- Email: [email protected]
Biocatalytic and antibacterial visualization of green synthesized silver nanoparticles using Hemidesmus indicus
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54
YMPAT1597_proof ■ 20 March 2015 ■ 1/7
Microbial Pathogenesis xxx (2015) 1e7
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
Q6
Biocatalytic and bactericidal interaction visualization of green synthesized silver nanoparticles using Hemidesmus indicus
Q5
M. Latha a, M. Sumathi a, R. Manikandan b, A. Arumugam c, N.M. Prabhu a, * a
Q1
Department of Animal Health and Management, Alagappa University, Karaikudi 630 004, India Department of Zoology, Madras University, Chennai, India c Department of Nanoscience and Technology, Alagappa University, Karaikudi 630 004, India b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 2 January 2015 Received in revised form 4 March 2015 Accepted 11 March 2015 Available online xxx
In the present investigation, we described the green synthesis of silver nanoparticles using plant leaf extract of Hemidesmus indicus. The synthesized silver nanoparticles were characterized by UVevisible spectroscopy, fourier transform infra-red spectroscopy (FTIR), X-ray diffraction (XRD), transmission electron microscopy (TEM) and energy dispersive X-ray spectroscopy (EDX). TEM images proved that the synthesized silver nanoparticles were spherical in shape with an average particle size of 25.24 nm. To evaluate antibacterial efficacy, bacteria was isolated from poultry gut and subjected to 16S rRNA characterization and confirmed as Shigella sonnei. The in vitro antibacterial efficacy of synthesized silver nanoparticles was studied by agar bioassay, well diffusion and confocal laser scanning microscopy (CLSM) assay. The H. indicus mediated synthesis of silver nanoparticles shows rapid synthesis and higher inhibitory activity (34 mm) against isolated bacteria S. sonnei at 40 mg/ml. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Hemidesmus indicus Silver nanoparticles Shigella sonnei Biosynthesis CLSM
1. Introduction Interdisciplinary research has widened the horizons of material research drawing new inspirations from biological systems. The immense environmental concerns had triggered the researchers to device novel methods of synthesizing the nanomaterials in biological system using plant [1,2] bacteria [3,4] fungi [5,6]. Green synthesis of nanoparticles required for various industrial applications [7,8]. It has been known that silver and its compound have broad spectrum of antibacterial activities [9,10] and exhibit low toxicity against human [11]. Silver particles can provide a large reservoir of silver ions that can be released gradually and result in long-term antimicrobial activity [12]. Previous studies have shown that nanoparticles could be used as bactericidal materials [13] and highly reactive metal oxide nanoparticles display an excellent antibacterial activity against gram positive and gram negative bacteria [14]. Poultry is one of the fast growing segments of the agricultural sector in India due to technology innovation in intensive culture practices and health management. Factors like high stocking
* Corresponding author. Department of Animal Health and Management, Alagappa University, Karaikudi 630 003, Tamil Nadu, India. E-mail address: [email protected] (N.M. Prabhu).
density, mismanagement during production, sudden changes in climatic condition may create stress to the birds and cause disease. Due to the outbreak of various infectious diseases caused by pathogenic bacteria and the development of antibiotic resistance to the particular pathogen, researchers and farmers are searching for new antibiotic to overcome this problem [15,16]. Shigella sonnei is a non-motile, nonspore-forming and facultative anaerobic gramnegative bacterium. In poultry industry this S. sonnei may transmit the disease due to sanitary issue. Similarly, this bacterium cause enteric infectious disease called shigellosis and threat to public health in many developed countries. Several plant based derivatives, feed additives, probiotics and prebiotics are used to control the bacterial disease in poultry production. However, this industry requirement is not fulfilled. More than hundreds of plant genera have been used as a vital source of powerful drugs [17]. Hemidesmus indicus L. (Asclepiadaceae) is a twining shrub used as folk medicine and an ingredient in Ayurvedic and Unani preparations, known as Indian Sarsaparilla (English). This plant has been used traditionally to treat blood disorders, low digestion, anorexia, diarrhoea, asthma, fever, cough, itching and skin diseases including leprosy [18]. Similarly the extract of H. indicus L. has been shown to possess antitumor, antiinflammatory, antioxidant, antimicrobial, hepatoprotective, nephroprotective [19,20] and neutralization of viper venom [21]. Hence,
http://dx.doi.org/10.1016/j.micpath.2015.03.008 0882-4010/© 2015 Elsevier Ltd. All rights reserved.
Please cite this article in press as: M. Latha, et al., Biocatalytic and bactericidal interaction visualization of green synthesized silver nanoparticles using Hemidesmus indicus, Microbial Pathogenesis (2015), http://dx.doi.org/10.1016/j.micpath.2015.03.008
55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YMPAT1597_proof ■ 20 March 2015 ■ 2/7
2
M. Latha et al. / Microbial Pathogenesis xxx (2015) 1e7
the present study was aimed to synthesis of silver nanoparticles using aqueous plant leaf extract of H. indicus and evaluates its antibacterial activity against isolated bacterium S. sonnei from broiler chicken. 2. Materials and methods 2.1. Chemicals and bacteriological medium The silver nitrate (AgNO3), bacterial media and other components used in this experiment were purchased from Hi Media (Mumbai, India). 2.2. Plant collection H. indicus plant leaves were collected from Karaikudi Tamilnadu, India and identified with the help of authenticated field botanist, Alagappa University, Karaikudi.
2.6. Isolation and identification of bacteria Unhealthy bird's gut and liver samples were sourced from slaughter house, Karaikudi, Sivaganga district, India. Gut samples were packed in sterile container and transferred immediately to the laboratory for the bacterial isolation. The samples were homogenized with sterile distilled water. The homogenized material was serially diluted up to 105 CFU/ml, 0.1 ml of homogenized sample was spread on Shigella specific media (Xylose-Lysine Deoxycholate Agar). Purification and identification of isolates were done using biochemical tests by following standard methods [22] and confirmed as Shigella. The DNA of bacterial strain was extracted by alkaline lysis method [23]. A complete 16S rRNA was amplified by using universal primers, namely forward primer 50 AGAGTTTGATCCTGGCTCAG 30 and reverse primer - 50 TACGGCTACCTTG TTACGACTT 30 [24]. The PCR product of 16S rRNA of the isolates was sequenced with primer set 518F-50 CCAGCAGCCGCGGTAATACG 30 and 800R-50 TACCAGGGTATCTAATCC 30 . Further comparison was made with previously available sequences in NCBI (National Center for Biotechnology Information) using BLAST (Blast Local Alignment Search Tool).
