistry, and pharmacology. Sci.World. J. 219815-24453812. Camacho, M.R., Mata, R., Castaneda, P., Kirby, G.C., Warhurst, D.C., Croft, S.L., Phillipson, J.D., 2000. Bioactive compounds from Celaenodendron mexicanum. Planta Med. 66, 463-468. Çelik, I., Demirer, G.N., 2015. Biogas production from pistachio (Pistacia vera L.) processing waste. Biocatal. Agric. Biotechnol. 4, 767-772. Daneshrad, A., Aynehchi, Y., 1980. Chemical studies of the oil from Pistacia nuts growing wild in iran. J. Am. Oil. Chem. Soc. 57, 248–249. Delazar, A., Reid, R.G., Sarker, S.D., 2004. GC-MS analysis of essential oil of the oleoresin from Pistacia atlantica var mutica. Chem. Nat. Compd. 40, 24-27. Demiral, I., Atilgan, N.G., Şensöz, S., 2008. Production of biofuel from soft shell of pistachio (Pistacia vera L.). Chem. Eng. Commun. 196, 104-115. Eghbali-Feriz, S., Taleghani, A., Al-Najjar, H., Emami, S.A., Rahimi, H., Asili, J., Hasanzadeh. S., Tayarani-Najaran, Z., 2018. Anti-melanogenesis and anti-tyrosinase properties of Pistacia atlantica subsp. mutica extracts on B16F10 murine melanoma cells. Res Pharm Sci. 13, 533545. Farahpour, M.R., Mirzakhani, N., Doostmohammadi, J., Ebrahimzadeh, M., 2015, Hydroethanolic Pistacia atlantica hulls extract improved wound healing process; evidence for mast cells infiltration, angiogenesis and RNA stability. Int. J. Surg. 17, 88-98.
19
Giner-Larza, E.M., Máñez, S., Giner, R.M., Recio, M.C., Prieto, J.M., Cerdá-Nicolás, M., Ríos, J.L., 2002. Anti-inflammatory triterpenes from Pistacia terebinthusgalls, Planta. Medica. 68, 311315. Grace, M.H., Esposito, D., Timmers, M.A., Xiong, J., Yousef, G., Komarnytsky, S., Lila, M.A., 2016. In vitro lipolytic, antioxidant and anti-inflammatory activities of roasted pistachio kernel and skin constituents. Food Funct. 7, 4285-4298. Guo, S., Dipietro, L.A., 2010. Factors affecting wound healing. J Dent Res. 89, 219-29. Jain, M.K., Yu, B.Z., Rogers, J.M., Smith, A.E., Boger, E.T., 1995. Ostrander RL, Rheingold AL. Specific competitive inhibitor of secreted phospholipase A2 from berries of Schinus terebinthifolius. Phytochemistry. 39, 537-547. Konno, C., Saito, T., Oshima, Y., Hikino, H., Kabuto, C., 1981. Structure of methyl adenophorate and triphyllol, triterpenoids of Adenophora triphylla var. japonica roots. Planta Med. 42, 268-274. Liu, T., Zhang, L., Joo, D., Sun, S.C., 2017. NF-κB signaling in inflammation. Signal Transduct Target Ther. 2. pii: 17023. doi: 10.1038/sigtrans. Lyons, A.B., 2000. Analysing cell division in vivo and in vitro using flow cytometric measurement of CFSE dye dilution. J Immunol Methods. 243, 147-154. Mahjoub, F., Akhavan Rezayat, K., Yousefi, M., Mohebbi, M., Salari, R., 2018. Pistacia atlantica Desf. A review of its traditional uses, phytochemicals and pharmacology. J. Med. Life. 11, 180-186.
20
Minaiyan, M., Karimi, F., Ghannadi, A., 2015. Anti-inflammatory effect of Pistacia atlantica subsp kurdica volatile oil and gum on acetic acid-induced acute colitis in rat. R. J. P. 2, 1-12. Moeini-Nodeh, S., Rahimifard, M., Baeeri, M., Abdollahi, M., 2017, Functional Improvement in Rats' Pancreatic Islets Using Magnesium Oxide Nanoparticles Through antiapoptotic and antioxidant pathways. Biol. Trace. Elem. Res. 175, 146-155. Morais, T.R., da Costa-Silva, T.A., Tempone, A.G., Borborema, S.E., Scotti, M.T., de Sousa, R.M., Araujo, A.C., de Oliveira, A., de Morais, S.A., Sartorelli, P., Lago, J.H., 2014. Antiparasitic activity of natural and semi-synthetic tirucallane triterpenoids from Schinus terebinthifolius (Anacardiaceae): structure/activity relationships. Molecules. 19, 5761-5776. Mosmann, T., 1983. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J. Immunol. Methods. 65, 55-63. Moussavi, G., Khosravi, R., 2010. Removal of cyanide from wastewater by adsorption onto pistachio hull wastes: parametric experiments, kinetics and equilibrium analysis. J. Hazard. Mater. 183, 724-730. Mulholland, D.A., Nair, J.J., 1994. Triterpenoids from Dysoxylum pettigrewianum. Phytochemistry. 37, 1409-1411. Muniandy, K., Gothai, S., Tan, W.S., Kumar, S.S., Mohd Esa, N., Chandramohan, G., Al-Numair, K.S., Arulselvan, P., 2018. In vitro wound healing potential of stem extract of Alternanthera sessilis. Evid Based Complement Alternat Med. 2018:3142073. doi: 10.1155/2018/3142073.
21
Muthusamy., V, Piva., T., 2010. The UV response of the skin: a review of the MAPK, NF-κB and TNF-α signal transduction pathways. Arch Dermatol Res 302: 5-17. Nagori, B.P., Solanki, R., 2011, Role of medicinal plants in wound healing. Res. J. Med. Plant. 5, 392-405. Orhan, I., Küpeli, E., Aslan, M., Kartal, M., Yesilada, E., 2006. Bioassay-guided evaluation of antiinflammatory and antinociceptive activities of pistachio, Pistacia vera L. J Ethnopharmacol. 105, 235-240. Oviedo-Chávez, I., Ramírez-Apan, T., Soto-Hernández, M., Martínez-Vázquez, M., 2004. Principles of the bark of Amphipterygium adstringens (Julianaceae) with anti-inflammatory activity. Phytomedicine.; 11, 436-45. Paraschos, S., Magiatis, P., Mitakou, S., Petraki, K., Kalliaropoulos, A., Maragkoudakis, P., Mentis, A., Sgouras, D., Skaltsounis, A.L., 2007. In vitro and in vivo activities of Chios mastic gum extracts and constituents against Helicobacter pylori. Antimicrob Agents Chemother. 51, 551-559. Rajaei, A., Barzegar, M., Mobarez, A.M., Sahari, M.A., Esfahani, Z.H., 2010. Antioxidant, antimicrobial and antimutagenicity activities of pistachio (Pistachia vera) green hull extract. Food. Chem. Toxicol. 48, 107-12. Rosas-Acevedo, H., Terrazas, T., González-Trujano, M.E., Guzmán, Y., Soto-Hernández, M., 2011. Anti-ulcer activity of Cyrtocarpa procera analogous to that of Amphipterygium adstringens, both assayed on the experimental gastric injury in rats. J Ethnopharmacol.134, 67-73.
22
Sarkhail, P., Salimi, M., Sarkheil, P. and Mostafapour Kandelous, H. 2017. Anti-melanogenic activity and cytotoxicity of Pistacia vera hull on human melanoma SKMEL-3 cells. Acta Med. Iran. 55, 422-428. Salas-Salvado´, J., Casas-Agustench, P., Salas-Huetos, A., 2011. Cultural and historical aspects of Mediterranean nuts with emphasis on their attributed healthy and nutritional properties. Nutr. Metab. Cardiovasc. Dis. 1, S1-S6. Sevimli-Gür, C., Onbaşılar, I., Atilla, P., Genç, R., Cakar, N., Deliloğlu-Gürhan, I., Bedir, E., 2011. In vitro growth stimulatory and in vivo wound healing studies on cycloartane-type saponins of Astragalus. J Ethnopharmacol. 134, 844-850. Shahouzehi, B., Sepehri, G., Sadeghiyan, S., Masoomi-Ardakani, Y., 2018. Effect of Pistacia atlantica resin oil on anti-oxidant, hydroxyprolin and VEGF changes in experimentallyinduced skin burn in rat. World. J. Plast. Surg. 7, 357-363. Shahouzehi, B., Sepehri, G., Sadeghiyan, S., Masoumi-Ardakani, y., 2019. Ameliorative effects of Pistacia atlantica resin oil on experimentally-induced skin burn in rat. R. J. P. 6, 29-34. Sorg, H., Tilkorn, D.J., Hager. S., Hauser. J., Mirastschijski, U., 2017. Skin Wound Healing: An Update on the Current Knowledge and Concepts. Eur Surg Res. 58, 81-94. Tan, W.S., Arulselvan, P., Ng, S.F., Mat Taib, C. N., Sarian, M.N., Fakurazi, S., 2019. Improvement of diabetic wound healing by topical application of Vicenin-2 hydrocolloid film on Sprague Dawley rats. BMC Complement Altern Med. 19(1):20. doi: 10.1186/s12906-018-2427-y.
