- Email: [email protected]
Biochemical and molecular characterization of a novel high activity creatine amidinohydrolase from Arthrobacter nicotianae strain 02181
Process Biochemistry 44 (2009) 460–465
Contents lists available at ScienceDirect
Process Biochemistry journal homepage: www.elsevier.com/locate/procbio
Biochemical and molecular characterization of a novel high activity creatine amidinohydrolase from Arthrobacter nicotianae strain 02181 Qiang Zhi a,1, Peiyan Kong b,1, Jiatao Zang a,1, Youhong Cui c, Shuhui Li a, Peng Li a, Weijing Yi a, Yuan Wang a, An Chen a, Chuanmin Hu a,* a b c
Department of Clinical Biochemistry, Third Military Medical University, Gaotanyan Street 30, Shapingba District, Chongqing 400038, China Department of Hematology, Xinqiao Hospital, Third Military Medical University, Chongqing 400037, China Institute of Inflammation & Immune Disease, Shantou University, Shantou 515031, China
A R T I C L E I N F O
A B S T R A C T
Article history: Received 29 July 2008 Received in revised form 12 November 2008 Accepted 17 December 2008
A high activity creatine amidinohydrolase (creatinase) from Arthrobacter nicotianae 02181 (a strain newly isolated from soil which may utilize creatinine as the unique organic source) was purified, characterized and the creatinase gene was cloned and analyzed in this study. Cells were cultivated under optimized condition for enzyme yield and creatinase was purified by the DEAE-cellulose and hydroxylapatite (HA) chromatography. The creatinase was found to be a dimmer formed by two identical subunit of 46.4 kDa, and the specific activity of the purified creatinase reached 124.44 U/mg protein, which was about 13 folds of the maximum value ever reported. The enzyme was found to be most active at 37 8C (pH 7.0), and it was found to be relatively stable bellow 45 8C around pH 7.0 by fluorescence spectroscopy and circular dichroism (CD) analysis. The activity of this creatinase could be significantly inhibited by Cu2+, Hg2+, Fe3+and SDS, and it could be improved by Ca2+ and NaN3.The creatinase gene was cloned by the consensus-degenerate hybrid oligonucleotide primers (CODEHOP) PCR and the genome walking method. Nucleotide sequence analysis of this gene revealed an open reading frame (ORF) of 1254 base pair (bp) encoding a 417 amino acid (aa) protein. The primary amino acid sequence alignment search in the database revealed a moderate homology between the deduced amino acid sequence and other creatinase. The sequence has been submitted to Genbank with the accession number EU004199. ß 2008 Elsevier Ltd. All rights reserved.
Keywords: Creatinase CODEHOP PCR Genome walking Nucleotide sequence Arthrobacter
1. Introduction Creatine amidinohydrolase (creatinase, EC 3.5.3.3) is an important enzyme for creatinine concentration determination in biological fluids to evaluate renal damage. It was first characterized in 1950 by Roche et al. [1], who made the finding of the phenomenon that the creatine was metabolized to urea in two Pseudomonads strains (Ps. eisenbergii and ovalis). This phenomenon was explained by Appleyard and Woods [2] through the illumination of the creatine catabolism pathway in Ps. pvalis. Yoshimoto et al. [3] purified and crystallized the creatinase from Ps. putida, and later on the creatinase active sites were deduced on base of the crystal model [4,5]. The active sites were found to be conserved in creatinases from different microorganisms, while residues in the N terminal was found to determine the specific activity level. The highest specific activity of purified native
creatinase ever reported was about 9 U/mg protein, which may be improved up to 16 U/mg protein by a modified cell split method in Escherichia coli (E. coli) [6]. Recent researches mainly focused on the detection of creatinine by biosensors [7], while reports about newly discovered creatinase was only a few. As an enzyme for clinical applications, activity is an important property. In previous work, an Arthrobacter nicotianae strain 02181 that produced high activity creatinase was isolated in our laboratory. We purified and characterized the creatinase from A. nicotianae 02181 in the present study, and the creatinase gene was cloned for a better understanding of its high activity. To our best knowledge, the activity of this creatinase is much higher than those from other microorganisms ever reported, and this research may contribute to both clinical applications and deeper understanding of the mechanism involved in enzyme activity. 2. Materials and methods 2.1. Bacterial strains and plasmids
* Corresponding author. Tel.: +86 23 68752314. E-mail address: [email protected] (C. Hu). 1 These authors contribute equally to this work. 1359-5113/$ – see front matter ß 2008 Elsevier Ltd. All rights reserved. doi:10.1016/j.procbio.2008.12.014
Strain 02181 was isolated from soil using creatinine as the unique organic source. Sample collected were plated onto solid agar plate containing (g/l): creatinine 5, MgSO47H2O 0.5, K2HPO4 1.0, KCl 5.0, glucose 20 and agar 15. Plates
Q. Zhi et al. / Process Biochemistry 44 (2009) 460–465 Table 1 Mediums used to determine essential organics for cell growth and enzyme yield. Mediums
Components(1 l)
MA MB MC MD ME MF MG
Basic Basic Basic Basic Basic Basic Basic
a
saltsa + creatinine 5.0 g salts + peptone 5.0 g salts + creatinine and peptone 5.0 g each salts + creatinine and sodium nitrate 5.0 g each salts + creatinine 5.0 g and glucose 20.0 g salts + sodium nitrate 5.0 g and glucose 20.0 g salts + creatinine and peptone 5.0 g each, glucose 20.0 g
Basic salts consist of MgSO47H2O 0.5 g, K2HPO4 1.0 g and KCl 5.0 g.
were incubated at 28 8C until colonies reached 2 mm. Single colonies were inoculated into liquid medium (M1, as same as solid plate but agar) separately for 24 h incubating at 28 8C and those that may produce urea were picked out for another round of screening. Finally, a strain with the highest urea production (02181) was obtained. Based on morphological and physiological characteristics and 16S rRNA gene homologies, it was identified to be a member of the genus A. nicotianae. E. coli DH5a strain (Novagen) and plasmid pGEM-T (Promega) were used for gene cloning. 2.2. Cultivation and media A. nicotianae 02181 was cultivated in medium M1 under temperatures ranged from 25 to 35 8C to determine the optimized temperature for enzyme production. It was also cultivated in mediums (MA–MG, Table 1) consisted of different organic sources to determine what was essential for enzyme activity and productivity. 2.3. Chemicals and reagents Creatine, creatinine, lysozyme, Pfu DNA polymerase and streptomycin were purchased from Promega. Restriction enzymes were from TOYOBO. Glutathione, 2diethylaminoethyl-cellulose (DEAE-cellulose) was purchased from Sigma; hydroxylapatite (HA) was purchased from Shanghai Bio Life Science and Technology Ltd. GSTrapTMFF column was a product of Amersham. Oligonucleotide primers were synthesized by Invitrogen Co., Ltd. (China). 2.4. Creatinase activity assay Specific enzyme activity of creatinase was determined according to the method set up by Yoshimoto et al. [3] 0.1 ml enzyme solution was added into a 0.9 ml 50 mM potassium phosphate buffer (PBS, pH7.0) containing 100 mM creatine as substrate. After 10 min incubation at 37 8C, 2.0 ml p-dimethylaminobenzaldehyde solution (2.0 g p-dimethylaminobenzaldehyde dissolved in 100 ml dimethylsulfoxide, then 15 ml HCl stock added) was added to stop the reaction by incubation at 25 8C for 20 min and absorbance was measured against the blank at 435 nm. Protein concentration was determined by the method described by Lowry et al. [8]. One unit of enzyme activity was defined as the amount of enzyme that catalyzed the synthesis of 1 mmol of the urea per minute under the conditions described in this section. 2.5. Purification of native creatinase After cultivation, cells were resuspended with a buffer containing 3 mM EDTANa2, 23 mM K2HPO4 and 7.6 mM NaN3 (pH 7.2) and lysed by lysozyme and a subsequent supersonic operation. Cell lysate was centrifuged at 13,000 rpm for 20 min at 4 8C, and the supernatant was removed into a new tube. Then streptomycin was added to 200 mg/ml. To remove nucleic acids, polycoses and somatic proteins, and supernatant after a centrifugation at 13,000 rpm for 30 min at 4 8C was loaded onto a DEAE-cellulose column preequilibrated with binding buffer (50 mM PBS, pH 7.2). The column was washed with NaCl in linear gradient (0–1 M) and creatinase activity of eluted fractions was tested. Fractions showing creatinase activity were mixed together and applied to the HA column preequilibrated with 10 mM PBS (pH 7.2), and then the column was washed with K3PO4 in linear gradient (20–400 mM). Eluted fractions were collected and analyzed by sodium dodecyl sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and PAGE, and specific creatinase activities were tested separately. 2.6. Kinetics parameters The purified enzyme was incubated with different concentrations of creatine (10–100 mM) in 100 mM PBS (pH 7.2) at 37 8C, and enzyme activity was measured at different spots of time. Each reaction was performed in triplicate and the reaction rates obtained were fitted to Michaelis–Menten kinetics.