2.3. Preparation of aqueous extracts 2.7. Antibacterial activity of green synthesized silver nanoparticles 1.4 g of fresh leaves were rinsed thoroughly with double distilled water and cut into fine pieces. The air-dried leaves were mixed with 70 ml of double distilled water and kept in boiling water bath at 60 C for 5 min. After cooling the clear leaf broth were filtered with whatman No 1 filter paper and used for further experiments. 2.4. Green synthesis of silver nanoparticles using H. indicus leaf extract 15 ml of clear H. indicus leaf broth was added into the aqueous solution of AgNO3 (0.75 mM) and the reaction mixture was incubated at room temperature in dark condition until colour change. After the reduction of silver ions (colour change) the broth containing silver nanoparticles was centrifuged at 10,000 rpm for 15 min and repeated for three times to ensure better separation of free entities from the metal nanoparticles. 2.5. Characterization of green synthesized silver nanoparticles The reduction of pure Agþ ions was observed periodically (0e3 h) by using UVevis spectroscopy at 250e700 nm (Shimadzu UV-1800, Japan) and H. indicus leaf extract without adding the silver nitrate was used as a control. The FTIR was performed to find out the presence of bio molecules in the extract. The leaf extract was exposed before and after adding the aqueous silver nitrate solution. The samples were mixed with KBr to make a pellet and subjected to FTIR analysis in the thermo scientific Nicolet 380 FTIR spectroscopy. To obtain good signal to noise ratio, 256 scans of silver nanoparticles were taken at the range of 400e4000 cm1 and the resolution was kept as 4 cm1. In order to determine the nature of particles, the freeze dried nanoparticles powder sample was subjected to XRD analysis (X’PERT- PRO.PAN analytical Netherland) operating in transmission mode at 40 kV and 30 mA with Cu K radiation. The size and morphological analysis of the synthesized nanoparticles was done with transmission electron microscopy (TEM) by loading a small volume of AgNPs on cabon-coated copper grids and measured on Technite 10 Philips instrument with an accelerating voltage of 80 Kv. In order to characterize the intermediate compounds, energy dispersive X-ray spectroscopy (Hitachi S3000H) was performed.
The antibacterial activity of green synthesized silver nanoparticles was determined by agar bioassay [25] and well diffusion method [26]. The isolated bacterium was pre-grown in nutrient broth at 37 C for 24 h 100 ml of isolated S. sonnei cells was inoculated at the density of 105 on Muller Hinton Agar medium and different concentration of silver nanoparticles (10, 20, 30, and 40 mg/ml) were poured into petridishes for agar bioassay and well diffusion method. Positive and negative control was also used in this study for comparison and all the plates were incubated at 37 C for 24 h. 2.8. Confocal laser scanning microscopic (CLSM) analysis Further, the effect of green synthesized silver nanoparticles were studied under CLSM (Model: LSM 710, Carl Zeiss, Germany), microscopy. The standard methods slightly modified [27] was to analysis the bacterial interaction with silver nanoparticles in CLSM. In control, 0.5 ml of double distilled water was added to S. sonnei instead of nanoparticles and four different concentrations of nanoparticle samples were added to the bacterial suspension (10, 20, 30 and 40 mg/ml) and incubated for 24 h, then these samples were centrifuged at 5000 rpm for 5 min. The supernatant of these samples were discarded and remaining bacterial pellets were suspended in 0.5 ml prepared fluorescent marker solution (Acridine orange 1 ml and 1 ml of PBS). After 15 min of incubation samples were centrifuged at 5000 rpm for 5 min and the obtained pellet was suspended in 200 ml PBS to remove the excess dye. In the control sample, except the incubation of nanoparticles, all other procedures were followed. One drop of thoroughly stirred sample was placed on glass slide, covered with a cover slip and observed under 40 magnifications in CLSM. The results were processed using Zen 2009 image software. 3. Results and discussion Green synthesized nanoparticles can act as antibacterial agents, due to their ability to interact with bacteria. For this reason, it has been received considerable attention to develop clean and nontoxic eco friendly materials. H. Indicus is easily available plant in India, used for making nannari syrup and folk medicine. Hence, this food based plant was used for bio reduction of AgNO3 to produce good
Please cite this article in press as: M. Latha, et al., Biocatalytic and bactericidal interaction visualization of green synthesized silver nanoparticles using Hemidesmus indicus, Microbial Pathogenesis (2015), http://dx.doi.org/10.1016/j.micpath.2015.03.008
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YMPAT1597_proof ■ 20 March 2015 ■ 3/7
M. Latha et al. / Microbial Pathogenesis xxx (2015) 1e7
3
bactericidal agent for the application in the poultry industry. 3.1. Synthesis of silver nanoparticles The plant extracts are widely being applied to synthesize AgNPs by reducing Agþ ions into Ag which increase the optical density of the solution [28]. The reaction was started after the leaf extract was introduced into 0.75 mM aqueous (AgNO3) solution. After 24 h of incubation in dark room, the colourless AgNO3 solution turned into dark brown which indicated the formation of AgNPs. It is well known that the silver nanoparticles exhibit reddish brown colour in aqueous solution due to excitation of surface plasmon resonance and reduction of AgNO3 [29e31]. Furthermore, the intensity of colour change is direct proportion to the incubation period of nanoparticle synthesis. 3.2. Characterization of green synthesized silver nanoparticles In order to verify the green synthesis of silver nanoparticles the samples were subjected to the UVevis spectra analysis. The absorption spectra of silver nanoparticles formed in the reaction media showed strong absorbance peak at 430 nm and within three hour the peak length was reduced and saturation phase was obtained (Fig 1). A variation in the biological material and metal salt concentration is known to influence NP synthesis [32] and silver nanoparticles exhibit unique and tuneable optical properties on account of their SPR, extremely sensitive to the nature, size distribution and shape of the nanoparticles. The FTIR spectroscopy results of plant aqueous extract showed (Fig. 2a (A)) strong bands at 3424 cm1 (OeH stretch), 2924, 2853 cm1 (CeH stretch), 1622 cm1 (-C]O stretch), 1457, 1405 cm1 (CeC stretch) and 1047 cm1 (CeN stretch). However AgNPs synthesized using H. indicus showed (Fig. 2a (B)) strong bands at 3447 cm1 (OeH stretch), 2924, 2853 cm1 (CeH stretch), 1622 cm1(eC]O stretch), and 1047, 1120 cm1 (CeN stretch). While comparing the FTIR spectrum of plant aqueous extract Fig. 2a (A) and AgNPs only minor changes Fig. 2a (B) were observed. The peak at 3424 cm1 corresponding stretching vibrations of hydroxyl groups of H. indicus plant leaf extract moves to lower wavelength 3447 cm1 which indicates the binding of silver nanoparticles on the surface. The peak at 1622 cm1 shifted to higher wavelength
Fig. 1. UVeVisible spectra of silver nanoparticles synthesized using H. Indicus leaf extracts at different time intervals. The figure insert shows the synthesis of silver nanoparticles.
Fig. 2. a. (A) FTIR spectrum of H. Indicus leaf extracts (B) synthesized silver nanoparticles, b. XRD spectrum of silver nanoparticles synthesized from leaf extract of H. indicus.
(1654 cm1) which indicates the reduction of Agþ ions into Ag nanoparticles. XRD spectrum of results showed four different diffractions peak at 38.1, 44.44 , 64.46 and 77, the lattice plane value was observed which may indexed at (1 1 1), (2 0 0), (2 2 0) and (3 11) of the fcc silver. The resultant data was matched with the data base (JCPDS file no.04e0783). Therefore, based on the XRD patterns it was confirmed that the synthesized AgNPs from leaf extract of H. indicus are crystalline in nature (Fig. 2b). Debye e Scherrer's equation was used to calculate the mean size of AgNPs using the FWHM (full-width (at) half-maximum (height) values at the (111) plane, which showed that the size of the synthesized AgNPs were in the range of 25.24 nm. This was strongly proved in TEM micrograph image. The green synthesized silver nanoparticles using the plant extract of H. indicus structure morphology were confirmed by TEM micrograph images. The TEM images were recorded at different magnification to find the individual particles. The typical TEM image of the green synthesized AgNPs are shown in Fig. 3a. According to the transmission electron micrograph, the morphology of the AgNPs was approximately spherical in shape and mostly aggregated and few individual particles were present. The size of the synthesized silver nanoparticles varied between of 19.91 nme47.60 nm and the
Please cite this article in press as: M. Latha, et al., Biocatalytic and bactericidal interaction visualization of green synthesized silver nanoparticles using Hemidesmus indicus, Microbial Pathogenesis (2015), http://dx.doi.org/10.1016/j.micpath.2015.03.008
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YMPAT1597_proof ■ 20 March 2015 ■ 4/7
4
M. Latha et al. / Microbial Pathogenesis xxx (2015) 1e7
confirmed as Shigella spp by biochemical assay (data not shown). Further, based on the inhibitory activity (in vitro analysis) of these three isolates one strain was selected (data not shown) for 16S rRNA characterization and confirmed as S. sonnei showing similarity of base pair (99%) with the sequence NR 074894.1 (S. sonnei strain SSE10) by BLAST analysis in NCBI database. The nucleotide sequence of S. sonnei strain SSE10 was submitted in the NCBI BankIt (Acc. No: KF769531.1) and this strain was taken for further studies (See Table 1). Q2 3.4. Antibacterial activity of green synthesized silver nanoparticles
Fig. 3. a. Transmission electron microscopy (TEM) analysis of silver nanoparticles ranged between 19.91 and 47.6 nm, b. Energy dispersive X-ray (EDX) spectrum of silver nanoparticles using H. indicus.