23
Tsala, D.E., Amadou, D., Habtemariam, S., 2013. Natural wound healing and bioactive natural products. Phytopharmaco. 4, 532-560. Tomaino, A., Martorana, M., Arcoraci, T., Monteleone, D., Giovinazzo, C., Saija, A., 2010. Antioxidant activity and phenolic profile of pistachio (Pistacia vera L., variety Bronte) seeds and skins. Biochimie. 92, 1115-22. Tsokou, A., Georgopoulou, K., Melliou, E., Magiatis, P., Tsitsa, E., 2007. Composition and enantiomeric analysis of the essential oil of the fruits and the leaves of Pistacia vera from Greece. Molecules. 12, 1233-1239. Varzakas, T., Zakynthinos, G., Verpoort, F., 2016. Plant food residues as a source of nutraceuticals and functional foods. Foods. 5, 88-119. Wagner, W., Wehrmann, M., 2007. Differential cytokine activity and morphology during wound healing in the neonatal and adult rat skin. J Cell Mol Med 11, 1342-1351. Wang, Z., Wang, Y., Farhangfar, F., Zimmer, M., Zhang, Y., 2012. Enhanced keratinocyte proliferation and migration in co-culture with fibroblasts. PLoS ONE. 7(7) doi: 10.1371/journal.pone.0040951.e40951. Whitehouse, W.E., 1957. The pistachio nut a new crop for the Western United States. Econ. Bot. 11, 281-321. Werner, S., Grosse., R., 2003. Regulation of wound healing by growth factors and cytokines. Physiol Rev. 83, 835-870. Wu, X., Cao, W., Wang, X., Zhang, J., Lv, Z., Qin, X., Wu, Y., Chen, W., 2013. TGM3, a candidate tumor suppressor gene, contributes to human head and neck cancer. Mol Cancer. 12, 151. 24
Yayeh, T., Hong, M., Jia, Q., Lee, Y.C., Kim, H.J., Hyun, E., Kim, T.W., Rhee, M.H., 2012. Pistacia chinensis inhibits no production and upregulates ho-1 induction via pi-3k/akt pathway in lps stimulated macrophage cells. Am. J. Chin. Med. 40, 1085-1097.
25
Table 1. Primers of genes IL-6, TNF-α, NFκ-B1 and GAPDH for performing RT-PCR Gene name
Gene symbol
Glyceraldehyde-3phosphate dehydrogenase
Gapdh
Interleukin 6
IL-6
Accession
no.
NM_001289726.1
Primer sequence (5ʹʹ-3ʹʹ)
F: ATTGTTGCCATCAACGACCC R: ATGTTAGTGGGGTCTCGCTC
NM_001314054.1
F: AGTTGCCTTCTTGGGACTGA R: CAGGTCTGTTGGGAGTGGTA
Tumor necrosis factor
TNF-α
NM_001278601.1
F: CACCACGCTCTTCTGTCTAC R: GGTCTGGGCCATAGAACTGAT
Nuclear factor of kappa
NFκB1
NM_008689.2
F: ACAAAATGCCCCACGGTTAT R: GTGCGTGGCAACTACATTTC
1
Table 2. The yield of CHCl3, EtOAc and n-butanol fractions from P. vera L. hull total extract and their effects on fibroblast cell viability and migration.
Wound area Fraction
Weight (gr)
EC50 (µg/ml) (% of control)
CHCl3
1.05
0.02
50.63%**
EtOAc
1.23
0.04
84.1%
n-BuOH
0.72
0.2
65.1%*
*and **Significant differences from control at P<0.05 and P<0.01, respectively. Bars represent the mean ± S.E.M. of three experiments.
2
Table 3. The weight of sub-fractions from P. vera L. hull chloroform fraction and their effects on fibroblast cell viability and migration.
Wound area Sub-fraction
EC50 (µg/ml)
Weight (g)
(% of control) Fr1
0.076
6.44
91%
Fr2
0.040
169
32.8%***
Fr3
0.226
3.70
82.1%
Fr4
0.415
0.02
38.4%***
Fr5
0.116
0.2
99.9%
***Significant differences from control at P<0.05 and P<0.001, respectively. Bars represent the mean ± S.E.M. of three experiments.
3
MeOH 80% Extract Partitioning
CHCl3
EtOAc
n-BtOH
Fraction
Fraction
Fraction
Fr4
Fr5
Column chromatography
FrI
Fr2
Fr3
Plate chromatography
Fr4.I
Fr4.II
Fr4.III
NMR and Mass analysis
3-epimasticadienolic acid
Figure 1. Scheme for the bioassay-guided fractionation of P. vera L. hull total extract.
1
(a)
(b)
(c)
Control
CHCl3
EtOAc
n-BuOH
Figure 2. Effect of the fractions CHCl3, EtOAc and n-BuOH on viability NIH fibroblast cells using MTT assay (a). Qualitative (b) and quantitative (c) scratch-wound healing results of the fractions CHCl3, EtOAc and n-BuOH after 48 h on NIH fibroblast cells exposing to EC50 values. Images of the fields were collected by fluorescence microscopy (magnification ×20) and analyzed with ImageJ software. *, **and ***Significant differences from control at P<0.05, P<0.01 and P<0.001, respectively. Bars represent the mean ± S.E.M. of three experiments. 2
(a)
(b) Control
Fr1
Fr2
Fr3
Fr4
Fr5
3
(c)
Figure 3. Effect of the sub-fractions (Fr1-Fr5) on viability NIH fibroblast cells using MTT assay (a). Qualitative (b) and quantitative (c) scratch-wound healing results of the sub-fractions (Fr1Fr5) after 48 h on NIH fibroblast cells exposing to EC50 values (b). Images of the fields were collected by fluorescence microscopy (magnification ×20) and analyzed with ImageJ software. *and ***Significant differences from control at P<0.05 and P<0.001, respectively and ##
P<0.01,###P<0.001 vs control. Bars represent the mean ± S.E.M. of three experiments.
4
a
b
c
Figure 4. Silica thin-layer chromatographic (TLC) profile of sub-fractions from Fr1 to Fr5 developed in hexane: ethyl acetate (3:1, v/v), the spots were visualized under UV light (a) 254 and (b) 366 nm and then (c) by spraying with vanillin/H2SO4 solution 1% (w/v) reagent after heating at 120 °C. The purple color formation displayed the presence of triterpenoids.
5
(a)
(b)
Control
Fr4.I
Fr4.II
Fr4.III
( c)
6
Figure 5. Effect of the sub-fractions (Fr4.I to Fr4.II) on viability NIH fibroblast cells using MTT assay (a). Qualitative (a) and quantitative (b) scratch-wound healing assay results after 48 h on NIH fibroblast cells exposing to EC50 of the sub-fractions (Fr4.I to Fr4.II). Images of the fields were collected by fluorescence microscopy (magnification ×20) and analyzed with ImageJ software. *and **Significant differences from control at P<0.05 and P<0.01, respectively. Bars represent the mean ± S.E.M. of three experiments.
7
Figure 6. Chemical structure of 3-epimasticadienolic acid
8
(a) Control (100)
Allantoin (77.9%)
0.2 µg/ml (100.1%)
2 µg/ml (88%)
20 µg/ml (85.7%)
200 µg/ml (55.2%)
(b)
Figure 7. Qualitative (a) and quantitative (b) scratch-wound healing assay results after 48 h on NIH fibroblast cells exposing to EC50 of 3-epimasticadienolic acid (0.2-200 µg/ml). Images of the fields were collected by fluorescence microscopy (magnification ×20) and analyzed with ImageJ software. *and ***Significant differences from control at P<0.05 and P<0.001,
9
respectively.
##
P<0.01 compare with allantoin. Bars represent the mean ± S.E.M. of three
experiments.
10
(a) Unstained cells
Untreated cells
Positive Control (Allantoin)
Negative Control (Mitomycin c)
Cells treated with compound
(b) Groups
Untreated
Percentage of parental generation
39.4%
Negative Control (Mitomycin C) 42.7%
Positive Control (Allantoin) 23.2%
Cells treated with active compound
Percentage of Generations 1 to 6
60.6%
57.3%
76.8%
75.4%
Proliferation Index
1.36
1.17
1.46
1.41
24.6%
Figure 8. Impact of the active compound (3α-HMA) on the cell proliferation was assessed by flow cytometry. NIH/3T3 fibroblast cells were labeled with CFSE and cultured in the absence and presence of 3α-HMA (200 µg/ml), allantoein (50µg/ml) and mitomycin c (5 µg/ml). The histogram shows the proliferation activity of these samples on 5 days (a). Percentage of parental 11
generation, percentage of generations 1 to 6 and proliferation index due to untreated and treated cells with 3α-HMA (200 µg/ml), allantoein (50µg/ml) and mitomycin c (5 µg/ml) on 5 days (b).