461
2.7. Effect of pH and temperature on enzyme activity and stability The purified creatinase was dialyzed against 50 mM citrate buffer (pH 3.0–6.0), 50 mM PBS (pH 6.0–8.0) or 50 mM borate buffer (pH 8.0–10.5), and then enzyme activities were tested according to the method described in Section 2.4 with pH adjusted correspondingly to determine the optimum pH. Enzyme stability in these buffers was evaluated by fluorescence spectroscopy and circular dichroism (CD) assay. In the fluorescence spectroscopy assay, the creatinase was diluted to 5 mg/ ml with corresponding buffers and then the fluorescence emissions were scanned from 300 to 500 nm under the excitation wavelength of 280 nm. In the CD assay, the concentration of creatinase was 50 mg/ml and the wavelength was 190– 260 nm. The optimum temperature for creatinase activity was determined by testing enzyme activity at temperatures from 15 to 60 8C according to Section 2.4, and effect of temperatures on enzyme stability was studied by fluorescence spectroscopy and CD assay. Briefly, the purified creatinase was diluted with 50 mM PBS (pH 7.0) to 5 and 50 mg/ml for fluorescence spectroscopy and CD assay, respectively, and tests were taken using the same wavelength as that in pH assay after having incubated for 15 min from 4 to 80 8C. 2.8. Effect of inhibitors and metal ions on enzyme activity The effect of enzyme inhibitors were studied in 50 mM PBS (pH 7.0) containing SDS, Brij35, Triton X-100 or NaN3 et al at a final concentration of 5 g/l or EDTA at 1 mM, respectively. Purified enzyme was pre-incubated with inhibitors at 37 8C for 30 min and the residual activity was measured by the method described in Section 2.4. The influence of various metal ions (Ca2+, Mg2+, Mn2+, Cd2+, Zn2+, Fe3+, Hg2+ and Cu2) was studied by testing residual enzyme activity after incubating for 30 min in 50 mM PBS (pH 7.0) containing 1 mM metal ion at 37 8C. 2.9. Cloning of creatinase gene by CODEHOP PCR and genome walking Genomic DNA of A. nicotianae 02181 was prepared by the CTAB method [9]. Oligonucleotide primers in CODEHOP PCR (P1-1, P1-2, P2-1, P2-2, P3-1 and P32, Table 2) were designed according to conservative gene blocks by the program CODEHOP2 following the method described by Rose et al. [10]. The PCR procedure was as follows: initial denaturation at 95 8C for 2 min and 30 cycles of 90 s at 95 8C, 60 s at 55 8C, 60 s at 72 8C, followed by additional 5 min at 72 8C. DNA fragments were recovered, subcloned in to the pGEM-T vector and sequenced. After a partial creatinase gene obtained, specific primers (GSP1u, GSP1d, GSP2u and GSP2d, Table 2) were designed for subsequent genome walking [11–13] using the BD GenomeWalkerTM Universal Kit (Takara) and BD AdvantageTM II PCR Kit (Takara). Genomic DNA of 02181 was digested by restriction enzymes DraI, PvuII, EcoRV or StuI, respectively to serve as templates for the primary and the secondary PCR amplification. The primary PCR procedure was as follows: initial denaturation at 95 8C for 2 min, 7 cycles of 25 s at 95 8C, 3 min at 72 8C, and 32 cycles of 25 s at 95 8C, 3 min at 67 8C. Primary PCR products were diluted 50 times as templates for the secondary PCR. The secondary PCR was similar to the primary PCR except for a reduction of 2 and 12 in cycle numbers. All PCR products were analyzed by electrophoresis in 1.5% agarose gels and DNA fragments of interest were cloned into pGEM-T vector and sequenced. 2.10. DNA sequence analysis DNA sequencing was carried out with the dideoxy-chain termination method [14] by using an ABI Prism 377 Genetic Analyser (Applied Biosystems). DNAStar (Lasergene), Vector NTI 8.0 (InforMax Inc.) and Primer Premiers 5.0 (PREMIER Biosoft international) software were employed to analyze the DNA sequence. 2.11. Nucleotide sequence accession number The nucleotide sequence reported in this study has been submitted to the GenBank database with the accession number EU004199.
3. Results 3.1. Effect of cultivation conditions on enzyme activity Studies were first carried out to optimize the medium for the growth and the production of enzymes, and the most appropriate medium (MC) for the protease production is composed of (g/l): MgSO47H2O 0.5, K2HPO4 1.0, KCl 5.0, creatinine 5.0 and peptone 5.0. It was very interesting to notice that A. nicotianae 2 The program was provided on http://bioinformatics.weizmann.ac.il/blocks/ blockmkr/www/make_blocks.html.
462
Q. Zhi et al. / Process Biochemistry 44 (2009) 460–465
Table 2 Primers for CODEHOP PCR and genome walking in creatinase gene cloning from A. nicotianae 02181. Namea
Oligonucleotide sequence
P1-1 P1-2 P2-1 P2-2 P3-1 P3-2 AP1 AP2 GSP1u GSP1d GSP2u GSP2d
50 TCCTTCGACGACAACATCGTntayacngayt30 50 AAGTTGTCCCGCTGCcartcngtrta30 50 CGAGTTCATGGACACCTGGryntggttyca30 50 TGCCGGACTGGaaccanrycca30 50 GCCGGCGGCTACCGngarcaygaya30 50 CGTTCTCGTTGATGACCAGGAtrtcrtgytcnc30 50 GTAATACGACTCACTATAGGGC30 50 ACTATAGGGCACGCGTGGT30 50 ATCTTCTCGCGGGTCAGGCCCGGCAGG30 50 CGAAATCGCCAAGACCTTCCCGCACCGC30 50 CGATGCGCGAGGCCTTCACTCCATCGC30 50 GCGACACCTGGACCTGGTTCCAGTCCGG30
a Primers P1-1, P1-2, P2-1, P2-2, P3-1 and P3-2 were designed on conservative creatinase gene blocks from Alcaligenes sp. (AB016788), Arthrobacter sp. TE1826 (AB007122), Bacillus sp. B-0618 (D14463), Flavobacterium sp. U-188 (D00656), Pseudomonas putida (AF072304) and Rhodobacter sphaeroides (NC_009428) for CODEHOP PCR, and each primer consisted of specific regions in upper case and degenerate regions in lower case. Primers AP1, AP2, GSP1u, GSP1d, GSP2u and GSP2d were used in genome walking. AP1 and AP2 were provided in the BD GenomeWalkerTM Universal Kit (TAKARA), and GSP1u, GSP1d, GSP2u and GSP2d were designed according to the 281 bp sequence obtained in CODEHOP PCR.
