Biochemical characterization and gene cloning of a novel alkaline endo-1-4-glucanase from Bacillus subtilis DR8806

Accepted Manuscript Title: Biochemical characterization and gene cloning of a novel alkaline endo-1-4-glucanase from Bacillus subtilis DR8806 Author: Somayeh Ramezani Ahmad Asoodeh PII: DOI: Reference:

S1381-1177(16)30119-9 http://dx.doi.org/doi:10.1016/j.molcatb.2016.07.004 MOLCAB 3395

To appear in:

Journal of Molecular Catalysis B: Enzymatic

Received date: Revised date: Accepted date:

3-11-2015 4-7-2016 4-7-2016

Please cite this article as: Somayeh Ramezani, Ahmad Asoodeh, Biochemical characterization and gene cloning of a novel alkaline endo-1-4-glucanase from Bacillus subtilis DR8806, Journal of Molecular Catalysis B: Enzymatic http://dx.doi.org/10.1016/j.molcatb.2016.07.004 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Biochemical characterization and gene cloning of a novel alkaline endo-1-4-glucanase from Bacillus subtilis DR8806 Somayeh Ramezani a, Ahmad Asoodeh a,b,* a

Department of Chemistry, Faculty of Science, Ferdowsi University of Mashhad,

Mashhad, Iran b

Institute of Biotechnology, Ferdowsi University of Mashhad, Mashhad, Iran

*

Corresponding Author: [email protected]

Tel/Fax: +98 51 38796416

1

(%) activity(%) Relativeactivity Relative

120 120 100 100 80 80 60 60 40 40 20 20 00

B. subtilis DR8806 producing CMCase

Control Control Barf Barf Shoma Shoma Softlan Softlan Darya Darya Finish Finish Persil Persil Vash Vash Prill Prill Gang Gang

Graphical abstract

Commerical Commerical detergents detergents

CMCase assay

Purification

2

Characterization and Gene cloning

Research Highlights

 A 52 kD- endo-β-1, 4-glucanase was purified from Bacillus subtilis DR8806.  The enzyme revealed optimal pH and temperature of 9.5 and 55 ºC.  Some organic solvents (20% v/v) stimulated glucanase activity.  Glucanase was a β 1-4 glycosyl hydrolase family 5 with a CBM-3 at its N terminus.  Three- structure modeling of the enzyme showed two Glu residues at active site.

Abstract In the present study, an endo-1-4-glucanase was isolated from Bacillus subtilis DR8806. The enzyme was purified to homogeneity via salt precipitation and ionexchange chromatography. SDS-PAGE analysis revealed a molecular mass of 52 kDa. Optimum pH of enzyme was 9.5 and the enzyme was stable at pH range of 8.5 to 10.5. The optimum temperature of enzyme was found to be 55 ºC and it showed a remarkable stability at temperatures between 40-60 ºC. The enzyme activity was stimulated by Co2+, K+, Mg2+, Ca2+ and Na+ ions while Hg2+, Mn2+, Pb2+ and Zn2+ ions were found to inhibit the enzyme activity. The enzyme activity was decreased by increasing in concentration of β-mercaptoethanol, EDTA, SDS, PMSF and Triton X-100. Organic solvents such as hexane, 2-propanol, acetone and ethanol (20% v/v) stimulated enzyme activity by 110%, 114%, 119% and 128%, respectively. Imidazolium-based ionic liquids (ILs) had inhibitory effects on endo-1-4-glucanase activity. Using carboxymethyl cellulose as substrate, kinetic parameters of Km apparent and Vmax were calculated to be 1.49 % (W/V) and 66.66 µM min-1 mg-1, respectively. Endo-1-4-glucanase coding gene of B. subtilis DR8806 was identified

3

by T/A cloning. The computational modeling of endo-1-4-glucanase showed that two Glu residues are at active site. Our results suggest that the enzyme has great of potential applications in hydrolyzing cellulosic substrates. Keywords: Endo-1-4-glucanase; Biochemical characterization; Gene cloning

4

1. Introduction Cellulose, a linear polysaccharide of D-glucose residues linked by 1,4-β-Dglycosidic bonds, is a major constituent of plant cell walls and the most abundant organic compound in the biosphere [1]. Principally, a cellulosic enzyme system is classified into three main groups: exoglucanases (EC 3.2.1.91) (degrade cellobiose residues from the non-reducing end of glucan), endoglucanases (EC 3.2.1.4) (cleave β-1,4-glycosidic bonds from chain ends and internally within chains, respectively) and β-glucosidases (EC 3.2.1.21) (cleave the final β-1,4 linkage of cellobiose or small polysaccharides). The cooperative action of the constituent enzymes hydrolyzed crystalline cellulose to smaller oligosaccharides and finally to glucose. These enzymes act sequentially in the synergistic system and subsequently convert cellulose into an utilizable energy source and glucose; hence, cellulases provide a key role in biomass utilization [2]. Several microorganisms including bacteria, fungi and protozoa have been found to produce a variety of cellulases for the degradation of cellulose. Although fungi are the most common producer of cellulase, bacterial enzymes are of great significance, since their enzyme production rate is normally higher due to the higher bacterial growth rate compared to fungi. Bacterial cellulases are also more effective catalysts. They may be less inhibited by the presence of material that has already been hydrolyzed. The greatest potential importance of bacteria is that they can be genetically engineered [3]. Moreover, bacterial cellulases are constitutively produced, whereas fungal cellulases are inducible [4]. Cellulolytic bacteria have been isolated from many different sources including the rumen soils, compost, municipal solid waste, sewage sludge and hot mineral springs [5]. Among microorganisms, Bacillus sp. produces various extracellular enzymes of industrial importance including cellulases [6]. A variety of Bacillus species secrete cellulases 5