12
Relative gen
Groups
expression Control
Allantoin
3α-HMA
IL-6
1 ± 0.045
0.54 ± 0.043
0.86 ± 0.023
TNF-α
1 ± 0.045
0.42 ± 0.037
0.54 ± 0.0123
NF-κB1
1 ± 0.045
2.38 ± 0.065
1.52 ± 0.0753
Figure 9. Effect of the active compound (3α-HMA) on gene expression level of IL-6, TNF-α and NF-κB1. The relative expression of IL-6, TNF-α and NF-κB1 genes was normalized against the expression level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene. *and ***Significant differences from control at P<0.05 and P<0.001, respectively. Bars represent the mean ± S.E.M. of three experiments.
13
S0378-8741(19)30782-2
DOI:
https://doi.org/10.1016/j.jep.2019.112335
Reference:
JEP 112335
To appear in:
Journal of Ethnopharmacology
Received Date: 12 March 2019 Revised Date:
19 August 2019
Accepted Date: 22 October 2019
Please cite this article as: Sarkhail, P., Navidpour, L., Rahimifard, M., Hosseini, N.M., Souri, E., Bioassay-guided fractionation and identification of wound healing active compound from Pistacia vera L. hull extract., Journal of Ethnopharmacology (2019), doi: https://doi.org/10.1016/j.jep.2019.112335. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier B.V.
Bioassay guided fractiation of Pistacia vera hulls extract (MeOH 80%)
At concentration 200 μg/ml
Scratch-wound healing assay Migration Proliferation
Inflammation
Bioassay-guided fractionation and identification of wound healing active compound from Pistacia vera L. hull extract.
Parisa Sarkhail
a,b
*, Latifeh Navidpour c, Mahban Rahimifard d, Negar Mohammad Hosseini b,
Effat Souri c a
Medicinal Plants Research Center, Faculty of Pharmacy, Tehran University of Medical
Sciences, Tehran, Iran. b
Bioactive Natural Products Group, Pharmaceutical Sciences Research Center, Institute of
Pharmaceutical Sciences (TIPS). Tehran University of Medical Sciences, Tehran, Iran. c
Department of Medicinal Chemistry, Faculty of Pharmacy, Tehran University of Medical
Sciences, Tehran, Iran. d
Toxicology and Diseases Group, Pharmaceutical Sciences Research Center, Institute of
Pharmaceutical Sciences (TIPS), Tehran University of Medical Sciences, Tehran, Iran.
*Correspondence Dr. Parisa Sarkhail, Associated professor of Medicinal Plants Research Center, Faculty of Pharmacy, Tehran University of Medical Sciences, Tehran, Iran. 16th Azar St. Tehran, Iran, PO Box 14155-6451, Tel/Fax +98 2143850522, Email: [email protected] 1
Bioassay-guided fractionation and identification of wound healing active compound from Pistacia vera L. hull extract.
Abstract ETHNOPHARMACOLOGICAL RELEVANCE: Pistachio hull has traditionally been used to treat peptic ulcer, hemorrhoids, oral and cutaneous wounds. AIM OF THE STUDY: On the basis of its traditional uses and previous pharmacological reports, a bioassay guided fractionation procedures on pistachio (Pistacia vera L.) hulls was performed to define the fractions and bioactive compound that are responsible for wound healing activity of hulls. MATERIAL AND METHODS: A bioassay-guided fractionation of the total extract (MeOH 80%) of Pistacia vera L. hulls was carried out to evaluate wound healing activity by scratch assay on NIH/3T3 murine fibroblast cells. A combination of solvent-solvent partitioning, column chromatography, preparative thin layer chromatography and crystallization were used to obtain fractions/sub-fractions and pure compound. The wound healing potential of isolated compound was examined by fibroblasts migration and proliferation using scratch assay and CFSC dilution assay, respectively. In addition, we evaluated the gene expression of some inflammatory markers which are involved in healing process using Real Time PCR. Chemical structure of active compound was elucidated by spectrometric methods.
2
RESULTS: Due to the higher wound healing activity of CHCl3 fraction from P. vera hulls, it was fractionated by successive chromatographic techniques to yield the active compound. 3epimasticadienolic acid was isolated and crystallized as a white powder. This active compound (200 µg/ml) significantly increased the fibroblast proliferation and migration, resulting in reduction of the scratch area about 45%. It showed a strong inhibitory effect on gene expression of IL-6 and TNF-α, and a stimulation effect on NF-κB gene expression at the same dose. CONCLUSION: The present study supported the traditional uses of P. vera hulls for woundhealing and 3-epimasticadienolic acid showed significantly potent on wound repair.
Abbreviations CC, column chromatography; CFSC, carboxyfluorescein diacetate succinimidyl ester; DMEM; Dulbecco’s Modified Eagle’s Medium, EC50, half maximal effective concentration; EIMS, electron ionization mass spectrometry; FBS, Fetal Bovine Serum; GAPDH, glyceraldehyde 3phosphate
dehydrogenase;
IL-6,
interleukine-6;
MTT,
3-4,5
dimethylthiazol-2-yl-2,5-
diphenyltetrazolium bromide; NF-κB, nuclear factor kappa light chain enhancer of activated B cells; NMR, nuclear magnetic resonance; PTLC, preparative thin layer chromatography; RTPCR, Real-time reverse transcription polymerase chain reaction; TNf-α, tumor necrosis factor alpha. Keywords: Pistachio hull; bioassay-guided fractionation; fibroblast cells; scratch-wound healing assay; proliferation; migration; inflammation.
3
1. Introduction In Iran, the Pistacia genus from the Anacardiaceae family includes three species: P. vera, P. atlantica and P. khinjuk species. Pistacia vera L. is a dioecious tree or shrub that is economically the most important species in this genus. It probably originated in Central Asia and the Middle East and also is dispersed all over the Mediterranean basin. From the sixth millennium BC, it has been found in both Afghanistan and southeastern Iran (Whitehouse 1957; Salas-Salvado et al., 2011; Bozorgi et al., 2013). The tree produces edible seeds that are considerable commercial importance especially in Iran. In folk medicine, seed pistachio has been proven effective for treatment of blood clotting, poor circulation, dyspepsia, asthma, jaundice, diarrhea and renal stones. Pistachio hulls and gum are traditionally used in remedy of toothache and other periodontal ailments, oral and cutaneous wounds, stomach problems and hemorrhoids as an anti-inflammatory, antibacterial, antiviral and wound healing agent (Alma et al., 2004; Orhan et al., 2006; Tsokou et al., 2007; Bozorgi et al., 2013). In addition, people use smoke of pistachio mastic in rapid healing of deep wound, and chew pistachio hull for gum stiffness and elimination bad breath. The edible nut and hull are also a rich source of anthocyanidins, proanthocyanidins, isoflavones and phytosterols (Tsokou et al., 2007; Mahjoub et al., 2018). Previous pharmacological studies confirmed that pistachio resin is able to improve wound healing through increasing vascular endothelial growth factor (VEGF) and hydroxyproline, reducing malondialdehyde levels and antioxidant activity (Shahouzehi et al., 2018; Shahouzehi et al., 2019). The ointment from P. atlantica hull improved wound healing process by promoting angiogenesis, fibroblast proliferation, increasing mast cells distribution and infiltration (Farahpour et al., 2015; Minaiyan et al., 2015; Shahouzehi et al., 2018). Recently, anti4
melanogenic activity of P. vera hull extract (Sarkhail et al. 2017) and P. atlantica unripe fruits have been reported (Eghbali-Feriz et al., 2018). In addition, differentl applications have been known for pistachio hulls such as a feed additive (Behgar et al., 2009), raw source for biofuel and biogas generation (Demiral et al., 2008; Çelik and Demirer, 2015) and absorbent for contaminated water (Moussavi and Khosravi, 2010). In this way, nowadays, the value of pistachio hull is rising as a source of novel biologically active agents that can used in new formulation drugs (Orhan et al., 2006; Rajaei et al., 2010; Tomaino et al., 2010; Varzakas et al., 2016). Wound healing is a dynamic process and normal biological response to the injury which occurs through different overlapping phases including inflammation, proliferation and maturation. There are many inflammatory markers such as, pro-inflammatory cytokines (tumor necrosis factor alpha, interleukins, nuclear factor kappa B), growth factors, extracellular matrix (ECM), and different type cells that regulate wound healing process. Key to this healing process is proliferation, migration and other functions in fibroblasts and keratinocytes. Prolonged inflammation can interfere with the whole healing process, as the inflammatory response inhibits skin cell proliferation and differentiation (Gio and Dipietro., 2010; Tsala et al., 2013; Muthusamy and Piva , 2010; warner and Grosse, 2003). To date, many herbal medicines have been reported to show wound healing activity via several mechanisms (Nagori and Solanki, 2011). On the basis of pistachio hull’s traditional uses and previous pharmacological reports, for the first time, we evaluated the wound healing activity of Pestacia vera L. hulls through bioassay guided fractionation procedures to define active fractions and compound which are responsible for this effect on murine embryonic fibroblast cell line. In the present study, we used the scratch-wound assay as a simple and valid assay for the 5
evaluation of the wound healing activity of fibroblast cells in the mechanical wound (SevimliGür et al., 2011). In addition, we investigated the effect of the active isolated compound on the cellular proliferation and gene expression of three main inflammatory markers, including IL-6, TNf-α and NF-κB1 for scientific support.