02181 may live in the medium using creatinine as the unique organic source, and cell growth was greatly improved when glucose was added in the medium while enzyme yield greatly reduced (Fig. 1B). Influence of temperature on cell growth was observed by cultivation under different temperatures, and the optimized temperature was 28 8C according to cell growth curve (Fig. 1A). 3.2. Purification of native creatinase of A. nicotianae 02181 Native creatinase from A. nicotianae strain 02181 was purified after cells cultivated in the medium MC according to the method described in Section 2.4. Specific creatinase activities of the fractions obtained in each purification step were tested (Table 3) and it was found that the activity of the purified creatinase from A. nicotianae 02181 was 124.4 U/mg protein, about 13 folds of those ever reported from other source. Purified native creatinase was analyzed by SDS-PAGE and PAGE analysis, and it was found to be a dimmer formed by two identical single monomers with a relative molecular weight of 46.4 kDa (Fig. 2).
Fig. 1. Effect of cultivation conditions on cell growth and enzyme production. (A) Cell yields and creatinase productivities in mediums MA–MG. Cells were cultivated in mediums MA–MG (Table 1) at 28 8C with continuous shaking of 200 rpm for 24 h. Cell yields and creatinase activities were tested subsequently. (B) Cell growth curve under different temperatures in medium M1. Cells were cultivated in M1 for 24 h with continuous shaking of 200 rpm.
3.3. Characteristics of creatinase from A. nicotianae 02181
Using primers P1-1 and P2-2 with the strategy of CODEHOP PCR, a 281 bp partial sequence of the creatinase gene from A. nicotianae 02181 has been cloned first. A genome walking at the base of that sequence was carried out, and a 361 bp and a 2 kb segment were obtained in the 50 upstream genome walking while segments obtained in the 30 downstream walking were 2 kb and 400 bp. They were sequenced and segments that showed high homology to creatinase by BLASTx analysis were picked out. The creatinase gene was then assembled using Vector NTI 8.0 and DNAstar, and a sequence of 2100 bp has been obtained.
The rates of creatine hydrolysis obeyed to Michaelis–Menten kinetics over the concentration of the substrate examined. Michaelis–Menten constant (Km) for this enzyme was calculated as 46.5 mM, and Vmax was 8.2 mM/min. Optimum pH and temperature for enzyme activity were studied and results were shown in Fig. 3A and B, respectively. The optimized pH was about 7.0, and enzyme activity decreased sharply when pH was above 8.0 or below 6.0. And the creatinase activity could be maintained mostly from 25 to 45 8C. Enzyme stabilities under different pH and temperatures were studied by fluorescence spectroscopy (Fig. 4A and B) and CD assay (Fig. 4C and D). The enzyme was found to be relatively stable between pH 6.0 and 9.0 below 45 8C, in which both the secondary and third structure maintained stable. The effect of a variety of enzyme inhibitors and metal ions on the activity of creatinase was investigated (Table 4). Enzyme activity would be greatly inhibited by Hg2+, Zn2+ and Fe3+, and it lost completely with the existing of SDS and Cu2+. Ca2+ and NaN3
were found to be helpful for enzyme activity while effect of EDTA was not very significant. 3.4. Cloning of creatinase gene from A. nicotianae 02181
Table 3 Purification of native creatinase from A. nicotianae 02181. Procedure
Input (U)
Output (U)
Yield (%)
Specific activity (U/mg protein)
Fold
Crude enzyme DEAE-cellulose Hydroxylapatite
– 8400 2750
– 7566 1456
– 90.08 52.95
1.0 8.70 124.44
– 8.70 124.44
Q. Zhi et al. / Process Biochemistry 44 (2009) 460–465
463
moderate homology between the deduced peptide and creatinases form other microorganisms (Fig. 5B). The sequence identity index between creatinase from Arthrobacter sp. FB24 (YP_833203) and deduced 02181 peptide was the highest among the strains listed above, having the value of 87%. Align analysis of this deduced protein and creatinase from Ps. Putida indicated that amino acid residues involved in creatinase function does exist in the deduced 02181 peptide. Bioinformatics analysis indicated that the molecular weight of this deduced 02181 polypeptide was 46,268, which was identical with the result of SDS-PAGE of the native creatinase from A. nicotianae 02181. 4. Discussion
Fig. 2. 15% SDS-PAGE analysis of purified native creatinase from A. nicotianae 02181. Lane M, protein molecular weight marker. Lane 1, purified native creatinase from A. nicotianae 02181.
3.5. Nucleotide and amino acid analysis Bioinformatics analysis of the 2100 bp creatinase gene revealed an ORF of 1254 bp in length. It was predicted to encode a polypeptide (designated creatinase) of 417 amino acids, which started from an ATG codon and ended with a TAA stop codon (Fig. 5A). A Shine Delgarno sequence (AAGGAG) was observed at 9–14 bp upstream from the ATG codon. Analysis of the sequence of the initiation codon allowed us to identify a presumable promoter region, TTGACA for the 35 and GTCTAA for the 10 sequences, respectively. An inverted repeat sequence for the transcription termination exists at 16 bp downstream from the end of the ORF. BLASTing the protein sequence deduced from the ORF against the NCBI databases predicted the peptide to be a member of creatinase. Amino acid sequence homology analysis revealed
Creatinase has been found in Alcaligenes [15], Actinobacillus [16], Arthrobacter [17], Flavobacterium [18], Bacillus [19,20], Candidatus [21], Paracoccus [22] and Pseudomaonas [9,23,24], etc. There was no report about these strains that may live in the medium without organic source except for creatinine. The reason for this might be that these strains could not synthesize one or two of the other two enzymes, creatininase and sarcosine oxidase, which are essential for creatinine hydrolysis. The A. nicotianae 02181 strain may utilize creatinine as the unique organic source to fulfill its base need, although creatinine is not an efficient nitrogen source compared with peptone. The contrast in cell growth and enzyme yield when glucose was added in to the medium indicated that there must be two metabolic pathways regulated by glucose and creatinine separately, and the pathway regulated by glucose as substrates should be more efficient than that of creatinine (Fig. 1A). In other words, there should be promoters regulated by glucose and creatinine in A. nicotianae 02181, and the promoter regulated by glucose must be more active than that of creatinase. The maximum native creatinase specific activity ever reported was about 9 U/mg protein [5,22], while the activity of creatinase purified from A. nicotianae 02181 was about 13fold of the maximum value ever reported. We had attributed the mechanism for the character of high activity to mutations in the active sites, but the assumption was denied after the sequence of the creatinase gene had been obtained. We made an alignment of the creatinase from A. nicotianae 02181 and Pseudomonas putida, whose crystal model had been built [4,5].
Fig. 3. Effect of pH and temperature on enzyme activity. The highest enzyme activity was defined as 100%. (A) An aqueous enzyme solution was incubated with 50 mM citrate buffer (*, pH 3.0–6.0), 50 mM PBS (&, pH 6.0–8.0) or 50 mM borate buffer (~, pH 8.0–10.5), and creatinase activity was measured by the method described in Section 2.4 with pH adjusted correspondingly. (B) Effect of temperature on enzyme activity. The creatinase activity was tested by the method described in Section 2.4 with temperatures adjusted.
Q. Zhi et al. / Process Biochemistry 44 (2009) 460–465
464
Fig. 4. Enzyme stability under different pH and temperatures revealed by fluorescence spectroscopy and CD assay. The purified creatinase was diluted to 5 mg/ml with buffers of different pH and left at 25 8C for 15 min, or incubated for 15 min from 4 to 80 8C in 50 mM PBS, pH 7.0. Fluorescence emissions were tested from 300 to 500 nm with the excitation wavelength of 280 nm. CD assay was performed by wavelength scan from 190 to 260 nm. (A) Enzyme stability revealed by fluorescence spectroscopy spectrum. Spectrums at pH 4.6 ( ) and 60 8C (– –) were shown in contrast to that of 25 8C, pH 7.0 (—). Results were shown from 300 to 400 nm for a more detailed view. (B) Fluorescence emission of creatinase from the 02181 strain at 333 nm under different pH (&) and temperatures (*). (C) CD spectrum under different pH. (D) CD spectrum under different temperatures.