average size was 25.24 nm. The variation in the particles sizes may be due to the formation of nanoparticles at different time intervals [33]. An elemental composition analysis of EDX showed the presence of a strong signal from silver atoms (Fig. 3b). Moreover, the presence of sharp optical absorption peak at the range of 3e4 keV which is typical for the absorption of metallic silver nano crystallites. This analysis result indicated that the nano-structures were composed solely of silver. However, there were other EDX peaks for Si, Cl and O, suggested that they were mixed precipitates from the centrifuged. The result of AgNPs clearly shows the character of nanoparticles and confirms the green synthesis of silver nanoparticles. 3.3. Isolation and identification of S. sonnei S. sonnei spreads through contaminated feeds, water and infected animals. Further, an extensive and repeated mixing of poultry stocks may favoured the spreading of this bacterial infection. A total of 40 bacterial strains were isolated from gut and liver of unhealthy broiler chicken, out of these three strains were
The foremost objective of the present study is to understand the antibacterial efficacy of AgNPs against gram negative bacteria of S. sonnei isolated from the poultry broiler. In earlier reports, the negatively charged bacterial cells may attract positively charged nanoparticles and interact with building elements of the bacterial membrane, which may cause structural changes, degradation and finally cell death [25]. It is also believed that DNA loses its replication ability and cellular proteins become inactivated on Agþ [34]. In the present study, the green synthesized silver nanoparticles showed excellent antibacterial activity against isolated bacteria S. sonnei. The results of agar bioassay and well diffusion assay are presented in the Figs. 4 and 5, the green synthesized silver nanoparticles using H. indicus leaf extract showed highest inhibition activity against the S. sonnei isolated from the poultry gut at 40 mg/ ml. In agar bioassay the bacterial colonies were reduced with the increase in the concentration of AgNPs and 34 mm zone of inhibition was recorded in well diffusion assay. Almost no growth of bacterial colonies was observed in the silver and crude extract of H. indicus. The particle size of the synthesized nanoparticles comparatively smaller in size (25.24). This makes them easier to adhere with the cell wall of the bacterium causing disturbance and leads to death of the cells. Further, the antibacterial activities of silver nanoparticles may also influenced by the dimensions of the particles [34]. It was also assumed that AgNPs may break the barrier of outer membrane permeability and destroyed the respiratory cycle. Similarly, Holt and Barder reported that, Agþ inhibits the reparatory cycle of E. coli [35]. The small size and morphology surface planar accessibility of the AgNPs indicates its efficient antibacterial potential [13]. 3.5. Confocal laser scanning microscopic (CLSM) bacterial analysis CLSM image analysis of the bacterial isolates S. sonnei with
Table 1 Physical and biochemical characterization of Shigella spp. Physical Characterization Cell Shape Gram Reaction Spore Position Motility Biochemical Characterization Catalase Oxidase Methyl red Voges Proskauer test Mannitol Fermentaion Xylose Glucose (acid) Glucose (gas) Mannose Lactose Sucrose
Rod shape Gram Negative Non spore farming Non motile þve ve þve ve þve þve þve ve þve ve ve
þ / Positive Reaction. / Negative Reaction.
Please cite this article in press as: M. Latha, et al., Biocatalytic and bactericidal interaction visualization of green synthesized silver nanoparticles using Hemidesmus indicus, Microbial Pathogenesis (2015), http://dx.doi.org/10.1016/j.micpath.2015.03.008
Q4
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YMPAT1597_proof ■ 20 March 2015 ■ 5/7
M. Latha et al. / Microbial Pathogenesis xxx (2015) 1e7
5
Fig. 4. A) Agar bioassay of green synthesized silver nanoparticles using H. indicus at different concentration of silver nanoparticles (a) Control (b) AgNPs mg/ml, (c) 10 mg/ml, (d) 20 mg/ml, (e) 30 mg/ml and (f) 40 mg/ml. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Fig. 5. Assay.1: Agar well diffusion assay of H. Indicus leaf extract, bacterial culture, AgNO3, AgNPs (i) Graph (ii) Plate.Assay. 2: Agar well diffusion assay of green synthesized silver nanoparticles using H. indicus at different concentration of silver nanoparticles with 10 mg/ml, 20 mg/ml, 30 mg/ml, 40 mg/ml and 50 mg/ml (iii) Graph (iv) Plate. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
different concentration of silver nanoparticles was performed to examine the bacterial interaction with AgNPs. Interestingly, the bacterial growth of S. sonnei was reduced with increase in the concentrations of silver nanoparticles (10, 20, 30 and 40 mg/ml). In control, the growth and number of cells were numerous when compared with test experiments (Fig. 6). Thus, the CLSM bacterial study confirmed that the green synthesised silver nanoparticles using H. indicus leaf extract have excellent antibacterial activity against S. sonnei isolated from poultry birds. However,
future studies on the biocide influence of this AgNPs on pathogenic bacteria are necessary in order to fully evaluate its possible use as a new bactericidal material at commercial scale (See Table 2). 4. Conclusion In conclusion, the bio-reduction of aqueous Agþ ions by the leaf extract of H. indicus plant has been demonstrated. This work,
Please cite this article in press as: M. Latha, et al., Biocatalytic and bactericidal interaction visualization of green synthesized silver nanoparticles using Hemidesmus indicus, Microbial Pathogenesis (2015), http://dx.doi.org/10.1016/j.micpath.2015.03.008
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YMPAT1597_proof ■ 20 March 2015 ■ 6/7
6
M. Latha et al. / Microbial Pathogenesis xxx (2015) 1e7
Fig. 6. Confocal laser scanning microscopy antibacterial activity of green synthesized silver nanoparticles using H. indicus at different concentration (a) 0 mg/ml (b) 10 mg/ml, (c) 20 mg/ml, (d) 30 mg/ml and (e) 40 mg/ml. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.) Table 2 In vitro analysis of green synthesized silver nanoparticles against Shigella spp isolated from poultry gut. Shigella spp Agar bioassay (mg/ml) 1 2 3 Well diffusion assay (mg/ml) 1 2 3
Control
10
+++++ +++ +++++ +++ +++++ +++ Measurements of zone of inhibition (mm) None 13 ± 0.2 mm None 15 ± 0.2 mm None 21 ± 0.2 mm
20
30
40
++ ++ ++
+ + +
19 ± 0.2 mm 21 ± 0.2 mm 26 ± 0.2 mm
21 ± 0.2 mm 25 ± 0.2 mm 29 ± 0.2 mm
25 ± 0.2 mm 29 ± 0.2 mm 34 ± 0.2 mm
+ / Presence of bacterial growth. / Absence of bacterial growth.
integrates nanotechnology and bacteriology leading to possible advancement in the formulation of new type of bactericides. The average size and shape of the nanoparticles were 25.24 nm and spherical in shape respectively. The present study confirmed the antibacterial efficacy of green synthesis of silver nanoparticles using H. indicus against S. sonnei isolated from gut of poultry (broiler) chicken. The AgNPs shows higher inhibition of 34 mm at 40 ml/ml in well diffusion assay and bacterial inhibition activities was further confirmed by CLSM image. Hence, this AgNPs may be effectively used as a bactericide. Moreover synthesis of silver nanoparticles using H. indicus plant extract was the eco-friendly method compare to the chemical and physical synthesis and this may be effectively used as an alternative to antibiotics in poultry industry. However the risk aspects for the large scale application should be strengthened in future studies.