2. Materials and methods 2.1. Materials NIH/3T3 fibroblast cells were obtained from the cell bank of Pasteur Institute of Iran (NCBI). Dulbecco's modified eagle's medium (DMEM), fetal bovine serum (FBS), 3-4,5 dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT), carboxyfluorescein diacetate succinimidyl ester (CFSE), allantoein, dimethyl sulfoxide (DMSO) and DAPI (4′,6-Diamidino-2phenylindole dihydrochloride) were purchased from Sigma-Aldrich (Munich, Germany). Silica gel 60 G (70–230 mesh) were used as the stationary phase in CC and precoated silica gel plates (Merck, Kieselgel 60 F-254, 0.5 mm) were used for PTLC. Thin layer chromatography (TLC) was performed on silica gel F254 (Merck) precoated aluminum sheets. For gene expression investigation HiGene™ Total RNA Prep kit (Cat. No. RP101-100), (Cat. No. DQ383-40h), BioFact™ 5X RT Pre-Mix (Cat. No. BR441-096) and BioFACT™ 2X Real-Time PCR Master Mix (For SYBR Green I) were purchased from BioFact (Seoul, Korea). All other solvents and chemicals used in experiments were obtained from Merck (Germany).
2.2. Phytochemical study 6
2.2.1. Plant material and preparation of liquid–liquid partition Pistacia vera L. fruits (Anacardiaceae) were purchased from the local market in Tehran, Iran and validated by the corresponding author. A voucher specimen (No. 1391-3) was deposited at Pharmaceutical Sciences Research Center (PSRC) laboratory, Tehran University of Medicinal Sciences. Pink-purple hulls were separated from the fruits by hand and then dried at 40 °C. 20 grams crispy hulls were crushed with an electric blender and extracted with 80% aqueous MeOH using percolation apparatus three times at room temperature. After filtration, evaporation was performed under vacuum and concentrated with freeze dryer. The dried extract was stored at 4 °C for experimental studies. The dry total extract from hulls was successively partitioned to the chloroform, ethyl acetate and n-butanol fractions. Subsequently, these fractions were subjected to be tested for their viability and wound healing activity. 2.2.2. Bioassay-guided fractionation and compounds isolation Following bioassay-guided procedures on the total extract of P. vera hull, the chloroform fraction, as an active part on the scratch-wound healing assay, was fractionated by chromatographic techniques. One gram of CHCl3 fraction was fractionated using a glass column packed with silica gel and elution was performed with a stepwise gradient of hexane–CHCl3 (1:0 to 0:1 v/v) and then of CHCl3–EtOAc (1:0 to 1:4 v/v) to obtain 62 primary fractions. The collected fractions were grouped into five fractions (Fr1–Fr5) after monitoring by their thin layer chromatographic (TLC on silica gel 60 F 254) using hexane: ethyl acetate (3:1) as mobile phase. The spots were visualized under UV light (254 and 366 nm) and by spraying with vanillin/H2SO4 solution 1% (w/v) reagent and heating at 120 °C until maximum color formation. All fractions Fr1–Fr5 were screened for viability by the MTT assay and wound scratching method (see 7
below). The bioactive fraction Fr4 was subjected to further preparative chromatography on glass plates with silica gel using hexane: ethyl acetate (7:3 v/v) as the mobile phase. Three subfractions namely Fr4.I, Fr4.II and Fr4.III were obtained. From the sub-fraction Fr4.III (108 mg), one major compound was isolated and purified by crystallization from MeOH and identified by mass spectrometry, 1H and 13C-NMR, DEPT-135. This compound showed purple color spot after spraying with vanillin-H2SO4, in TLC, with Rf of 0.33 (hexane: EtOAc, 7:3 v/v). The fractionation procedure of pistachio hull is shown in Fig. 1. 2.2.3. Structure elucidation of the active compound The NMR spectra were obtained on a Varian 500 spectrometer using tetramethylsilane as internal standard. Chemical shifts are given in δ-scale. Melting point was determined on a Reichert-Jung hot-stage microscope and EI-MS spectra were recorded on a mass spectrometer (Agilent Technologies) with electron ionization at 70 eV and quadruple analyzer. 2.2.3.1. 3α-Hydroxytirucalla-7, 24Z-dien-26-oic acid (3-epimasticadienolic acid or schinol). This compound was obtained as white amorphous powders, mp l48-150 °C with molecular weight of 456 (C30H48O3): EI-MS m/z 456 [M]+, 441 [M+- CH3], 423 [M+-CH3-H2O], 187, 175, 147,135, 119, 107, 95, 81, 69, 55. 1H-NMR (CDCl3), δ/ppm: 6.09 (1H, brt, J = 7.1 Hz, H-24), 5.25 (1H, brs, H-7), 3.46 (1H, bt, J = 2.9 Hz, H-3), 2.56 (1H, m, H-9), 2.45 (2H, m, H23), 2.31 (2H, m, H-2), 2.20 (3H, s, H-27), 1.4-2.0 (17H, m, H-1, H-5, H-6, H-11, H-12, H-15, H-16, H-17, H-20, H-22), 1.26 (3H, s, H-30), 0.97 (3H, s, H-28), 0.94 (3H ,s, H-29), 0.96 (3H, d, J = 6.35 Hz, H-21), 0.82 (3H, s, H-18), 0.77 (3H, s, H-19).Its 1H-NMR spectrum indicated five tertiary methyl group at δ 1.9 (s), 1.26 (s), 0.97 (s), 0.94 (s), 0.82 (s), and 0.77 (s), a secondary methyl group at δ 0.96 (d, J = 6.35 Hz). One oxymethine proton signal at δ 3.46 (bt, J = 2.9 Hz) 8
is characteristic of the proton geminal to the 3α-axial hydroxyl in tirucallane-type triterpenes. The 1H NMR also detected two olefinic signals at δ 6.09 (t, 1H, J = 7.1 Hz) and 5.25 (brs, 1H). 13
C-NMR (CDCl3), δ/ppm: 172.0 (C-26), 146.9 (CH-24), 146.13 (Cq-8), 125.6 (Cq-25), 117.9
(CH-7), 76.1 (CH-3), 52.8 (CH-17), 51.2 (Cq-14), 48.7 (CH-9), 44.8 (CH-5), 43.5 (Cq-13), 36.1 (CH-20), 35.9 (Cq-4), 35.7 (CH2-22), 34.7 (CH2-10), 34.0 (CH2-15), 33.8 (C-12), 31.3 (CH2-1), 28.2 (CH2-16), 27.8 (CH3-28), 27.3 (CH3-30), 26.9 (CH2-2), 25.4 (CH2-23), 23.9 (CH2-6), 21.9 (CH3-29), 21.8 (CH3-18), 20.5 (CH3-27), 18.3 (CH3-21), 18.0 (CH2-11), 13.0 (CH3-19). The I3CNMR spectrum of this compound showed 30 carbon atoms. Its 13C-NMR spectrum displayed one carbonyl signal at δ 172.0, four signals at δ 146.9 (CH-24), 146.13 (Cq-8), 125.6 (Cq-25), 117.9 (CH-7) represented two double bond. The DEPT 135 experiment confirmed the existence of one oxygenated signal at δ 76.1, and six methyls, nine methylenes and five methanes in the structure of compound. On the basis of the above evidence and by comparison of the spectroscopic data with the previous reports (Konno et al., 1981; Mulholland and Nair, 1994; Camacho et al., 2000; Morais et al., 2014).the structure of this compound was determined to be 3α-Hydroxytirucalla7,24Z-dien-26-oic acid (Fig. 2). 2.3. Biological activity evaluation 2.3.1. Cell culture and Cell viability assay
To investigate safety of samples, the NIH-3T3 murine embryonic fibroblast cell line viability was assessed using MTT assay. The fibroblast cells were cultured in complete DMEM supplemented with 10% FBS, 100 IU/ml penicillin, and 100 µg/ml streptomycin at 37°C under 5% CO2. Cells were cultured at 104 cells/well into a 96-well plate. Then they treated with varying concentrations of the fractions/sub-fractions (0.02 - 200 µg/ml) that prepared in DMSO 9