The active sites of creatinase interpreted in that model include H232, N249, A260, H324, E358 and H376, while none mutation was found in these residues in the creatinase from A. nicotianae 02181. This result conformed the conclusion drew by Hoeffken and Moellering et al., but the degree of the variation in the
Table 4 Effect of inhibitors and metal ions on enzyme activity. Inhibitors and metal ions
Final concentrations
Residual activities (%)a
Ca2+ Mg2+ Mn2+ Cd2+ Zn2+ Hg2+ Fe3+ Cu2+ SDS Brij35 Triton X-100 NaN3 EDTA
1 mM 1 mM 1 mM 1 mM 1 mM 1 mM 1 mM 1 mM 5 g/l 5 g/l 5 g/l 5 g/l 1 mM
103.8 91.08 88.65 63.31 43.98 9.82 2.24 0 0 85.14 87.39 103.64 99.16
a Purified creatinase was pre-incubated with inhibitors or metal ions in 50 mM PBS (pH 7.0) at 37 8C for 30 min and the residual activity was measured by the method in Section 2.4. Activity in the buffer without inhibitors and metal ions was set as 100%.
sterical structure induced by mutations around the creatinase active sites is not sure. Inhibition of SDS to enzyme activity indicated that sterical structure was crucial for creatinase activity, and it has also been confirmed by the reduction of activity in recombinant creatinase monomer. Several combinations of different vectors and host cells had been used to prepare a recombinant creatinase dimmer, and result in some combination was very exciting (data not shown). This creatinase was relatively active between pH 6.0 and 8.0 and maintained stable between pH 6.0 and 9.0, which was similar to the creatinase from Paracoccus sp. strain WB1 [22]. However, the method for stability evaluation in this study was different from that of WB1. The fluorescence spectroscopy and CD assay are more direct, and this is the first report to characterize creatinase stability using these techniques. Most behaviors of creatinase from the 02181 strain with enzyme inhibitors were similar with those ever reported except for Fe3+ and SDS. In fact, we have found that Mg2+ and K+ were helpful for creatinase activity when they were added in the culture medium, while Ca2+ and Fe2+ were found to be adverse though cell yield may be improved (data not shown). In this study we just report the high activity creatinase and its gene sequence from A. nicotianae 02181, and further research would be done to find the exact mechanism involved at the base of previous work.
Q. Zhi et al. / Process Biochemistry 44 (2009) 460–465
465
Acknowledgements This study was supported by the Scientific Research Foundation of Third Military Medical University (2004) and National Natural Science Foundation of China (Grant no. 30570373). References [1] Roche J, Lacombe G, Girard H. On the specificity of certain bacterial deguanidases generating urea and on arginindihydrolase. Biochem Biophys Acta 1950;6:210–6. [2] Appleyard G, Woods DD. The pathway of creatine catabolism by Pseudomonas ovalis. J Gen Microbiol 1956;14:351–65. [3] Yoshimoto T, Oka I, Tsuru D. Purification, crystallization, and some properties of creatine amidinohydrolase from Pseudomonas putida. J Biochem (Tokyo) 1976;79:1381–4. [4] Hans M, Lorenz R, Gu¨nter S. Enzymatic mechanism of creatine amidinohydrolase as deduced from crystal structures. J Mol Biol 1990;214:597–610. [5] Hoeffken HW, Knof SH, Bartlett PA, Huber R, Moellering H, Schumacher G. Crystal structure determination, refinement and molecular model of creatine amidinohydrolase from Pseudomonas putida. J Mol Biol 1988;204:417–33. [6] Chen YC, Chen LA, Chen SJ, Chang MC, Chen TL. A modified osmotic shock for periplasmic release of a recombinant creatinase from Escherichia coli. Biochem Eng J 2004;19:211–5. [7] Ramanavicius A. Amperometric biosensor for the determination of creatine. Anal Bioanal Chem 2007;387:1899–906. [8] Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem 1951;193:265–75. [9] Hong MC, Chang JC, Wu ML, Chang MC. Expression and export of Pseudomonas putida NTU-8 creatinase by Escherichia coli using the chitinase signal sequence of Aeromonas hydrophila. Biochem Genet 1998;36:407–22. [10] Rose TM, Henikoff JG, Henikoff S. CODEHOP (Consensus-Degenerate Hybrid Oligonucleotide Primer) PCR primer design. Nucleic Acids Res 2003;31:3763–9. [11] Jones DH, Winistorfer SC. Genome walking with 2 to 4 kb steps using panhandle PCR. PCR Methods App 1993 l;2:197–203. [12] Rosenthal A, Jones DS. Genomic walking and sequencing by oligo-cassette mediated polymerase chain reaction. Nucleic Acids Res 1990;18:3095–101. [13] Shyamala V, Ames GF. Genome walking by single-specific-primer polymerase chain reaction: SSP-PCR. Gene 1989;84:1–8. [14] Sanger F, Nicklan S, Coulson AR. DNA sequencing with chain termination inhibitors. Proc Natl Acad Sci 1997;74:5463–7. [15] Matsuda Y, Wakamatsu N, Inouye Y, Uede S, Hashimoto Y, Asano K, Nakamura S. Purification and characterization of creatine amidinohydrolase of Alcaligenes origin. Chem Pharm Bull 1986;34:2155–215. [16] Padmanabhan B, Paehler A, Horikoshi M. Structure of creatine amidinohydrolase from Actinobacillus. Acta Crystallogr D Biol Crystallogr 2002;58:1322–30. [17] Nishiya Y, Toda A, Imanaka T. Gene cluster for creatinine degradation in Arthrobacter sp. TE1826. Mol Gen Genet 1998;257:581–7. [18] Koyama Y, Kitao S, Yamamoto OH. Cloning and expression of the creatinase gene from Flavobacterium sp. U-188 in Escherichia coli. Agric Biol Chem 1990;54:1453–60. [19] Sugiyama M, Yuasa K, Kumagai T, Kinoshita E, Matsuo H, Nishimura M, et al. Gene technology to overproduce the enzymes useful as diagnostic reagents. Rinsho Byori 1995;43:765–71. [20] Suzuki K, Sagai H, Sugiyama M, Imamura S. Molecular cloning and high expression of the Bacillus creatinase gene in Escherichia coli. J Ferment Bioeng 1993;76:77–81. [21] Giovannoni SJ, Tripp HJ, Givan S, Podar M, Vergin KL, Baptista D, et al. Genome streamlining in a cosmopolitan oceanic bacterium. Science 2005;309:1242–5. [22] Wang YY, Ma XH, Zhao WF, Jia XM, Kai L, Xu XH. Study on the creatinase from Paracoccus sp. strain WB1. Process Biochem 2006;41:2072–7. [23] Chang MC, Chang CC, Chang JC. Cloning of a creatinase gene from Pseudomonas putida in Escherichia coli by using an indicator plate. Appl Environ Microbiol 1992;5810:3437–77. [24] Yamamoto K, Oka M, Kikuchi T, et al. Cloning of the creatinine amidohydrolase gene from Pseudomonas sp. PS-7. Biosci Biotechnol Biochem 1995;59:1331–3.
Fig. 5. DNA sequence analysis of creatinase gene from A. nicotianae 02181. (A) Nucleotide and deduced amino acids sequence of creatinase from A. nicotianae 02181. Translation initiation codon (ATG) and termination codon (TAA) are positioned at nt +1 and nt +1254, respectively. Regions encoding putative promoter (10 and 35), RBS and transcription termination site are underlined. Creatinase active sites were marked with &. The accession number of this gene in Genbank was EU004199. (B) Sequence alignment of creatinases from A. nicotianae 02181, Arthrobacter sp. FB24 (YP_833203), Bacillus sp. B-0618 (BAA03358), Rubrobacter xylanophilus DSM 9941 (YP_643247), Burkholderia phymatum STM815
(YP_001862364), Ps. Putida (P38488) and Candidatus pelagibacter ubique HTCC1062 (YP_266109). Sequences were compared using Vector NTI 8.0 software. Those with red foreground and yellow background are with full identity; those strongly similar are heavy blue foreground and light blue background; those with weakly similarity are black foreground and white background. The sequence of A. nicotianae 02181 is used as the consensus sequence. (For interpretation of the references to color in the figure caption, the reader is referred to the web version of the article.)