INSPIRE Fellowship/2011/[2], dated 26.09.2011), Department of Physics, Alagappa University, Karaikudi, for their help in X-ray diffraction spectrum analysis. References [1] [2] [3] [4] [5] [6] [7] [8]
Acknowledgement
[9] [10]
The authors are grateful to DST-INSPIRE, Department of Science and Technology, New Delhi for the Research Fellowships (DST/
[11] [12] [13]
R.G. Haverkamp, A.T. Maeshell, J. Nanopart. Rws. 11 (2009) 1453e1464. A. Leela, M. Vivekanandan, Afr. J. Biotechnol. 7 (2008) 3162e3165. N. Saifuddin, C.W. Wong, A.A. Nuryasumira, Eur. J. Chem. 6 (2009) 61e70. A.R. Shahverdi, S. Minaeian, H.R. Shahverdi, H. Jamalifar, A.A. Nohi, Process. Biochem. 42 (2007) 919e923. R. Varshney, A.N. Mishra, S. Bhadauria, M.S. Gaur, Dig. J. Nanomater. Biostruct 4 (2009) 349e355. N. Duran, P.D. Marcato, G.I.H. De souza, O.L. Alves, E. Esposito, J. Biomed. Nanotechnol. 3 (2009) 1e8. S.S. Shankar, A. Ahmad, R. Parischa, M. Sastry, J. Mater. Chem. 13 (2003) 1822e1826. S.S. Shankar, A. Rai, B. Ankamwar, A. Singh, A. Ahmad, M. Sastry, Nat. Mater. 3 (2004) 482e488. K.H. Cho, J.E. Park, T. Osaka, S.G. Park, Electrochim. Acta 51 (2005) 956e960. C.N. Lok, C.M. Ho, R. Chen, Q.Y. He, W.Y. Yu, H. Sun, P.K. Tam, J.F. Chiu, C.M. Chen, J. Proteome Res. 5 (2006) 916e924. S. Silver, Microbiol. Rev. 27 (2003) 341e353. C. Damm, H. Munstedt, A. Rosch, J. Mater. Sci. 42 (2007) 6067e6073. S. Pal, Y.K. Tak, J.M. Song, Appl. Environ. Microbiol. 73 (2007) 1712e2172. Q3
Please cite this article in press as: M. Latha, et al., Biocatalytic and bactericidal interaction visualization of green synthesized silver nanoparticles using Hemidesmus indicus, Microbial Pathogenesis (2015), http://dx.doi.org/10.1016/j.micpath.2015.03.008
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
YMPAT1597_proof ■ 20 March 2015 ■ 7/7
M. Latha et al. / Microbial Pathogenesis xxx (2015) 1e7 [14] E. Bae, H.J. Park, J. Lee, Y. Kim, J. Yoon, K. Park, K. Choi, J. Yi, Envriron. Toxicol. Chem. 29 (2010) 2154e2160. [15] J.R. Morones, J.L. Elechiguerra, A. Camacho, K. Holt, J.B. Kouri, J.T. Ramirez, M.J. Yacaman, Nanotechnology 16 (2005) 2346e2353. [16] J.S. Kim, E. Kuk, K.N. Kim, J.H. Yu, S.J. Park, H.J. Lee, Y.K. Kim, S.H. Park, H.P. Yong, C.Y. Hwang, Y.K. Kim, Y.S. Lee, D.H. Jeong, M.H. Cho, Nanomed. Nanotechnol. Biol. Med. 3 (2007) 95e101. [17] S.H. Ahmed, G.F. Koob, Science 282 (1998) 298e300. [18] J. Anjaria, M. Parabia, G. Bhatt, R. Khamar, Nature, Heals, a Glossary of Selecyed Indiagenous Medicinal Plants of India, Sristi Innovation, Ahmedabad, 2002. [19] M.S. Kotnis, P. Patel, S.N. Menon, R.T. Sane, Nephrol. Carlt. 9 (2004) 142e152. [20] S. Qureshi, M.K. Rai, S.C. Agrawal, Hindustan Antibiot. Bull. 39 (1997) 56e60. [21] M.I. Alam, B. Audpy, A. Gomes, Phytother. Res. 10 (1996) 58e61. [22] J.G. Holt, N.R. Krieg, P.H.A. Sneath, J.T. Staley, S.T. Williams, Bergey's Manual of Determinative Bacteriology, ninth ed., the Wiiams and Wikins Company, Baltimore, MD, USA, 1994. [23] F.M. Ausubel, R. Brend, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, K. Struhi, Current Protocols in Molecular Biology, vol. 1, Greene Publishing Associates and Wiley- Interscience, New York, 1990.
7
[24] G. Andrew, S. Henderson, W. Hall, Br. J. psychiatry 178 (2001) 145e153. [25] S. Ivan, S.S. Branka, J. Colloid Interface Sci. 275 (2004) 177e182. [26] H. Mette, B. Oivind, R. Ana, N. Janne, M. Jette, J. Sigmund, D. Haze, A. peter, B. Harry, G. Lone, Syst. Appl. Microbiol. 27 (2004) 360e371. [27] E. Sawosz, A. Chwalibog, J. Szeliga, F. Sawosz, M. Grodzik, M. Rupiewicz, T. Niemiec, K. Kacprzyk, Int. J. Nanomed. 5 (2010) 631e637. [28] J.Y. Song, B.S. Kim, Bioprocess. Biosyst. Eng. 32 (2009) 79e84. [29] S.S. Shankar, A. Rai, A. Ahmad, M. Sastry, J. Colloid Interface Sci. 275 (2004) 496e502. [30] P. Mulvaney, Langmuir 12 (1996) 788e800. [31] A. Ahmad, P. Mukherjee, S. Senapati, D. Mandal, M. Islam Khan, R. Kumar, M. Sastry, Colloids. Surf. B 28 (2003) 313e318. [32] P.S. Pimprikar, S.S. Joshi, A.R. Kumar, S.S. Zinjarde, S.K. Kulkarani, Colloids. Surf. B 74 (2009) 309e316. [33] J. Kasthuri, K. Kathiravan, N. Rajendiran, J. Nanopart. Res. 11 (2009) 1075e1085. [34] Q.L. Feng, J. Wu, G.Q. Chen, F.Z. Cui, T.M. Kim, J.O.J. Kim, Biomed. Mater. Res. 52 (2000) 662e668. [35] S. Kaviya, J. Santhanalakshmi, B. Viswanathan, J. Nanotechnol. (2011) http:// dx.doi.org/10.1155/2011/152970.