(0.5% v/v). After 48 hours of incubation, the medium was washed twice with phosphate buffer and 50 µL of MTT (0.5 mg/ml) was added. Then cells were incubated for another 3 hours at 37°C. In the next step, purple crystal of formazan was dissolved in dimethyl sulfoxide (DMSO) for 30 min and the absorption was read using ELISA reader (Synergy, BioTek Instruments Inc., Germany) at 570 nm. The background absorbance at 690 nm was subtracted from 570 nm. Data is represented as percent of control (Mosmann, 1883). Finally, EC50 of each fraction on the NIH fibroblast cells was calculated and reported. 2.3.2. In vitro scratch-wound healing assay The ability of migration of NIH fibroblast cells into the wounded area was assessed using scratch assay method. Cells were seeded at 2×105 cells/well in 24-well cell culture dishes along with DMEM. For monolayer formation with approximate 75% confluency, 24-hour incubation at 37 °C was done. Then, with a sterile 100µL pipette tip, a linear scratch was created. Then, cells were washed using PBS in order to remove residues and then exposed to EC50 of fractions/subfractions and different concentrations of active compound (0.2-200 µg/ml) for 48 hours (Bayrami et al., 2018). Allantoin was used as a positive control at 50 µg/ml concentration (Muniandy et al., 2018). In the following, the fixation of cells with 4% paraformaldehyde for 15 min and staining by DAPI for 1 min were conducted. Finally, images were taken using fluorescence microscope (Olympus BX51, Japan) and the changes in wound area were analyzed using “imageJ” software. 2.3.3. Cell proliferation assay Cell proliferation of isolated compound determined by carboxyfluorescein diacetate succinimidyl ester (CFSE) cytoplasmic proliferation dye assay flow cytometry experiment based on a previously described protocol (Badr et al., 2012). The cells were harvested and washed two 10
times in PBS and stained with 5 µM CFSE for 8 min at room temperature and then CFSE inactivate by FBS. Residual CFSE was removed by washing twice with PBS, and CFSE labeled cells were seeded in 6-well plates and grown in cell culture medium. Mitomicine C used as a negative control (5 µg/ml, for 2 h), allantoin as positive control (50 µg/ml) and 3α-HMA (200 µg/ml). The CFSE florescence intensity was measured by flow cytometry using FACS analysis after 5 days. Each peak represents a successive generation of cell division. 2.3.4. Real-time PCR Analysis The mRNA expressions of IL-6, TNF-α and NF-κB1 were analyzed by real-time PCR. After washing the cells in sterilized PBS and according to the manufacturer's suggested protocol, total RNA was extracted from the cells using the TRIZol@ reagent. The RNA concentration was measured via Thermo Scientific NanoDrop 2000c UV–Vis spectrophotometer (Thermo Scientific, USA). The ratio between the readings at 260 nm and 280 nm (OD260/OD280) was used to provide an estimate of the purity of the nucleic acid, and the ratio ranged between 1.7 and 2.0. DNase-I and RNase-free kits were used to remove genomic DNA, while cDNA was a reverse transcript by iScript cDNA synthesis kit. As reference gene, primer pairs were selected with GAPDH. Quantitative RT-PCR evaluation was done using Light Cycler 96 system (Roche) by SYBR green master mix. Comparative cycle threshold method was used to evaluate the relative gene expression (Wu et al., 2013). Table 1 indicates abbreviations, accession number, and sequence of the primers.
2.4. Statistics
11
Data obtained within the groups were expressed as mean ± SEM for triplicate independent experiments. The statistical significance of the data was analyzed with a one-way ANOVA followed by Tukey’s HSD using SPSS program (Version 11.5, SPSS Inc., Chicago, IL) and the significance level was set at P ≤ 0.05. Flow cytometry data were analyzed by FlowJo software.
3. Results and Discussion In traditional medicines worldwide, a large number of plants and plant extracts have been used for treatment of wounds. A number of medicinal plants have been reported to repair wounds by promoting blood fighting against infection and accelerating wound healing. In the present study, we evaluated the wound healing property of Pistacia vera hull on the basis of traditional Iranian medicine and the latest pharmacological reports about pistachio species hull (Tsokou et al., 2007; Bozorgi et al., 2013). The bioassay-guided fractionation of P. vera hull, was carried out using the scratchwound healing assay on NIH-3T3 fibroblast cells. Although the scratch-wound healing assay cannot substitute in vivo studies as a final proof for efficacy in wound healing, it is useful for gaining the first insights into the potential of the extract and compound to wound healing. Generally, this assay is applied to consider the second phase of wound healing process which is characterized by migration of fibroblast or keratinocytes. The total extract of P. vera hull was fractionated (as shown in Fig. 1) and the effect of fractions/sub-fractions on viability of NIH-3T3 fibroblast cells, at a different concentrations, was evaluated by MTT assay to select the best samples concentration (EC50) as seen in Fig. 2a. The CHCl3, EtOAc and n-BuOH fractions at a concentration range of 0.02–20 µg/ml showed no toxic effect on NIH fibroblast cells. The 12
effective concentrations (EC50) values for CHCl3, EtOAc and n-BuOH fractions were determined as 0.02, 0.04 and 0.2 µg/ml, respectively. Consequently, the EC50 value of each fraction was chosen for in vitro wound scratching assay on NIH/3T3 fibroblast cells. Fibroblast migration rates were considered at a time period of 48 h after in vitro wound induction in the groups. Among the fractions, as shown in Figure 2b, treated cells with CHCl3 fraction showed the most cell migration rate. Wound area of that group significantly (P<0.01) decreased down to 50.63% of control group (Fig. 2c). The yield of CHCl3, EtOAc and n-BuOH fractions from P. vera hull total extract and their effects on fibroblast cell viability and migration was listed in Table 2. Due to the higher wound healing activity of CHCl3 fraction, following investigations were carried out on its sub-fractions. The yield of five chloroform sub-fractions (Fr1-Fr5) was presented in Table 3. In Fig 3ac the viability and wound healing activity of Fr1-Fr5 on the cells were shown. According to the results listed in Table 3, Fr2 with an EC50 value of 169 µg/ml and Fr4 at EC50 value of 0.02 µg/ml were able to decrease significantly (P<0.001) the wound area of fibroblast cells scratch within 48 hours down to 38.4% and 32.8% of control, respectively. The TLC examination of CHCl3 sub-fractions displayed the presence of terpenoids in Fr2 and Fr4 after spraying vanillinsulfuric acid reagent and heating (120 °C) (Fig.4). Due to the higher yield of Fr4 in comparison with Fr2, it was selected for further bioassays. The active Fr4 was subjected to fractionation by PTLC technique and were grouped into three sub-fractions (Fr4.I-Fr4.III) based on their chemical fingerprinting on TLC examination. In the MTT assay, the EC50 values of Fr4.I, Fr4.II and Fr4.III were estimated at 12, 16 and 0.01 µg/ml, respectively (Fig. 5a). As Fig. 5b and c is shown the Fr4.III has the best effect on migration of the cells and can reduce wound area down to 23.36%. Delayed wound healing processes were observed especially in the control group 13
compared to the other groups. From fraction Fr4.III one major compound was purified by crystallization from MeOH and identified by mass spectrometry, 1H and (Supplementary
Fig.