Contents lists available at ScienceDirect
Process Biochemistry journal homepage: www.elsevier.com/locate/procbio
Biochemical and molecular characterization of a novel high activity creatine amidinohydrolase from Arthrobacter nicotianae strain 02181 Qiang Zhi a,1, Peiyan Kong b,1, Jiatao Zang a,1, Youhong Cui c, Shuhui Li a, Peng Li a, Weijing Yi a, Yuan Wang a, An Chen a, Chuanmin Hu a,* a b c
Department of Clinical Biochemistry, Third Military Medical University, Gaotanyan Street 30, Shapingba District, Chongqing 400038, China Department of Hematology, Xinqiao Hospital, Third Military Medical University, Chongqing 400037, China Institute of Inflammation & Immune Disease, Shantou University, Shantou 515031, China
A R T I C L E I N F O
A B S T R A C T
Article history: Received 29 July 2008 Received in revised form 12 November 2008 Accepted 17 December 2008
A high activity creatine amidinohydrolase (creatinase) from Arthrobacter nicotianae 02181 (a strain newly isolated from soil which may utilize creatinine as the unique organic source) was purified, characterized and the creatinase gene was cloned and analyzed in this study. Cells were cultivated under optimized condition for enzyme yield and creatinase was purified by the DEAE-cellulose and hydroxylapatite (HA) chromatography. The creatinase was found to be a dimmer formed by two identical subunit of 46.4 kDa, and the specific activity of the purified creatinase reached 124.44 U/mg protein, which was about 13 folds of the maximum value ever reported. The enzyme was found to be most active at 37 8C (pH 7.0), and it was found to be relatively stable bellow 45 8C around pH 7.0 by fluorescence spectroscopy and circular dichroism (CD) analysis. The activity of this creatinase could be significantly inhibited by Cu2+, Hg2+, Fe3+and SDS, and it could be improved by Ca2+ and NaN3.The creatinase gene was cloned by the consensus-degenerate hybrid oligonucleotide primers (CODEHOP) PCR and the genome walking method. Nucleotide sequence analysis of this gene revealed an open reading frame (ORF) of 1254 base pair (bp) encoding a 417 amino acid (aa) protein. The primary amino acid sequence alignment search in the database revealed a moderate homology between the deduced amino acid sequence and other creatinase. The sequence has been submitted to Genbank with the accession number EU004199. ß 2008 Elsevier Ltd. All rights reserved.
Keywords: Creatinase CODEHOP PCR Genome walking Nucleotide sequence Arthrobacter
1. Introduction Creatine amidinohydrolase (creatinase, EC 3.5.3.3) is an important enzyme for creatinine concentration determination in biological fluids to evaluate renal damage. It was first characterized in 1950 by Roche et al. [1], who made the finding of the phenomenon that the creatine was metabolized to urea in two Pseudomonads strains (Ps. eisenbergii and ovalis). This phenomenon was explained by Appleyard and Woods [2] through the illumination of the creatine catabolism pathway in Ps. pvalis. Yoshimoto et al. [3] purified and crystallized the creatinase from Ps. putida, and later on the creatinase active sites were deduced on base of the crystal model [4,5]. The active sites were found to be conserved in creatinases from different microorganisms, while residues in the N terminal was found to determine the specific activity level. The highest specific activity of purified native
creatinase ever reported was about 9 U/mg protein, which may be improved up to 16 U/mg protein by a modified cell split method in Escherichia coli (E. coli) [6]. Recent researches mainly focused on the detection of creatinine by biosensors [7], while reports about newly discovered creatinase was only a few. As an enzyme for clinical applications, activity is an important property. In previous work, an Arthrobacter nicotianae strain 02181 that produced high activity creatinase was isolated in our laboratory. We purified and characterized the creatinase from A. nicotianae 02181 in the present study, and the creatinase gene was cloned for a better understanding of its high activity. To our best knowledge, the activity of this creatinase is much higher than those from other microorganisms ever reported, and this research may contribute to both clinical applications and deeper understanding of the mechanism involved in enzyme activity. 2. Materials and methods 2.1. Bacterial strains and plasmids
* Corresponding author. Tel.: +86 23 68752314. E-mail address: [email protected] (C. Hu). 1 These authors contribute equally to this work. 1359-5113/$ – see front matter ß 2008 Elsevier Ltd. All rights reserved. doi:10.1016/j.procbio.2008.12.014
Strain 02181 was isolated from soil using creatinine as the unique organic source. Sample collected were plated onto solid agar plate containing (g/l): creatinine 5, MgSO47H2O 0.5, K2HPO4 1.0, KCl 5.0, glucose 20 and agar 15. Plates
Q. Zhi et al. / Process Biochemistry 44 (2009) 460–465 Table 1 Mediums used to determine essential organics for cell growth and enzyme yield. Mediums
Components(1 l)
MA MB MC MD ME MF MG
Basic Basic Basic Basic Basic Basic Basic
a
saltsa + creatinine 5.0 g salts + peptone 5.0 g salts + creatinine and peptone 5.0 g each salts + creatinine and sodium nitrate 5.0 g each salts + creatinine 5.0 g and glucose 20.0 g salts + sodium nitrate 5.0 g and glucose 20.0 g salts + creatinine and peptone 5.0 g each, glucose 20.0 g
Basic salts consist of MgSO47H2O 0.5 g, K2HPO4 1.0 g and KCl 5.0 g.
were incubated at 28 8C until colonies reached 2 mm. Single colonies were inoculated into liquid medium (M1, as same as solid plate but agar) separately for 24 h incubating at 28 8C and those that may produce urea were picked out for another round of screening. Finally, a strain with the highest urea production (02181) was obtained. Based on morphological and physiological characteristics and 16S rRNA gene homologies, it was identified to be a member of the genus A. nicotianae. E. coli DH5a strain (Novagen) and plasmid pGEM-T (Promega) were used for gene cloning. 2.2. Cultivation and media A. nicotianae 02181 was cultivated in medium M1 under temperatures ranged from 25 to 35 8C to determine the optimized temperature for enzyme production. It was also cultivated in mediums (MA–MG, Table 1) consisted of different organic sources to determine what was essential for enzyme activity and productivity. 2.3. Chemicals and reagents Creatine, creatinine, lysozyme, Pfu DNA polymerase and streptomycin were purchased from Promega. Restriction enzymes were from TOYOBO. Glutathione, 2diethylaminoethyl-cellulose (DEAE-cellulose) was purchased from Sigma; hydroxylapatite (HA) was purchased from Shanghai Bio Life Science and Technology Ltd. GSTrapTMFF column was a product of Amersham. Oligonucleotide primers were synthesized by Invitrogen Co., Ltd. (China). 2.4. Creatinase activity assay Specific enzyme activity of creatinase was determined according to the method set up by Yoshimoto et al. [3] 0.1 ml enzyme solution was added into a 0.9 ml 50 mM potassium phosphate buffer (PBS, pH7.0) containing 100 mM creatine as substrate. After 10 min incubation at 37 8C, 2.0 ml p-dimethylaminobenzaldehyde solution (2.0 g p-dimethylaminobenzaldehyde dissolved in 100 ml dimethylsulfoxide, then 15 ml HCl stock added) was added to stop the reaction by incubation at 25 8C for 20 min and absorbance was measured against the blank at 435 nm. Protein concentration was determined by the method described by Lowry et al. [8]. One unit of enzyme activity was defined as the amount of enzyme that catalyzed the synthesis of 1 mmol of the urea per minute under the conditions described in this section. 2.5. Purification of native creatinase After cultivation, cells were resuspended with a buffer containing 3 mM EDTANa2, 23 mM K2HPO4 and 7.6 mM NaN3 (pH 7.2) and lysed by lysozyme and a subsequent supersonic operation. Cell lysate was centrifuged at 13,000 rpm for 20 min at 4 8C, and the supernatant was removed into a new tube. Then streptomycin was added to 200 mg/ml. To remove nucleic acids, polycoses and somatic proteins, and supernatant after a centrifugation at 13,000 rpm for 30 min at 4 8C was loaded onto a DEAE-cellulose column preequilibrated with binding buffer (50 mM PBS, pH 7.2). The column was washed with NaCl in linear gradient (0–1 M) and creatinase activity of eluted fractions was tested. Fractions showing creatinase activity were mixed together and applied to the HA column preequilibrated with 10 mM PBS (pH 7.2), and then the column was washed with K3PO4 in linear gradient (20–400 mM). Eluted fractions were collected and analyzed by sodium dodecyl sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and PAGE, and specific creatinase activities were tested separately. 2.6. Kinetics parameters The purified enzyme was incubated with different concentrations of creatine (10–100 mM) in 100 mM PBS (pH 7.2) at 37 8C, and enzyme activity was measured at different spots of time. Each reaction was performed in triplicate and the reaction rates obtained were fitted to Michaelis–Menten kinetics.