Please cite this article in press as: M. Latha, et al., Biocatalytic and bactericidal interaction visualization of green synthesized silver nanoparticles using Hemidesmus indicus, Microbial Pathogenesis (2015), http://dx.doi.org/10.1016/j.micpath.2015.03.008
18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34
YMPAT1597_proof ■ 20 March 2015 ■ 1/7
Microbial Pathogenesis xxx (2015) 1e7
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
Q6
Biocatalytic and bactericidal interaction visualization of green synthesized silver nanoparticles using Hemidesmus indicus
Q5
M. Latha a, M. Sumathi a, R. Manikandan b, A. Arumugam c, N.M. Prabhu a, * a
Q1
Department of Animal Health and Management, Alagappa University, Karaikudi 630 004, India Department of Zoology, Madras University, Chennai, India c Department of Nanoscience and Technology, Alagappa University, Karaikudi 630 004, India b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 2 January 2015 Received in revised form 4 March 2015 Accepted 11 March 2015 Available online xxx
In the present investigation, we described the green synthesis of silver nanoparticles using plant leaf extract of Hemidesmus indicus. The synthesized silver nanoparticles were characterized by UVevisible spectroscopy, fourier transform infra-red spectroscopy (FTIR), X-ray diffraction (XRD), transmission electron microscopy (TEM) and energy dispersive X-ray spectroscopy (EDX). TEM images proved that the synthesized silver nanoparticles were spherical in shape with an average particle size of 25.24 nm. To evaluate antibacterial efficacy, bacteria was isolated from poultry gut and subjected to 16S rRNA characterization and confirmed as Shigella sonnei. The in vitro antibacterial efficacy of synthesized silver nanoparticles was studied by agar bioassay, well diffusion and confocal laser scanning microscopy (CLSM) assay. The H. indicus mediated synthesis of silver nanoparticles shows rapid synthesis and higher inhibitory activity (34 mm) against isolated bacteria S. sonnei at 40 mg/ml. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Hemidesmus indicus Silver nanoparticles Shigella sonnei Biosynthesis CLSM
1. Introduction Interdisciplinary research has widened the horizons of material research drawing new inspirations from biological systems. The immense environmental concerns had triggered the researchers to device novel methods of synthesizing the nanomaterials in biological system using plant [1,2] bacteria [3,4] fungi [5,6]. Green synthesis of nanoparticles required for various industrial applications [7,8]. It has been known that silver and its compound have broad spectrum of antibacterial activities [9,10] and exhibit low toxicity against human [11]. Silver particles can provide a large reservoir of silver ions that can be released gradually and result in long-term antimicrobial activity [12]. Previous studies have shown that nanoparticles could be used as bactericidal materials [13] and highly reactive metal oxide nanoparticles display an excellent antibacterial activity against gram positive and gram negative bacteria [14]. Poultry is one of the fast growing segments of the agricultural sector in India due to technology innovation in intensive culture practices and health management. Factors like high stocking
* Corresponding author. Department of Animal Health and Management, Alagappa University, Karaikudi 630 003, Tamil Nadu, India. E-mail address: [email protected] (N.M. Prabhu).
density, mismanagement during production, sudden changes in climatic condition may create stress to the birds and cause disease. Due to the outbreak of various infectious diseases caused by pathogenic bacteria and the development of antibiotic resistance to the particular pathogen, researchers and farmers are searching for new antibiotic to overcome this problem [15,16]. Shigella sonnei is a non-motile, nonspore-forming and facultative anaerobic gramnegative bacterium. In poultry industry this S. sonnei may transmit the disease due to sanitary issue. Similarly, this bacterium cause enteric infectious disease called shigellosis and threat to public health in many developed countries. Several plant based derivatives, feed additives, probiotics and prebiotics are used to control the bacterial disease in poultry production. However, this industry requirement is not fulfilled. More than hundreds of plant genera have been used as a vital source of powerful drugs [17]. Hemidesmus indicus L. (Asclepiadaceae) is a twining shrub used as folk medicine and an ingredient in Ayurvedic and Unani preparations, known as Indian Sarsaparilla (English). This plant has been used traditionally to treat blood disorders, low digestion, anorexia, diarrhoea, asthma, fever, cough, itching and skin diseases including leprosy [18]. Similarly the extract of H. indicus L. has been shown to possess antitumor, antiinflammatory, antioxidant, antimicrobial, hepatoprotective, nephroprotective [19,20] and neutralization of viper venom [21]. Hence,
http://dx.doi.org/10.1016/j.micpath.2015.03.008 0882-4010/© 2015 Elsevier Ltd. All rights reserved.
Please cite this article in press as: M. Latha, et al., Biocatalytic and bactericidal interaction visualization of green synthesized silver nanoparticles using Hemidesmus indicus, Microbial Pathogenesis (2015), http://dx.doi.org/10.1016/j.micpath.2015.03.008
55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YMPAT1597_proof ■ 20 March 2015 ■ 2/7
2
M. Latha et al. / Microbial Pathogenesis xxx (2015) 1e7
the present study was aimed to synthesis of silver nanoparticles using aqueous plant leaf extract of H. indicus and evaluates its antibacterial activity against isolated bacterium S. sonnei from broiler chicken. 2. Materials and methods 2.1. Chemicals and bacteriological medium The silver nitrate (AgNO3), bacterial media and other components used in this experiment were purchased from Hi Media (Mumbai, India). 2.2. Plant collection H. indicus plant leaves were collected from Karaikudi Tamilnadu, India and identified with the help of authenticated field botanist, Alagappa University, Karaikudi.
2.6. Isolation and identification of bacteria Unhealthy bird's gut and liver samples were sourced from slaughter house, Karaikudi, Sivaganga district, India. Gut samples were packed in sterile container and transferred immediately to the laboratory for the bacterial isolation. The samples were homogenized with sterile distilled water. The homogenized material was serially diluted up to 105 CFU/ml, 0.1 ml of homogenized sample was spread on Shigella specific media (Xylose-Lysine Deoxycholate Agar). Purification and identification of isolates were done using biochemical tests by following standard methods [22] and confirmed as Shigella. The DNA of bacterial strain was extracted by alkaline lysis method [23]. A complete 16S rRNA was amplified by using universal primers, namely forward primer 50 AGAGTTTGATCCTGGCTCAG 30 and reverse primer - 50 TACGGCTACCTTG TTACGACTT 30 [24]. The PCR product of 16S rRNA of the isolates was sequenced with primer set 518F-50 CCAGCAGCCGCGGTAATACG 30 and 800R-50 TACCAGGGTATCTAATCC 30 . Further comparison was made with previously available sequences in NCBI (National Center for Biotechnology Information) using BLAST (Blast Local Alignment Search Tool).
2.3. Preparation of aqueous extracts 2.7. Antibacterial activity of green synthesized silver nanoparticles 1.4 g of fresh leaves were rinsed thoroughly with double distilled water and cut into fine pieces. The air-dried leaves were mixed with 70 ml of double distilled water and kept in boiling water bath at 60 C for 5 min. After cooling the clear leaf broth were filtered with whatman No 1 filter paper and used for further experiments. 2.4. Green synthesis of silver nanoparticles using H. indicus leaf extract 15 ml of clear H. indicus leaf broth was added into the aqueous solution of AgNO3 (0.75 mM) and the reaction mixture was incubated at room temperature in dark condition until colour change. After the reduction of silver ions (colour change) the broth containing silver nanoparticles was centrifuged at 10,000 rpm for 15 min and repeated for three times to ensure better separation of free entities from the metal nanoparticles. 2.5. Characterization of green synthesized silver nanoparticles The reduction of pure Agþ ions was observed periodically (0e3 h) by using UVevis spectroscopy at 250e700 nm (Shimadzu UV-1800, Japan) and H. indicus leaf extract without adding the silver nitrate was used as a control. The FTIR was performed to find out the presence of bio molecules in the extract. The leaf extract was exposed before and after adding the aqueous silver nitrate solution. The samples were mixed with KBr to make a pellet and subjected to FTIR analysis in the thermo scientific Nicolet 380 FTIR spectroscopy. To obtain good signal to noise ratio, 256 scans of silver nanoparticles were taken at the range of 400e4000 cm1 and the resolution was kept as 4 cm1. In order to determine the nature of particles, the freeze dried nanoparticles powder sample was subjected to XRD analysis (X’PERT- PRO.PAN analytical Netherland) operating in transmission mode at 40 kV and 30 mA with Cu K radiation. The size and morphological analysis of the synthesized nanoparticles was done with transmission electron microscopy (TEM) by loading a small volume of AgNPs on cabon-coated copper grids and measured on Technite 10 Philips instrument with an accelerating voltage of 80 Kv. In order to characterize the intermediate compounds, energy dispersive X-ray spectroscopy (Hitachi S3000H) was performed.