1a
to
d)
as
13
C-NMR, DEPT-135
3α-hydroxytirucalla-7,24Z-dien-26-oic
acid
(3-
epimasticadienolic acid, schinol). The chemical structure of compound was shown in Fig. 6. 3α-hydroxymasticadienolic acid (3α-HMA) as a pentacyclic triterpene compound has been found in Pistacia spp. resins and galls (Paraschos et al., 2007; Bozorgi et al., 2013) but it is the first time that isolated from P. vera hull. The results showed that 3α-HMA at the concentrations between 20 and 200 µg/ml significantly (P < 0.05 to P< 0.001) increased the rate of wound closure compared with the control group during 48h in a dose-dependent manner (Fig, 7). This finding confirmed that the treatment of 3α-HMA improved the migration and wound closure of NIH/3T3 fibroblast cells better than allantoein. Regarding the significant reduction with highest concentration of 3α-HMA (200 µg/ml) on the scratch wound area (about 45%, P< 0.001), it was used for further bioassays. The ability of 3α-HMA on the proliferation fibroblast cells was investigated through the CFSE dilution flow cytometry assay which is an effective method to monitor cell division by measuring the corresponding decrease in cell fluorescence (Lyons et al., 2000). We found that after being treated with 200 µg/ml of 3α-HMA, the percentage of proliferating cells was markedly increased from 60% in untreated cells to 75.4% in treatedcompound cells and was similar to the results obtained in treated cells with allantoin as a positive control (50 µg/ml) (Fig. 8) Wound healing is characterized by the different process of reepithelization that is associated with proliferation, growth, and migration. Fibroblasts along with several mediators at the cellular and molecular are the most important components of granulation tissue that involved 14
in wound closure mechanism (Wagner and Wehrmann, 2007; Wang et al., 2012). The secretions of pro-inflammatory cytokines by the cells, particularly IL-6 and TNf-α and also NF-κB pathway play key roles in the regulation of inflammation, fibroblast proliferation and migration. In the inflammatory phase, NF-κB is a key transcription factor of M1 macrophages and has an important role in regulating the expressions of inflammatory genes such as IL-6 and TNf-α. The high levels of IL-6 and TNF-α can interfere with one or more phases in wound healing process and cause prolonged inflammation that leading to further tissue injury. In the proliferation phase of wound healing, macrophage undergo a differentiation into activate anti-inflammatory phenotypes (M2 macrophage) that stimulate fibroblast proliferation and migration as well as proliferation of extracellular matrix (ECM) which are responsible in wound closure (Sorg et al., 2017; Liu et al., 2017). NF-κB is composed of five structurally related members, including NFκB1 (p50), NF-κB2 (p52), RelA (p65), RelB, c-Rel, which mediates transcription of various inflammatory genes. NF-κB1, one of the most common NF-κB heterodimers, is not only a key regulator of inflammation and innate immunity, but also induces the expression of anti-apoptotic genes to accelerate cell growth and proliferation cells. In this study, we evaluated the expression of IL-6, TNF-α and NF-κB1 genes using Real Time PCR. We confirmed that the expression level of IL-6 and TNF-α significantly (P<0.05 and P<0.001, respectively) decreased in cells treated with 3α-HMA at concentration 200 µg/ml, while this compound at the same concentration significantly (P<0.001) increased the expression level of NF-κB1 in the cells more than untreated cell (Fig. 9). Based on this data, we can suggested the wound healing process in fibroblast cells using 3α-HMA effectively enhanced through the anti-inflammatory effect of NFκB signaling pathways by a reduction of associated mediators cytokines such as IL-6 and TNF-α levels and probably other inflammatory factors was not tested in these study (Tan et al., 2019). 15
Several evidences showed that many triterpenoids and polyphenolics from Pistacia spp. play an important role in reducing inflammation. Pistacia chinensis methanolic extract showed anti-inflammatory and antioxidant activity through influencing redox-sensitive signal transduction pathways, therefore modulating NF-κB activity and finally inhibited mRNA expressions of inducible nitric oxide synthase (iNOS), cyclooxygenase 2 (COX-2), tumor necrosis factor (TNF)-α and interleukin (IL)-6 (Yayeh et al., 2012; Grace et al., 2016). Some previous studies have revealed that the essential oils, galls and resins from Pistacia spp. can accelerate the wound healing process that generally is due to promoting angiogenesis, fibroblast proliferation, increasing mast cells distribution, infiltration and RNA stability, antimicrobial and anti-inflammatory activity (Bozorgi et al., 2013; Farahpour et al., 2015; Minaiyan et al., 2015; Shahouzehi et al., 2018). Resin and gall of these species are rich of tetracyclic triterpenes such as masticadienonic acid, masticadienolic acid and 3α-hydroxymasticadienonic acid that seem to be responsible for its anti-inflammatory activity (Giner-Larza et al., 2002; Arrieta et al., 2003; Alma et al., 2004) and gastro-protective effects (Rosas-Acevedo et al., 2011) through inhibition of phospholipase A2, leukotriene B4 generation and NO production (Jain et al., 1995; Arrieta et al., 2003; Oviedo-Chávez et al., 2004). Pentacyclic triterpenoids have been found to have many functions, for example, masticadienonic acid, masticadienolic acid and morolic acid showed efficiency on the mouse ear inflammation (Giner-Larza et al., 2002). In this study, we showed that the wound healing activity of P. vera hull can be due to the presence of triterpenoids such as 3-epimasticadienolic acid in which play a significant role in fibroblast cell proliferation, migration and modulation of inflammatory markers such as IL-6, TNF-α and NF-κB1.
16
4. Conclusion The present study supported the traditional use of Pistacia vera hulls for wound-healing. Throughout bioassay-guided fractionation procedures, we proved that the non-polar extract was rich of bioactive components with wound healing effect and 3-epimasticadienolic acid was identified as, at least, one of the active compounds. In addition, this study is the first to provide scientific evidence that the potential wound healing effect of 3-epimasticadienolic acid due to a combination of fibroblast stimulation and inhibition of inflammatory markers production.
Acknowledgements The authors warmly thank Dr. Zahra Heydari (PhD student of Organic Chemistry at Tehran University) for NMR experiments. This study is supported by a grant from The Institute of Pharmaceutical Sciences (TIPS) (No. 95-04-45-33338).
Conflict of interest All of the authors claim that there is no conflict of interests among the authors.
References Alma, M.H., Nitz, S., Kollmannsberger, H., Digrak, M., Efe, F.T., Yilmaz, N., 2044. Chemical composition and antimicrobial activity of the essential oils from the gum of Turkish pistachio (Pistacia vera L.). J. Agric. Food. Chem. 52, 3911-3914.
17
Arrieta, J., Benitez, J., Flores, E., Carlos. C., 2003. Navarrete, Andres - Purification of Gastroprotective Triterpenoids from the Stem Bark of Amphipterygium adstringens; Role of prostaglandins, sulfhydryls, nitric oxide and capsaicin-sensitive neurons. Planta. Med. 69, 905-909. Badr, G., Al-Sadoon, M.K., Abdel-Maksoud, M.A., Rabah, D.M., El-Toni, A.M., 2012. Cellular and Molecular Mechanisms Underlie the Anti-Tumor Activities Exerted by Walterinnesia aegyptia Venom Combined with Silica Nanoparticles against Multiple Myeloma Cancer Cell Types. PLoS One. 7, e51661. Bayrami, Z., Hajiaghaee, R., Khalighi-Sigaroodi, F., Rahimi, R., Farzaei, M.H., Hodjat, M., Baeeri, M., Rahimifard, M., Navaei-Nigjeh, M., Abdollahi, M., 2018. Bio-guided fractionation and isolation of active component from Tragopogon graminifolius based on its wound healing property. J. Ethnopharmacol. 226, 48-55. Behgar, M., Valizadeh, R., Mirzaee, M., Naserian, A.A., Nasiri, M.R., 2009. Correlation between the physical and chemical properties of some forages and non-forage fiber. J. Anim. Vet. Advances. 8, 2280-2285. Benjamin J. C. Quah and Christopher R. Parish. 2010. The Use of Carboxyfluorescein Diacetate Succinimidyl Ester (CFSE) to Monitor Lymphocyte Proliferation J Vis Exp. 44, 2259doi: 10.3791/2259. Bozorgi, M., Memariani, Z., Mobli, M., Salehi Surmaghi, M.H., Shams-Ardekani, M.R., Rahimi, R., 2013. Five Pistacia species (P. vera, P. atlantica, P. terebinthus, P. khinjuk, and P.
18
lentiscus): a review of their traditional uses, phytochemistry, and pharmacology. Sci.World. J. 219815-24453812. Camacho, M.R., Mata, R., Castaneda, P., Kirby, G.C., Warhurst, D.C., Croft, S.L., Phillipson, J.D., 2000. Bioactive compounds from Celaenodendron mexicanum. Planta Med. 66, 463-468. Çelik, I., Demirer, G.N., 2015. Biogas production from pistachio (Pistacia vera L.) processing waste. Biocatal. Agric. Biotechnol. 4, 767-772. Daneshrad, A., Aynehchi, Y., 1980. Chemical studies of the oil from Pistacia nuts growing wild in iran. J. Am. Oil. Chem. Soc. 57, 248–249. Delazar, A., Reid, R.G., Sarker, S.D., 2004. GC-MS analysis of essential oil of the oleoresin from Pistacia atlantica var mutica. Chem. Nat. Compd. 40, 24-27. Demiral, I., Atilgan, N.G., Şensöz, S., 2008. Production of biofuel from soft shell of pistachio (Pistacia vera L.). Chem. Eng. Commun. 196, 104-115. Eghbali-Feriz, S., Taleghani, A., Al-Najjar, H., Emami, S.A., Rahimi, H., Asili, J., Hasanzadeh. S., Tayarani-Najaran, Z., 2018. Anti-melanogenesis and anti-tyrosinase properties of Pistacia atlantica subsp. mutica extracts on B16F10 murine melanoma cells. Res Pharm Sci. 13, 533545. Farahpour, M.R., Mirzakhani, N., Doostmohammadi, J., Ebrahimzadeh, M., 2015, Hydroethanolic Pistacia atlantica hulls extract improved wound healing process; evidence for mast cells infiltration, angiogenesis and RNA stability. Int. J. Surg. 17, 88-98.