461
2.7. Effect of pH and temperature on enzyme activity and stability The purified creatinase was dialyzed against 50 mM citrate buffer (pH 3.0–6.0), 50 mM PBS (pH 6.0–8.0) or 50 mM borate buffer (pH 8.0–10.5), and then enzyme activities were tested according to the method described in Section 2.4 with pH adjusted correspondingly to determine the optimum pH. Enzyme stability in these buffers was evaluated by fluorescence spectroscopy and circular dichroism (CD) assay. In the fluorescence spectroscopy assay, the creatinase was diluted to 5 mg/ ml with corresponding buffers and then the fluorescence emissions were scanned from 300 to 500 nm under the excitation wavelength of 280 nm. In the CD assay, the concentration of creatinase was 50 mg/ml and the wavelength was 190– 260 nm. The optimum temperature for creatinase activity was determined by testing enzyme activity at temperatures from 15 to 60 8C according to Section 2.4, and effect of temperatures on enzyme stability was studied by fluorescence spectroscopy and CD assay. Briefly, the purified creatinase was diluted with 50 mM PBS (pH 7.0) to 5 and 50 mg/ml for fluorescence spectroscopy and CD assay, respectively, and tests were taken using the same wavelength as that in pH assay after having incubated for 15 min from 4 to 80 8C. 2.8. Effect of inhibitors and metal ions on enzyme activity The effect of enzyme inhibitors were studied in 50 mM PBS (pH 7.0) containing SDS, Brij35, Triton X-100 or NaN3 et al at a final concentration of 5 g/l or EDTA at 1 mM, respectively. Purified enzyme was pre-incubated with inhibitors at 37 8C for 30 min and the residual activity was measured by the method described in Section 2.4. The influence of various metal ions (Ca2+, Mg2+, Mn2+, Cd2+, Zn2+, Fe3+, Hg2+ and Cu2) was studied by testing residual enzyme activity after incubating for 30 min in 50 mM PBS (pH 7.0) containing 1 mM metal ion at 37 8C. 2.9. Cloning of creatinase gene by CODEHOP PCR and genome walking Genomic DNA of A. nicotianae 02181 was prepared by the CTAB method [9]. Oligonucleotide primers in CODEHOP PCR (P1-1, P1-2, P2-1, P2-2, P3-1 and P32, Table 2) were designed according to conservative gene blocks by the program CODEHOP2 following the method described by Rose et al. [10]. The PCR procedure was as follows: initial denaturation at 95 8C for 2 min and 30 cycles of 90 s at 95 8C, 60 s at 55 8C, 60 s at 72 8C, followed by additional 5 min at 72 8C. DNA fragments were recovered, subcloned in to the pGEM-T vector and sequenced. After a partial creatinase gene obtained, specific primers (GSP1u, GSP1d, GSP2u and GSP2d, Table 2) were designed for subsequent genome walking [11–13] using the BD GenomeWalkerTM Universal Kit (Takara) and BD AdvantageTM II PCR Kit (Takara). Genomic DNA of 02181 was digested by restriction enzymes DraI, PvuII, EcoRV or StuI, respectively to serve as templates for the primary and the secondary PCR amplification. The primary PCR procedure was as follows: initial denaturation at 95 8C for 2 min, 7 cycles of 25 s at 95 8C, 3 min at 72 8C, and 32 cycles of 25 s at 95 8C, 3 min at 67 8C. Primary PCR products were diluted 50 times as templates for the secondary PCR. The secondary PCR was similar to the primary PCR except for a reduction of 2 and 12 in cycle numbers. All PCR products were analyzed by electrophoresis in 1.5% agarose gels and DNA fragments of interest were cloned into pGEM-T vector and sequenced. 2.10. DNA sequence analysis DNA sequencing was carried out with the dideoxy-chain termination method [14] by using an ABI Prism 377 Genetic Analyser (Applied Biosystems). DNAStar (Lasergene), Vector NTI 8.0 (InforMax Inc.) and Primer Premiers 5.0 (PREMIER Biosoft international) software were employed to analyze the DNA sequence. 2.11. Nucleotide sequence accession number The nucleotide sequence reported in this study has been submitted to the GenBank database with the accession number EU004199.
3. Results 3.1. Effect of cultivation conditions on enzyme activity Studies were first carried out to optimize the medium for the growth and the production of enzymes, and the most appropriate medium (MC) for the protease production is composed of (g/l): MgSO47H2O 0.5, K2HPO4 1.0, KCl 5.0, creatinine 5.0 and peptone 5.0. It was very interesting to notice that A. nicotianae 2 The program was provided on http://bioinformatics.weizmann.ac.il/blocks/ blockmkr/www/make_blocks.html.
462
Q. Zhi et al. / Process Biochemistry 44 (2009) 460–465
Table 2 Primers for CODEHOP PCR and genome walking in creatinase gene cloning from A. nicotianae 02181. Namea
Oligonucleotide sequence
P1-1 P1-2 P2-1 P2-2 P3-1 P3-2 AP1 AP2 GSP1u GSP1d GSP2u GSP2d
50 TCCTTCGACGACAACATCGTntayacngayt30 50 AAGTTGTCCCGCTGCcartcngtrta30 50 CGAGTTCATGGACACCTGGryntggttyca30 50 TGCCGGACTGGaaccanrycca30 50 GCCGGCGGCTACCGngarcaygaya30 50 CGTTCTCGTTGATGACCAGGAtrtcrtgytcnc30 50 GTAATACGACTCACTATAGGGC30 50 ACTATAGGGCACGCGTGGT30 50 ATCTTCTCGCGGGTCAGGCCCGGCAGG30 50 CGAAATCGCCAAGACCTTCCCGCACCGC30 50 CGATGCGCGAGGCCTTCACTCCATCGC30 50 GCGACACCTGGACCTGGTTCCAGTCCGG30
a Primers P1-1, P1-2, P2-1, P2-2, P3-1 and P3-2 were designed on conservative creatinase gene blocks from Alcaligenes sp. (AB016788), Arthrobacter sp. TE1826 (AB007122), Bacillus sp. B-0618 (D14463), Flavobacterium sp. U-188 (D00656), Pseudomonas putida (AF072304) and Rhodobacter sphaeroides (NC_009428) for CODEHOP PCR, and each primer consisted of specific regions in upper case and degenerate regions in lower case. Primers AP1, AP2, GSP1u, GSP1d, GSP2u and GSP2d were used in genome walking. AP1 and AP2 were provided in the BD GenomeWalkerTM Universal Kit (TAKARA), and GSP1u, GSP1d, GSP2u and GSP2d were designed according to the 281 bp sequence obtained in CODEHOP PCR.