The antibacterial activity of green synthesized silver nanoparticles was determined by agar bioassay [25] and well diffusion method [26]. The isolated bacterium was pre-grown in nutrient broth at 37 C for 24 h 100 ml of isolated S. sonnei cells was inoculated at the density of 105 on Muller Hinton Agar medium and different concentration of silver nanoparticles (10, 20, 30, and 40 mg/ml) were poured into petridishes for agar bioassay and well diffusion method. Positive and negative control was also used in this study for comparison and all the plates were incubated at 37 C for 24 h. 2.8. Confocal laser scanning microscopic (CLSM) analysis Further, the effect of green synthesized silver nanoparticles were studied under CLSM (Model: LSM 710, Carl Zeiss, Germany), microscopy. The standard methods slightly modified [27] was to analysis the bacterial interaction with silver nanoparticles in CLSM. In control, 0.5 ml of double distilled water was added to S. sonnei instead of nanoparticles and four different concentrations of nanoparticle samples were added to the bacterial suspension (10, 20, 30 and 40 mg/ml) and incubated for 24 h, then these samples were centrifuged at 5000 rpm for 5 min. The supernatant of these samples were discarded and remaining bacterial pellets were suspended in 0.5 ml prepared fluorescent marker solution (Acridine orange 1 ml and 1 ml of PBS). After 15 min of incubation samples were centrifuged at 5000 rpm for 5 min and the obtained pellet was suspended in 200 ml PBS to remove the excess dye. In the control sample, except the incubation of nanoparticles, all other procedures were followed. One drop of thoroughly stirred sample was placed on glass slide, covered with a cover slip and observed under 40 magnifications in CLSM. The results were processed using Zen 2009 image software. 3. Results and discussion Green synthesized nanoparticles can act as antibacterial agents, due to their ability to interact with bacteria. For this reason, it has been received considerable attention to develop clean and nontoxic eco friendly materials. H. Indicus is easily available plant in India, used for making nannari syrup and folk medicine. Hence, this food based plant was used for bio reduction of AgNO3 to produce good
Please cite this article in press as: M. Latha, et al., Biocatalytic and bactericidal interaction visualization of green synthesized silver nanoparticles using Hemidesmus indicus, Microbial Pathogenesis (2015), http://dx.doi.org/10.1016/j.micpath.2015.03.008
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YMPAT1597_proof ■ 20 March 2015 ■ 3/7
M. Latha et al. / Microbial Pathogenesis xxx (2015) 1e7
3
bactericidal agent for the application in the poultry industry. 3.1. Synthesis of silver nanoparticles The plant extracts are widely being applied to synthesize AgNPs by reducing Agþ ions into Ag which increase the optical density of the solution [28]. The reaction was started after the leaf extract was introduced into 0.75 mM aqueous (AgNO3) solution. After 24 h of incubation in dark room, the colourless AgNO3 solution turned into dark brown which indicated the formation of AgNPs. It is well known that the silver nanoparticles exhibit reddish brown colour in aqueous solution due to excitation of surface plasmon resonance and reduction of AgNO3 [29e31]. Furthermore, the intensity of colour change is direct proportion to the incubation period of nanoparticle synthesis. 3.2. Characterization of green synthesized silver nanoparticles In order to verify the green synthesis of silver nanoparticles the samples were subjected to the UVevis spectra analysis. The absorption spectra of silver nanoparticles formed in the reaction media showed strong absorbance peak at 430 nm and within three hour the peak length was reduced and saturation phase was obtained (Fig 1). A variation in the biological material and metal salt concentration is known to influence NP synthesis [32] and silver nanoparticles exhibit unique and tuneable optical properties on account of their SPR, extremely sensitive to the nature, size distribution and shape of the nanoparticles. The FTIR spectroscopy results of plant aqueous extract showed (Fig. 2a (A)) strong bands at 3424 cm1 (OeH stretch), 2924, 2853 cm1 (CeH stretch), 1622 cm1 (-C]O stretch), 1457, 1405 cm1 (CeC stretch) and 1047 cm1 (CeN stretch). However AgNPs synthesized using H. indicus showed (Fig. 2a (B)) strong bands at 3447 cm1 (OeH stretch), 2924, 2853 cm1 (CeH stretch), 1622 cm1(eC]O stretch), and 1047, 1120 cm1 (CeN stretch). While comparing the FTIR spectrum of plant aqueous extract Fig. 2a (A) and AgNPs only minor changes Fig. 2a (B) were observed. The peak at 3424 cm1 corresponding stretching vibrations of hydroxyl groups of H. indicus plant leaf extract moves to lower wavelength 3447 cm1 which indicates the binding of silver nanoparticles on the surface. The peak at 1622 cm1 shifted to higher wavelength
Fig. 1. UVeVisible spectra of silver nanoparticles synthesized using H. Indicus leaf extracts at different time intervals. The figure insert shows the synthesis of silver nanoparticles.
Fig. 2. a. (A) FTIR spectrum of H. Indicus leaf extracts (B) synthesized silver nanoparticles, b. XRD spectrum of silver nanoparticles synthesized from leaf extract of H. indicus.
(1654 cm1) which indicates the reduction of Agþ ions into Ag nanoparticles. XRD spectrum of results showed four different diffractions peak at 38.1, 44.44 , 64.46 and 77, the lattice plane value was observed which may indexed at (1 1 1), (2 0 0), (2 2 0) and (3 11) of the fcc silver. The resultant data was matched with the data base (JCPDS file no.04e0783). Therefore, based on the XRD patterns it was confirmed that the synthesized AgNPs from leaf extract of H. indicus are crystalline in nature (Fig. 2b). Debye e Scherrer's equation was used to calculate the mean size of AgNPs using the FWHM (full-width (at) half-maximum (height) values at the (111) plane, which showed that the size of the synthesized AgNPs were in the range of 25.24 nm. This was strongly proved in TEM micrograph image. The green synthesized silver nanoparticles using the plant extract of H. indicus structure morphology were confirmed by TEM micrograph images. The TEM images were recorded at different magnification to find the individual particles. The typical TEM image of the green synthesized AgNPs are shown in Fig. 3a. According to the transmission electron micrograph, the morphology of the AgNPs was approximately spherical in shape and mostly aggregated and few individual particles were present. The size of the synthesized silver nanoparticles varied between of 19.91 nme47.60 nm and the
Please cite this article in press as: M. Latha, et al., Biocatalytic and bactericidal interaction visualization of green synthesized silver nanoparticles using Hemidesmus indicus, Microbial Pathogenesis (2015), http://dx.doi.org/10.1016/j.micpath.2015.03.008
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YMPAT1597_proof ■ 20 March 2015 ■ 4/7
4
M. Latha et al. / Microbial Pathogenesis xxx (2015) 1e7
confirmed as Shigella spp by biochemical assay (data not shown). Further, based on the inhibitory activity (in vitro analysis) of these three isolates one strain was selected (data not shown) for 16S rRNA characterization and confirmed as S. sonnei showing similarity of base pair (99%) with the sequence NR 074894.1 (S. sonnei strain SSE10) by BLAST analysis in NCBI database. The nucleotide sequence of S. sonnei strain SSE10 was submitted in the NCBI BankIt (Acc. No: KF769531.1) and this strain was taken for further studies (See Table 1). Q2 3.4. Antibacterial activity of green synthesized silver nanoparticles
Fig. 3. a. Transmission electron microscopy (TEM) analysis of silver nanoparticles ranged between 19.91 and 47.6 nm, b. Energy dispersive X-ray (EDX) spectrum of silver nanoparticles using H. indicus.