19
Giner-Larza, E.M., Máñez, S., Giner, R.M., Recio, M.C., Prieto, J.M., Cerdá-Nicolás, M., Ríos, J.L., 2002. Anti-inflammatory triterpenes from Pistacia terebinthusgalls, Planta. Medica. 68, 311315. Grace, M.H., Esposito, D., Timmers, M.A., Xiong, J., Yousef, G., Komarnytsky, S., Lila, M.A., 2016. In vitro lipolytic, antioxidant and anti-inflammatory activities of roasted pistachio kernel and skin constituents. Food Funct. 7, 4285-4298. Guo, S., Dipietro, L.A., 2010. Factors affecting wound healing. J Dent Res. 89, 219-29. Jain, M.K., Yu, B.Z., Rogers, J.M., Smith, A.E., Boger, E.T., 1995. Ostrander RL, Rheingold AL. Specific competitive inhibitor of secreted phospholipase A2 from berries of Schinus terebinthifolius. Phytochemistry. 39, 537-547. Konno, C., Saito, T., Oshima, Y., Hikino, H., Kabuto, C., 1981. Structure of methyl adenophorate and triphyllol, triterpenoids of Adenophora triphylla var. japonica roots. Planta Med. 42, 268-274. Liu, T., Zhang, L., Joo, D., Sun, S.C., 2017. NF-κB signaling in inflammation. Signal Transduct Target Ther. 2. pii: 17023. doi: 10.1038/sigtrans. Lyons, A.B., 2000. Analysing cell division in vivo and in vitro using flow cytometric measurement of CFSE dye dilution. J Immunol Methods. 243, 147-154. Mahjoub, F., Akhavan Rezayat, K., Yousefi, M., Mohebbi, M., Salari, R., 2018. Pistacia atlantica Desf. A review of its traditional uses, phytochemicals and pharmacology. J. Med. Life. 11, 180-186.
20
Minaiyan, M., Karimi, F., Ghannadi, A., 2015. Anti-inflammatory effect of Pistacia atlantica subsp kurdica volatile oil and gum on acetic acid-induced acute colitis in rat. R. J. P. 2, 1-12. Moeini-Nodeh, S., Rahimifard, M., Baeeri, M., Abdollahi, M., 2017, Functional Improvement in Rats' Pancreatic Islets Using Magnesium Oxide Nanoparticles Through antiapoptotic and antioxidant pathways. Biol. Trace. Elem. Res. 175, 146-155. Morais, T.R., da Costa-Silva, T.A., Tempone, A.G., Borborema, S.E., Scotti, M.T., de Sousa, R.M., Araujo, A.C., de Oliveira, A., de Morais, S.A., Sartorelli, P., Lago, J.H., 2014. Antiparasitic activity of natural and semi-synthetic tirucallane triterpenoids from Schinus terebinthifolius (Anacardiaceae): structure/activity relationships. Molecules. 19, 5761-5776. Mosmann, T., 1983. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J. Immunol. Methods. 65, 55-63. Moussavi, G., Khosravi, R., 2010. Removal of cyanide from wastewater by adsorption onto pistachio hull wastes: parametric experiments, kinetics and equilibrium analysis. J. Hazard. Mater. 183, 724-730. Mulholland, D.A., Nair, J.J., 1994. Triterpenoids from Dysoxylum pettigrewianum. Phytochemistry. 37, 1409-1411. Muniandy, K., Gothai, S., Tan, W.S., Kumar, S.S., Mohd Esa, N., Chandramohan, G., Al-Numair, K.S., Arulselvan, P., 2018. In vitro wound healing potential of stem extract of Alternanthera sessilis. Evid Based Complement Alternat Med. 2018:3142073. doi: 10.1155/2018/3142073.
21
Muthusamy., V, Piva., T., 2010. The UV response of the skin: a review of the MAPK, NF-κB and TNF-α signal transduction pathways. Arch Dermatol Res 302: 5-17. Nagori, B.P., Solanki, R., 2011, Role of medicinal plants in wound healing. Res. J. Med. Plant. 5, 392-405. Orhan, I., Küpeli, E., Aslan, M., Kartal, M., Yesilada, E., 2006. Bioassay-guided evaluation of antiinflammatory and antinociceptive activities of pistachio, Pistacia vera L. J Ethnopharmacol. 105, 235-240. Oviedo-Chávez, I., Ramírez-Apan, T., Soto-Hernández, M., Martínez-Vázquez, M., 2004. Principles of the bark of Amphipterygium adstringens (Julianaceae) with anti-inflammatory activity. Phytomedicine.; 11, 436-45. Paraschos, S., Magiatis, P., Mitakou, S., Petraki, K., Kalliaropoulos, A., Maragkoudakis, P., Mentis, A., Sgouras, D., Skaltsounis, A.L., 2007. In vitro and in vivo activities of Chios mastic gum extracts and constituents against Helicobacter pylori. Antimicrob Agents Chemother. 51, 551-559. Rajaei, A., Barzegar, M., Mobarez, A.M., Sahari, M.A., Esfahani, Z.H., 2010. Antioxidant, antimicrobial and antimutagenicity activities of pistachio (Pistachia vera) green hull extract. Food. Chem. Toxicol. 48, 107-12. Rosas-Acevedo, H., Terrazas, T., González-Trujano, M.E., Guzmán, Y., Soto-Hernández, M., 2011. Anti-ulcer activity of Cyrtocarpa procera analogous to that of Amphipterygium adstringens, both assayed on the experimental gastric injury in rats. J Ethnopharmacol.134, 67-73.
22
Sarkhail, P., Salimi, M., Sarkheil, P. and Mostafapour Kandelous, H. 2017. Anti-melanogenic activity and cytotoxicity of Pistacia vera hull on human melanoma SKMEL-3 cells. Acta Med. Iran. 55, 422-428. Salas-Salvado´, J., Casas-Agustench, P., Salas-Huetos, A., 2011. Cultural and historical aspects of Mediterranean nuts with emphasis on their attributed healthy and nutritional properties. Nutr. Metab. Cardiovasc. Dis. 1, S1-S6. Sevimli-Gür, C., Onbaşılar, I., Atilla, P., Genç, R., Cakar, N., Deliloğlu-Gürhan, I., Bedir, E., 2011. In vitro growth stimulatory and in vivo wound healing studies on cycloartane-type saponins of Astragalus. J Ethnopharmacol. 134, 844-850. Shahouzehi, B., Sepehri, G., Sadeghiyan, S., Masoomi-Ardakani, Y., 2018. Effect of Pistacia atlantica resin oil on anti-oxidant, hydroxyprolin and VEGF changes in experimentallyinduced skin burn in rat. World. J. Plast. Surg. 7, 357-363. Shahouzehi, B., Sepehri, G., Sadeghiyan, S., Masoumi-Ardakani, y., 2019. Ameliorative effects of Pistacia atlantica resin oil on experimentally-induced skin burn in rat. R. J. P. 6, 29-34. Sorg, H., Tilkorn, D.J., Hager. S., Hauser. J., Mirastschijski, U., 2017. Skin Wound Healing: An Update on the Current Knowledge and Concepts. Eur Surg Res. 58, 81-94. Tan, W.S., Arulselvan, P., Ng, S.F., Mat Taib, C. N., Sarian, M.N., Fakurazi, S., 2019. Improvement of diabetic wound healing by topical application of Vicenin-2 hydrocolloid film on Sprague Dawley rats. BMC Complement Altern Med. 19(1):20. doi: 10.1186/s12906-018-2427-y.