02181 may live in the medium using creatinine as the unique organic source, and cell growth was greatly improved when glucose was added in the medium while enzyme yield greatly reduced (Fig. 1B). Influence of temperature on cell growth was observed by cultivation under different temperatures, and the optimized temperature was 28 8C according to cell growth curve (Fig. 1A). 3.2. Purification of native creatinase of A. nicotianae 02181 Native creatinase from A. nicotianae strain 02181 was purified after cells cultivated in the medium MC according to the method described in Section 2.4. Specific creatinase activities of the fractions obtained in each purification step were tested (Table 3) and it was found that the activity of the purified creatinase from A. nicotianae 02181 was 124.4 U/mg protein, about 13 folds of those ever reported from other source. Purified native creatinase was analyzed by SDS-PAGE and PAGE analysis, and it was found to be a dimmer formed by two identical single monomers with a relative molecular weight of 46.4 kDa (Fig. 2).
Fig. 1. Effect of cultivation conditions on cell growth and enzyme production. (A) Cell yields and creatinase productivities in mediums MA–MG. Cells were cultivated in mediums MA–MG (Table 1) at 28 8C with continuous shaking of 200 rpm for 24 h. Cell yields and creatinase activities were tested subsequently. (B) Cell growth curve under different temperatures in medium M1. Cells were cultivated in M1 for 24 h with continuous shaking of 200 rpm.
3.3. Characteristics of creatinase from A. nicotianae 02181
Using primers P1-1 and P2-2 with the strategy of CODEHOP PCR, a 281 bp partial sequence of the creatinase gene from A. nicotianae 02181 has been cloned first. A genome walking at the base of that sequence was carried out, and a 361 bp and a 2 kb segment were obtained in the 50 upstream genome walking while segments obtained in the 30 downstream walking were 2 kb and 400 bp. They were sequenced and segments that showed high homology to creatinase by BLASTx analysis were picked out. The creatinase gene was then assembled using Vector NTI 8.0 and DNAstar, and a sequence of 2100 bp has been obtained.
The rates of creatine hydrolysis obeyed to Michaelis–Menten kinetics over the concentration of the substrate examined. Michaelis–Menten constant (Km) for this enzyme was calculated as 46.5 mM, and Vmax was 8.2 mM/min. Optimum pH and temperature for enzyme activity were studied and results were shown in Fig. 3A and B, respectively. The optimized pH was about 7.0, and enzyme activity decreased sharply when pH was above 8.0 or below 6.0. And the creatinase activity could be maintained mostly from 25 to 45 8C. Enzyme stabilities under different pH and temperatures were studied by fluorescence spectroscopy (Fig. 4A and B) and CD assay (Fig. 4C and D). The enzyme was found to be relatively stable between pH 6.0 and 9.0 below 45 8C, in which both the secondary and third structure maintained stable. The effect of a variety of enzyme inhibitors and metal ions on the activity of creatinase was investigated (Table 4). Enzyme activity would be greatly inhibited by Hg2+, Zn2+ and Fe3+, and it lost completely with the existing of SDS and Cu2+. Ca2+ and NaN3
were found to be helpful for enzyme activity while effect of EDTA was not very significant. 3.4. Cloning of creatinase gene from A. nicotianae 02181
Table 3 Purification of native creatinase from A. nicotianae 02181. Procedure
Input (U)
Output (U)
Yield (%)
Specific activity (U/mg protein)
Fold
Crude enzyme DEAE-cellulose Hydroxylapatite
– 8400 2750
– 7566 1456
– 90.08 52.95
1.0 8.70 124.44
– 8.70 124.44
Q. Zhi et al. / Process Biochemistry 44 (2009) 460–465
463
moderate homology between the deduced peptide and creatinases form other microorganisms (Fig. 5B). The sequence identity index between creatinase from Arthrobacter sp. FB24 (YP_833203) and deduced 02181 peptide was the highest among the strains listed above, having the value of 87%. Align analysis of this deduced protein and creatinase from Ps. Putida indicated that amino acid residues involved in creatinase function does exist in the deduced 02181 peptide. Bioinformatics analysis indicated that the molecular weight of this deduced 02181 polypeptide was 46,268, which was identical with the result of SDS-PAGE of the native creatinase from A. nicotianae 02181. 4. Discussion
Fig. 2. 15% SDS-PAGE analysis of purified native creatinase from A. nicotianae 02181. Lane M, protein molecular weight marker. Lane 1, purified native creatinase from A. nicotianae 02181.
3.5. Nucleotide and amino acid analysis Bioinformatics analysis of the 2100 bp creatinase gene revealed an ORF of 1254 bp in length. It was predicted to encode a polypeptide (designated creatinase) of 417 amino acids, which started from an ATG codon and ended with a TAA stop codon (Fig. 5A). A Shine Delgarno sequence (AAGGAG) was observed at 9–14 bp upstream from the ATG codon. Analysis of the sequence of the initiation codon allowed us to identify a presumable promoter region, TTGACA for the 35 and GTCTAA for the 10 sequences, respectively. An inverted repeat sequence for the transcription termination exists at 16 bp downstream from the end of the ORF. BLASTing the protein sequence deduced from the ORF against the NCBI databases predicted the peptide to be a member of creatinase. Amino acid sequence homology analysis revealed
Creatinase has been found in Alcaligenes [15], Actinobacillus [16], Arthrobacter [17], Flavobacterium [18], Bacillus [19,20], Candidatus [21], Paracoccus [22] and Pseudomaonas [9,23,24], etc. There was no report about these strains that may live in the medium without organic source except for creatinine. The reason for this might be that these strains could not synthesize one or two of the other two enzymes, creatininase and sarcosine oxidase, which are essential for creatinine hydrolysis. The A. nicotianae 02181 strain may utilize creatinine as the unique organic source to fulfill its base need, although creatinine is not an efficient nitrogen source compared with peptone. The contrast in cell growth and enzyme yield when glucose was added in to the medium indicated that there must be two metabolic pathways regulated by glucose and creatinine separately, and the pathway regulated by glucose as substrates should be more efficient than that of creatinine (Fig. 1A). In other words, there should be promoters regulated by glucose and creatinine in A. nicotianae 02181, and the promoter regulated by glucose must be more active than that of creatinase. The maximum native creatinase specific activity ever reported was about 9 U/mg protein [5,22], while the activity of creatinase purified from A. nicotianae 02181 was about 13fold of the maximum value ever reported. We had attributed the mechanism for the character of high activity to mutations in the active sites, but the assumption was denied after the sequence of the creatinase gene had been obtained. We made an alignment of the creatinase from A. nicotianae 02181 and Pseudomonas putida, whose crystal model had been built [4,5].
Fig. 3. Effect of pH and temperature on enzyme activity. The highest enzyme activity was defined as 100%. (A) An aqueous enzyme solution was incubated with 50 mM citrate buffer (*, pH 3.0–6.0), 50 mM PBS (&, pH 6.0–8.0) or 50 mM borate buffer (~, pH 8.0–10.5), and creatinase activity was measured by the method described in Section 2.4 with pH adjusted correspondingly. (B) Effect of temperature on enzyme activity. The creatinase activity was tested by the method described in Section 2.4 with temperatures adjusted.
Q. Zhi et al. / Process Biochemistry 44 (2009) 460–465
464
Fig. 4. Enzyme stability under different pH and temperatures revealed by fluorescence spectroscopy and CD assay. The purified creatinase was diluted to 5 mg/ml with buffers of different pH and left at 25 8C for 15 min, or incubated for 15 min from 4 to 80 8C in 50 mM PBS, pH 7.0. Fluorescence emissions were tested from 300 to 500 nm with the excitation wavelength of 280 nm. CD assay was performed by wavelength scan from 190 to 260 nm. (A) Enzyme stability revealed by fluorescence spectroscopy spectrum. Spectrums at pH 4.6 ( ) and 60 8C (– –) were shown in contrast to that of 25 8C, pH 7.0 (—). Results were shown from 300 to 400 nm for a more detailed view. (B) Fluorescence emission of creatinase from the 02181 strain at 333 nm under different pH (&) and temperatures (*). (C) CD spectrum under different pH. (D) CD spectrum under different temperatures.