average size was 25.24 nm. The variation in the particles sizes may be due to the formation of nanoparticles at different time intervals [33]. An elemental composition analysis of EDX showed the presence of a strong signal from silver atoms (Fig. 3b). Moreover, the presence of sharp optical absorption peak at the range of 3e4 keV which is typical for the absorption of metallic silver nano crystallites. This analysis result indicated that the nano-structures were composed solely of silver. However, there were other EDX peaks for Si, Cl and O, suggested that they were mixed precipitates from the centrifuged. The result of AgNPs clearly shows the character of nanoparticles and confirms the green synthesis of silver nanoparticles. 3.3. Isolation and identification of S. sonnei S. sonnei spreads through contaminated feeds, water and infected animals. Further, an extensive and repeated mixing of poultry stocks may favoured the spreading of this bacterial infection. A total of 40 bacterial strains were isolated from gut and liver of unhealthy broiler chicken, out of these three strains were
The foremost objective of the present study is to understand the antibacterial efficacy of AgNPs against gram negative bacteria of S. sonnei isolated from the poultry broiler. In earlier reports, the negatively charged bacterial cells may attract positively charged nanoparticles and interact with building elements of the bacterial membrane, which may cause structural changes, degradation and finally cell death [25]. It is also believed that DNA loses its replication ability and cellular proteins become inactivated on Agþ [34]. In the present study, the green synthesized silver nanoparticles showed excellent antibacterial activity against isolated bacteria S. sonnei. The results of agar bioassay and well diffusion assay are presented in the Figs. 4 and 5, the green synthesized silver nanoparticles using H. indicus leaf extract showed highest inhibition activity against the S. sonnei isolated from the poultry gut at 40 mg/ ml. In agar bioassay the bacterial colonies were reduced with the increase in the concentration of AgNPs and 34 mm zone of inhibition was recorded in well diffusion assay. Almost no growth of bacterial colonies was observed in the silver and crude extract of H. indicus. The particle size of the synthesized nanoparticles comparatively smaller in size (25.24). This makes them easier to adhere with the cell wall of the bacterium causing disturbance and leads to death of the cells. Further, the antibacterial activities of silver nanoparticles may also influenced by the dimensions of the particles [34]. It was also assumed that AgNPs may break the barrier of outer membrane permeability and destroyed the respiratory cycle. Similarly, Holt and Barder reported that, Agþ inhibits the reparatory cycle of E. coli [35]. The small size and morphology surface planar accessibility of the AgNPs indicates its efficient antibacterial potential [13]. 3.5. Confocal laser scanning microscopic (CLSM) bacterial analysis CLSM image analysis of the bacterial isolates S. sonnei with
Table 1 Physical and biochemical characterization of Shigella spp. Physical Characterization Cell Shape Gram Reaction Spore Position Motility Biochemical Characterization Catalase Oxidase Methyl red Voges Proskauer test Mannitol Fermentaion Xylose Glucose (acid) Glucose (gas) Mannose Lactose Sucrose
Rod shape Gram Negative Non spore farming Non motile þve ve þve ve þve þve þve ve þve ve ve
þ / Positive Reaction. / Negative Reaction.
Please cite this article in press as: M. Latha, et al., Biocatalytic and bactericidal interaction visualization of green synthesized silver nanoparticles using Hemidesmus indicus, Microbial Pathogenesis (2015), http://dx.doi.org/10.1016/j.micpath.2015.03.008
Q4
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YMPAT1597_proof ■ 20 March 2015 ■ 5/7
M. Latha et al. / Microbial Pathogenesis xxx (2015) 1e7
5
Fig. 4. A) Agar bioassay of green synthesized silver nanoparticles using H. indicus at different concentration of silver nanoparticles (a) Control (b) AgNPs mg/ml, (c) 10 mg/ml, (d) 20 mg/ml, (e) 30 mg/ml and (f) 40 mg/ml. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Fig. 5. Assay.1: Agar well diffusion assay of H. Indicus leaf extract, bacterial culture, AgNO3, AgNPs (i) Graph (ii) Plate.Assay. 2: Agar well diffusion assay of green synthesized silver nanoparticles using H. indicus at different concentration of silver nanoparticles with 10 mg/ml, 20 mg/ml, 30 mg/ml, 40 mg/ml and 50 mg/ml (iii) Graph (iv) Plate. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
different concentration of silver nanoparticles was performed to examine the bacterial interaction with AgNPs. Interestingly, the bacterial growth of S. sonnei was reduced with increase in the concentrations of silver nanoparticles (10, 20, 30 and 40 mg/ml). In control, the growth and number of cells were numerous when compared with test experiments (Fig. 6). Thus, the CLSM bacterial study confirmed that the green synthesised silver nanoparticles using H. indicus leaf extract have excellent antibacterial activity against S. sonnei isolated from poultry birds. However,
future studies on the biocide influence of this AgNPs on pathogenic bacteria are necessary in order to fully evaluate its possible use as a new bactericidal material at commercial scale (See Table 2). 4. Conclusion In conclusion, the bio-reduction of aqueous Agþ ions by the leaf extract of H. indicus plant has been demonstrated. This work,
Please cite this article in press as: M. Latha, et al., Biocatalytic and bactericidal interaction visualization of green synthesized silver nanoparticles using Hemidesmus indicus, Microbial Pathogenesis (2015), http://dx.doi.org/10.1016/j.micpath.2015.03.008
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
YMPAT1597_proof ■ 20 March 2015 ■ 6/7
6
M. Latha et al. / Microbial Pathogenesis xxx (2015) 1e7
Fig. 6. Confocal laser scanning microscopy antibacterial activity of green synthesized silver nanoparticles using H. indicus at different concentration (a) 0 mg/ml (b) 10 mg/ml, (c) 20 mg/ml, (d) 30 mg/ml and (e) 40 mg/ml. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.) Table 2 In vitro analysis of green synthesized silver nanoparticles against Shigella spp isolated from poultry gut. Shigella spp Agar bioassay (mg/ml) 1 2 3 Well diffusion assay (mg/ml) 1 2 3
Control
10
+++++ +++ +++++ +++ +++++ +++ Measurements of zone of inhibition (mm) None 13 ± 0.2 mm None 15 ± 0.2 mm None 21 ± 0.2 mm
20
30
40
++ ++ ++
+ + +
19 ± 0.2 mm 21 ± 0.2 mm 26 ± 0.2 mm
21 ± 0.2 mm 25 ± 0.2 mm 29 ± 0.2 mm
25 ± 0.2 mm 29 ± 0.2 mm 34 ± 0.2 mm
+ / Presence of bacterial growth. / Absence of bacterial growth.
integrates nanotechnology and bacteriology leading to possible advancement in the formulation of new type of bactericides. The average size and shape of the nanoparticles were 25.24 nm and spherical in shape respectively. The present study confirmed the antibacterial efficacy of green synthesis of silver nanoparticles using H. indicus against S. sonnei isolated from gut of poultry (broiler) chicken. The AgNPs shows higher inhibition of 34 mm at 40 ml/ml in well diffusion assay and bacterial inhibition activities was further confirmed by CLSM image. Hence, this AgNPs may be effectively used as a bactericide. Moreover synthesis of silver nanoparticles using H. indicus plant extract was the eco-friendly method compare to the chemical and physical synthesis and this may be effectively used as an alternative to antibiotics in poultry industry. However the risk aspects for the large scale application should be strengthened in future studies.