23
Tsala, D.E., Amadou, D., Habtemariam, S., 2013. Natural wound healing and bioactive natural products. Phytopharmaco. 4, 532-560. Tomaino, A., Martorana, M., Arcoraci, T., Monteleone, D., Giovinazzo, C., Saija, A., 2010. Antioxidant activity and phenolic profile of pistachio (Pistacia vera L., variety Bronte) seeds and skins. Biochimie. 92, 1115-22. Tsokou, A., Georgopoulou, K., Melliou, E., Magiatis, P., Tsitsa, E., 2007. Composition and enantiomeric analysis of the essential oil of the fruits and the leaves of Pistacia vera from Greece. Molecules. 12, 1233-1239. Varzakas, T., Zakynthinos, G., Verpoort, F., 2016. Plant food residues as a source of nutraceuticals and functional foods. Foods. 5, 88-119. Wagner, W., Wehrmann, M., 2007. Differential cytokine activity and morphology during wound healing in the neonatal and adult rat skin. J Cell Mol Med 11, 1342-1351. Wang, Z., Wang, Y., Farhangfar, F., Zimmer, M., Zhang, Y., 2012. Enhanced keratinocyte proliferation and migration in co-culture with fibroblasts. PLoS ONE. 7(7) doi: 10.1371/journal.pone.0040951.e40951. Whitehouse, W.E., 1957. The pistachio nut a new crop for the Western United States. Econ. Bot. 11, 281-321. Werner, S., Grosse., R., 2003. Regulation of wound healing by growth factors and cytokines. Physiol Rev. 83, 835-870. Wu, X., Cao, W., Wang, X., Zhang, J., Lv, Z., Qin, X., Wu, Y., Chen, W., 2013. TGM3, a candidate tumor suppressor gene, contributes to human head and neck cancer. Mol Cancer. 12, 151. 24
Yayeh, T., Hong, M., Jia, Q., Lee, Y.C., Kim, H.J., Hyun, E., Kim, T.W., Rhee, M.H., 2012. Pistacia chinensis inhibits no production and upregulates ho-1 induction via pi-3k/akt pathway in lps stimulated macrophage cells. Am. J. Chin. Med. 40, 1085-1097.
25
Table 1. Primers of genes IL-6, TNF-α, NFκ-B1 and GAPDH for performing RT-PCR Gene name
Gene symbol
Glyceraldehyde-3phosphate dehydrogenase
Gapdh
Interleukin 6
IL-6
Accession
no.
NM_001289726.1
Primer sequence (5ʹʹ-3ʹʹ)
F: ATTGTTGCCATCAACGACCC R: ATGTTAGTGGGGTCTCGCTC
NM_001314054.1
F: AGTTGCCTTCTTGGGACTGA R: CAGGTCTGTTGGGAGTGGTA
Tumor necrosis factor
TNF-α
NM_001278601.1
F: CACCACGCTCTTCTGTCTAC R: GGTCTGGGCCATAGAACTGAT
Nuclear factor of kappa
NFκB1
NM_008689.2
F: ACAAAATGCCCCACGGTTAT R: GTGCGTGGCAACTACATTTC
1
Table 2. The yield of CHCl3, EtOAc and n-butanol fractions from P. vera L. hull total extract and their effects on fibroblast cell viability and migration.
Wound area Fraction
Weight (gr)
EC50 (µg/ml) (% of control)
CHCl3
1.05
0.02
50.63%**
EtOAc
1.23
0.04
84.1%
n-BuOH
0.72
0.2
65.1%*
*and **Significant differences from control at P<0.05 and P<0.01, respectively. Bars represent the mean ± S.E.M. of three experiments.
2
Table 3. The weight of sub-fractions from P. vera L. hull chloroform fraction and their effects on fibroblast cell viability and migration.
Wound area Sub-fraction
EC50 (µg/ml)
Weight (g)
(% of control) Fr1
0.076
6.44
91%
Fr2
0.040
169
32.8%***
Fr3
0.226
3.70
82.1%
Fr4
0.415
0.02
38.4%***
Fr5
0.116
0.2
99.9%
***Significant differences from control at P<0.05 and P<0.001, respectively. Bars represent the mean ± S.E.M. of three experiments.
3
MeOH 80% Extract Partitioning
CHCl3
EtOAc
n-BtOH
Fraction
Fraction
Fraction
Fr4
Fr5
Column chromatography
FrI
Fr2
Fr3
Plate chromatography
Fr4.I
Fr4.II
Fr4.III
NMR and Mass analysis
3-epimasticadienolic acid
Figure 1. Scheme for the bioassay-guided fractionation of P. vera L. hull total extract.
1
(a)
(b)
(c)
Control
CHCl3
EtOAc
n-BuOH
Figure 2. Effect of the fractions CHCl3, EtOAc and n-BuOH on viability NIH fibroblast cells using MTT assay (a). Qualitative (b) and quantitative (c) scratch-wound healing results of the fractions CHCl3, EtOAc and n-BuOH after 48 h on NIH fibroblast cells exposing to EC50 values. Images of the fields were collected by fluorescence microscopy (magnification ×20) and analyzed with ImageJ software. *, **and ***Significant differences from control at P<0.05, P<0.01 and P<0.001, respectively. Bars represent the mean ± S.E.M. of three experiments. 2
(a)
(b) Control
Fr1
Fr2
Fr3
Fr4
Fr5
3
(c)
Figure 3. Effect of the sub-fractions (Fr1-Fr5) on viability NIH fibroblast cells using MTT assay (a). Qualitative (b) and quantitative (c) scratch-wound healing results of the sub-fractions (Fr1Fr5) after 48 h on NIH fibroblast cells exposing to EC50 values (b). Images of the fields were collected by fluorescence microscopy (magnification ×20) and analyzed with ImageJ software. *and ***Significant differences from control at P<0.05 and P<0.001, respectively and ##
P<0.01,###P<0.001 vs control. Bars represent the mean ± S.E.M. of three experiments.
4
a
b
c
Figure 4. Silica thin-layer chromatographic (TLC) profile of sub-fractions from Fr1 to Fr5 developed in hexane: ethyl acetate (3:1, v/v), the spots were visualized under UV light (a) 254 and (b) 366 nm and then (c) by spraying with vanillin/H2SO4 solution 1% (w/v) reagent after heating at 120 °C. The purple color formation displayed the presence of triterpenoids.
5
(a)
(b)
Control
Fr4.I
Fr4.II
Fr4.III
( c)
6
Figure 5. Effect of the sub-fractions (Fr4.I to Fr4.II) on viability NIH fibroblast cells using MTT assay (a). Qualitative (a) and quantitative (b) scratch-wound healing assay results after 48 h on NIH fibroblast cells exposing to EC50 of the sub-fractions (Fr4.I to Fr4.II). Images of the fields were collected by fluorescence microscopy (magnification ×20) and analyzed with ImageJ software. *and **Significant differences from control at P<0.05 and P<0.01, respectively. Bars represent the mean ± S.E.M. of three experiments.
7
Figure 6. Chemical structure of 3-epimasticadienolic acid
8
(a) Control (100)
Allantoin (77.9%)
0.2 µg/ml (100.1%)
2 µg/ml (88%)
20 µg/ml (85.7%)
200 µg/ml (55.2%)
(b)
Figure 7. Qualitative (a) and quantitative (b) scratch-wound healing assay results after 48 h on NIH fibroblast cells exposing to EC50 of 3-epimasticadienolic acid (0.2-200 µg/ml). Images of the fields were collected by fluorescence microscopy (magnification ×20) and analyzed with ImageJ software. *and ***Significant differences from control at P<0.05 and P<0.001,
9
respectively.
##
P<0.01 compare with allantoin. Bars represent the mean ± S.E.M. of three
experiments.
10
(a) Unstained cells
Untreated cells
Positive Control (Allantoin)
Negative Control (Mitomycin c)
Cells treated with compound
(b) Groups
Untreated
Percentage of parental generation
39.4%
Negative Control (Mitomycin C) 42.7%
Positive Control (Allantoin) 23.2%
Cells treated with active compound
Percentage of Generations 1 to 6
60.6%
57.3%
76.8%
75.4%
Proliferation Index
1.36
1.17
1.46
1.41
24.6%
Figure 8. Impact of the active compound (3α-HMA) on the cell proliferation was assessed by flow cytometry. NIH/3T3 fibroblast cells were labeled with CFSE and cultured in the absence and presence of 3α-HMA (200 µg/ml), allantoein (50µg/ml) and mitomycin c (5 µg/ml). The histogram shows the proliferation activity of these samples on 5 days (a). Percentage of parental 11
generation, percentage of generations 1 to 6 and proliferation index due to untreated and treated cells with 3α-HMA (200 µg/ml), allantoein (50µg/ml) and mitomycin c (5 µg/ml) on 5 days (b).
12
Relative gen
Groups
expression Control
Allantoin
3α-HMA
IL-6
1 ± 0.045
0.54 ± 0.043
0.86 ± 0.023
TNF-α
1 ± 0.045
0.42 ± 0.037
0.54 ± 0.0123
NF-κB1
1 ± 0.045
2.38 ± 0.065
1.52 ± 0.0753
Figure 9. Effect of the active compound (3α-HMA) on gene expression level of IL-6, TNF-α and NF-κB1. The relative expression of IL-6, TNF-α and NF-κB1 genes was normalized against the expression level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene. *and ***Significant differences from control at P<0.05 and P<0.001, respectively. Bars represent the mean ± S.E.M. of three experiments.
13