The active sites of creatinase interpreted in that model include H232, N249, A260, H324, E358 and H376, while none mutation was found in these residues in the creatinase from A. nicotianae 02181. This result conformed the conclusion drew by Hoeffken and Moellering et al., but the degree of the variation in the
Table 4 Effect of inhibitors and metal ions on enzyme activity. Inhibitors and metal ions
Final concentrations
Residual activities (%)a
Ca2+ Mg2+ Mn2+ Cd2+ Zn2+ Hg2+ Fe3+ Cu2+ SDS Brij35 Triton X-100 NaN3 EDTA
1 mM 1 mM 1 mM 1 mM 1 mM 1 mM 1 mM 1 mM 5 g/l 5 g/l 5 g/l 5 g/l 1 mM
103.8 91.08 88.65 63.31 43.98 9.82 2.24 0 0 85.14 87.39 103.64 99.16
a Purified creatinase was pre-incubated with inhibitors or metal ions in 50 mM PBS (pH 7.0) at 37 8C for 30 min and the residual activity was measured by the method in Section 2.4. Activity in the buffer without inhibitors and metal ions was set as 100%.
sterical structure induced by mutations around the creatinase active sites is not sure. Inhibition of SDS to enzyme activity indicated that sterical structure was crucial for creatinase activity, and it has also been confirmed by the reduction of activity in recombinant creatinase monomer. Several combinations of different vectors and host cells had been used to prepare a recombinant creatinase dimmer, and result in some combination was very exciting (data not shown). This creatinase was relatively active between pH 6.0 and 8.0 and maintained stable between pH 6.0 and 9.0, which was similar to the creatinase from Paracoccus sp. strain WB1 [22]. However, the method for stability evaluation in this study was different from that of WB1. The fluorescence spectroscopy and CD assay are more direct, and this is the first report to characterize creatinase stability using these techniques. Most behaviors of creatinase from the 02181 strain with enzyme inhibitors were similar with those ever reported except for Fe3+ and SDS. In fact, we have found that Mg2+ and K+ were helpful for creatinase activity when they were added in the culture medium, while Ca2+ and Fe2+ were found to be adverse though cell yield may be improved (data not shown). In this study we just report the high activity creatinase and its gene sequence from A. nicotianae 02181, and further research would be done to find the exact mechanism involved at the base of previous work.
Q. Zhi et al. / Process Biochemistry 44 (2009) 460–465
465
Acknowledgements This study was supported by the Scientific Research Foundation of Third Military Medical University (2004) and National Natural Science Foundation of China (Grant no. 30570373). References [1] Roche J, Lacombe G, Girard H. On the specificity of certain bacterial deguanidases generating urea and on arginindihydrolase. Biochem Biophys Acta 1950;6:210–6. [2] Appleyard G, Woods DD. The pathway of creatine catabolism by Pseudomonas ovalis. J Gen Microbiol 1956;14:351–65. [3] Yoshimoto T, Oka I, Tsuru D. Purification, crystallization, and some properties of creatine amidinohydrolase from Pseudomonas putida. J Biochem (Tokyo) 1976;79:1381–4. [4] Hans M, Lorenz R, Gu¨nter S. Enzymatic mechanism of creatine amidinohydrolase as deduced from crystal structures. J Mol Biol 1990;214:597–610. [5] Hoeffken HW, Knof SH, Bartlett PA, Huber R, Moellering H, Schumacher G. Crystal structure determination, refinement and molecular model of creatine amidinohydrolase from Pseudomonas putida. J Mol Biol 1988;204:417–33. [6] Chen YC, Chen LA, Chen SJ, Chang MC, Chen TL. A modified osmotic shock for periplasmic release of a recombinant creatinase from Escherichia coli. Biochem Eng J 2004;19:211–5. [7] Ramanavicius A. Amperometric biosensor for the determination of creatine. Anal Bioanal Chem 2007;387:1899–906. [8] Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem 1951;193:265–75. [9] Hong MC, Chang JC, Wu ML, Chang MC. Expression and export of Pseudomonas putida NTU-8 creatinase by Escherichia coli using the chitinase signal sequence of Aeromonas hydrophila. Biochem Genet 1998;36:407–22. [10] Rose TM, Henikoff JG, Henikoff S. CODEHOP (Consensus-Degenerate Hybrid Oligonucleotide Primer) PCR primer design. Nucleic Acids Res 2003;31:3763–9. [11] Jones DH, Winistorfer SC. Genome walking with 2 to 4 kb steps using panhandle PCR. PCR Methods App 1993 l;2:197–203. [12] Rosenthal A, Jones DS. Genomic walking and sequencing by oligo-cassette mediated polymerase chain reaction. Nucleic Acids Res 1990;18:3095–101. [13] Shyamala V, Ames GF. Genome walking by single-specific-primer polymerase chain reaction: SSP-PCR. Gene 1989;84:1–8. [14] Sanger F, Nicklan S, Coulson AR. DNA sequencing with chain termination inhibitors. Proc Natl Acad Sci 1997;74:5463–7. [15] Matsuda Y, Wakamatsu N, Inouye Y, Uede S, Hashimoto Y, Asano K, Nakamura S. Purification and characterization of creatine amidinohydrolase of Alcaligenes origin. Chem Pharm Bull 1986;34:2155–215. [16] Padmanabhan B, Paehler A, Horikoshi M. Structure of creatine amidinohydrolase from Actinobacillus. Acta Crystallogr D Biol Crystallogr 2002;58:1322–30. [17] Nishiya Y, Toda A, Imanaka T. Gene cluster for creatinine degradation in Arthrobacter sp. TE1826. Mol Gen Genet 1998;257:581–7. [18] Koyama Y, Kitao S, Yamamoto OH. Cloning and expression of the creatinase gene from Flavobacterium sp. U-188 in Escherichia coli. Agric Biol Chem 1990;54:1453–60. [19] Sugiyama M, Yuasa K, Kumagai T, Kinoshita E, Matsuo H, Nishimura M, et al. Gene technology to overproduce the enzymes useful as diagnostic reagents. Rinsho Byori 1995;43:765–71. [20] Suzuki K, Sagai H, Sugiyama M, Imamura S. Molecular cloning and high expression of the Bacillus creatinase gene in Escherichia coli. J Ferment Bioeng 1993;76:77–81. [21] Giovannoni SJ, Tripp HJ, Givan S, Podar M, Vergin KL, Baptista D, et al. Genome streamlining in a cosmopolitan oceanic bacterium. Science 2005;309:1242–5. [22] Wang YY, Ma XH, Zhao WF, Jia XM, Kai L, Xu XH. Study on the creatinase from Paracoccus sp. strain WB1. Process Biochem 2006;41:2072–7. [23] Chang MC, Chang CC, Chang JC. Cloning of a creatinase gene from Pseudomonas putida in Escherichia coli by using an indicator plate. Appl Environ Microbiol 1992;5810:3437–77. [24] Yamamoto K, Oka M, Kikuchi T, et al. Cloning of the creatinine amidohydrolase gene from Pseudomonas sp. PS-7. Biosci Biotechnol Biochem 1995;59:1331–3.
Fig. 5. DNA sequence analysis of creatinase gene from A. nicotianae 02181. (A) Nucleotide and deduced amino acids sequence of creatinase from A. nicotianae 02181. Translation initiation codon (ATG) and termination codon (TAA) are positioned at nt +1 and nt +1254, respectively. Regions encoding putative promoter (10 and 35), RBS and transcription termination site are underlined. Creatinase active sites were marked with &. The accession number of this gene in Genbank was EU004199. (B) Sequence alignment of creatinases from A. nicotianae 02181, Arthrobacter sp. FB24 (YP_833203), Bacillus sp. B-0618 (BAA03358), Rubrobacter xylanophilus DSM 9941 (YP_643247), Burkholderia phymatum STM815
(YP_001862364), Ps. Putida (P38488) and Candidatus pelagibacter ubique HTCC1062 (YP_266109). Sequences were compared using Vector NTI 8.0 software. Those with red foreground and yellow background are with full identity; those strongly similar are heavy blue foreground and light blue background; those with weakly similarity are black foreground and white background. The sequence of A. nicotianae 02181 is used as the consensus sequence. (For interpretation of the references to color in the figure caption, the reader is referred to the web version of the article.)