INSPIRE Fellowship/2011/[2], dated 26.09.2011), Department of Physics, Alagappa University, Karaikudi, for their help in X-ray diffraction spectrum analysis. References [1] [2] [3] [4] [5] [6] [7] [8]
Acknowledgement
[9] [10]
The authors are grateful to DST-INSPIRE, Department of Science and Technology, New Delhi for the Research Fellowships (DST/
[11] [12] [13]
R.G. Haverkamp, A.T. Maeshell, J. Nanopart. Rws. 11 (2009) 1453e1464. A. Leela, M. Vivekanandan, Afr. J. Biotechnol. 7 (2008) 3162e3165. N. Saifuddin, C.W. Wong, A.A. Nuryasumira, Eur. J. Chem. 6 (2009) 61e70. A.R. Shahverdi, S. Minaeian, H.R. Shahverdi, H. Jamalifar, A.A. Nohi, Process. Biochem. 42 (2007) 919e923. R. Varshney, A.N. Mishra, S. Bhadauria, M.S. Gaur, Dig. J. Nanomater. Biostruct 4 (2009) 349e355. N. Duran, P.D. Marcato, G.I.H. De souza, O.L. Alves, E. Esposito, J. Biomed. Nanotechnol. 3 (2009) 1e8. S.S. Shankar, A. Ahmad, R. Parischa, M. Sastry, J. Mater. Chem. 13 (2003) 1822e1826. S.S. Shankar, A. Rai, B. Ankamwar, A. Singh, A. Ahmad, M. Sastry, Nat. Mater. 3 (2004) 482e488. K.H. Cho, J.E. Park, T. Osaka, S.G. Park, Electrochim. Acta 51 (2005) 956e960. C.N. Lok, C.M. Ho, R. Chen, Q.Y. He, W.Y. Yu, H. Sun, P.K. Tam, J.F. Chiu, C.M. Chen, J. Proteome Res. 5 (2006) 916e924. S. Silver, Microbiol. Rev. 27 (2003) 341e353. C. Damm, H. Munstedt, A. Rosch, J. Mater. Sci. 42 (2007) 6067e6073. S. Pal, Y.K. Tak, J.M. Song, Appl. Environ. Microbiol. 73 (2007) 1712e2172. Q3
Please cite this article in press as: M. Latha, et al., Biocatalytic and bactericidal interaction visualization of green synthesized silver nanoparticles using Hemidesmus indicus, Microbial Pathogenesis (2015), http://dx.doi.org/10.1016/j.micpath.2015.03.008
66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
YMPAT1597_proof ■ 20 March 2015 ■ 7/7
M. Latha et al. / Microbial Pathogenesis xxx (2015) 1e7 [14] E. Bae, H.J. Park, J. Lee, Y. Kim, J. Yoon, K. Park, K. Choi, J. Yi, Envriron. Toxicol. Chem. 29 (2010) 2154e2160. [15] J.R. Morones, J.L. Elechiguerra, A. Camacho, K. Holt, J.B. Kouri, J.T. Ramirez, M.J. Yacaman, Nanotechnology 16 (2005) 2346e2353. [16] J.S. Kim, E. Kuk, K.N. Kim, J.H. Yu, S.J. Park, H.J. Lee, Y.K. Kim, S.H. Park, H.P. Yong, C.Y. Hwang, Y.K. Kim, Y.S. Lee, D.H. Jeong, M.H. Cho, Nanomed. Nanotechnol. Biol. Med. 3 (2007) 95e101. [17] S.H. Ahmed, G.F. Koob, Science 282 (1998) 298e300. [18] J. Anjaria, M. Parabia, G. Bhatt, R. Khamar, Nature, Heals, a Glossary of Selecyed Indiagenous Medicinal Plants of India, Sristi Innovation, Ahmedabad, 2002. [19] M.S. Kotnis, P. Patel, S.N. Menon, R.T. Sane, Nephrol. Carlt. 9 (2004) 142e152. [20] S. Qureshi, M.K. Rai, S.C. Agrawal, Hindustan Antibiot. Bull. 39 (1997) 56e60. [21] M.I. Alam, B. Audpy, A. Gomes, Phytother. Res. 10 (1996) 58e61. [22] J.G. Holt, N.R. Krieg, P.H.A. Sneath, J.T. Staley, S.T. Williams, Bergey's Manual of Determinative Bacteriology, ninth ed., the Wiiams and Wikins Company, Baltimore, MD, USA, 1994. [23] F.M. Ausubel, R. Brend, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, K. Struhi, Current Protocols in Molecular Biology, vol. 1, Greene Publishing Associates and Wiley- Interscience, New York, 1990.
7
[24] G. Andrew, S. Henderson, W. Hall, Br. J. psychiatry 178 (2001) 145e153. [25] S. Ivan, S.S. Branka, J. Colloid Interface Sci. 275 (2004) 177e182. [26] H. Mette, B. Oivind, R. Ana, N. Janne, M. Jette, J. Sigmund, D. Haze, A. peter, B. Harry, G. Lone, Syst. Appl. Microbiol. 27 (2004) 360e371. [27] E. Sawosz, A. Chwalibog, J. Szeliga, F. Sawosz, M. Grodzik, M. Rupiewicz, T. Niemiec, K. Kacprzyk, Int. J. Nanomed. 5 (2010) 631e637. [28] J.Y. Song, B.S. Kim, Bioprocess. Biosyst. Eng. 32 (2009) 79e84. [29] S.S. Shankar, A. Rai, A. Ahmad, M. Sastry, J. Colloid Interface Sci. 275 (2004) 496e502. [30] P. Mulvaney, Langmuir 12 (1996) 788e800. [31] A. Ahmad, P. Mukherjee, S. Senapati, D. Mandal, M. Islam Khan, R. Kumar, M. Sastry, Colloids. Surf. B 28 (2003) 313e318. [32] P.S. Pimprikar, S.S. Joshi, A.R. Kumar, S.S. Zinjarde, S.K. Kulkarani, Colloids. Surf. B 74 (2009) 309e316. [33] J. Kasthuri, K. Kathiravan, N. Rajendiran, J. Nanopart. Res. 11 (2009) 1075e1085. [34] Q.L. Feng, J. Wu, G.Q. Chen, F.Z. Cui, T.M. Kim, J.O.J. Kim, Biomed. Mater. Res. 52 (2000) 662e668. [35] S. Kaviya, J. Santhanalakshmi, B. Viswanathan, J. Nanotechnol. (2011) http:// dx.doi.org/10.1155/2011/152970.
Please cite this article in press as: M. Latha, et al., Biocatalytic and bactericidal interaction visualization of green synthesized silver nanoparticles using Hemidesmus indicus, Microbial Pathogenesis (2015), http://dx.doi.org/10.1016/j.micpath.2015.03.008
18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34