including strains of B. subtilis [7], B. licheniformis [8], B. pumilus [3], B. flexus [9], B. sp. KSM-330 [10] and alkaliphilic Bacillus [11]. A fairly common observation has been that bacilli lack a complete cellulase system with primary activity being on carboxymethyl cellulose (CMCase, endoglucanase) and do not hydrolyze crystalline cellulose. However, in contrast, there are reports of certain Bacillus endoglucanases (CMCase) that have shown detectable activity on microcrystalline cellulose [12]. Cellulases are widely used in industrial processes such as bioethanol generation, realistic long-term energy source, textile finishing, formulation of washing powders, extraction of fruit and vegetable juices as well as starch processing [13]. In the present study, purification and biochemical characterization of a cellulase from Bacillus subtilis DR8806 formerly isolated from Dig Rostam hot mineral spring was reported. Furthermore, DR8806 cellulase-encoding gene was isolated using specific primers and three structure of the enzyme was predicted by molecular modeling. 2. Materials and methods 2.1. Bacterial growth and plasmid preparation A cellulolytic bacterium was previously isolated from Dig Rostam hot mineral spring in Iran. The strain was identified as Bacillus subtilis based on the 16S rDNA gene sequence (GenBank: JF309277) and has been deposited in Iranian Biological Resource Center under acquisition number of IBRC-M10742. The bacterial strain was grown in nutrient agar at 37 °C and sub-cultured every 2 weeks. A loopful of culture from the nutrient agar was transferred to 10 ml of nutrient broth. The culture was incubated overnight at 37 °C with 120 rpm shaking. 250 µl of the culture inoculum was transferred to 1000 ml Erlenmeyer flask containing 250 ml of cellulolytic medium containing (g/l) CMC, 10; peptone, 5; yeast extract, 5; K2HPO4, 6

1; MgSO4.7H2O, 0.25 ;FeSO4.7H2O, 0.25 and MnCl2.4H2O, 0.5. The pH of the medium was adjusted to 7.0 before autoclaving [14]. E. coli DH5α was used as cloning host. The E. coli strains were cultivated in LuriaBertani (LB; 1.0% tryptone, 0.5% yeast extract and 1.0% NaCl) medium at 37 °C. B. subtilis DR8806 was served as the source of genomic DNA. The plasmid pTZ57R/T (Fermentas, Maryland, USA) was used for sequencing of cellulase gene.

2.2. Purification of cellulase from Bacillus subtilis DR8806 Following 36 h of cultivation in specific production medium, the culture medium was centrifuged at 5, 000 × g for 10 min at 4 °C. Ammonium sulfate was added to the crude culture supernatant (85% saturation) at 4 °C for 5 h. The precipitates were centrifuged at 10,000×g for 15 min at 4 °C and the pellets were dissolved in minimum volume of 20 mM Tris buffer, pH 7.4. The concentrated enzyme was then dialyzed overnight against the same buffer at 4 °C. This solution was applied to QSepharose column (3 cm×10 cm) at a flow rate of 1 ml/min, previously equilibrated with 20 mM Tris, pH 7.4. Proteins were eluted with a linear gradient of 0.1-1.0 M NaCl under the same conditions. The active fractions were collected and dialyzed against Tris- HCl 0.05 M pH 9.5 for subsequent studies.

2.3. Determination of enzyme activity and protein concentration Cellulase activity was measured according to the method of Miller [15]. Endo-β-1,4glucanase activity of enzymes was measured by incubating 0.05 ml of enzymatic sample with 0.5 ml of 1 % (w/v) carboxymethyl cellulose (molecular weight; 90 kDa, medium viscosity) in Tris-HCl buffer (0.05 M, pH 9.5). The mixture was then incubated at 55 °C in a shaking water bath for 30 min. The reaction was terminated 7

by adding 2 ml of DNS (3,5-dinitrosalicylic acid) reagent. The colour was then developed by boiling the mixture for 15 min. The absorbance of samples was measured at 540 nm against a blank containing all the reagents minus the crude enzyme. One unit of CMCase activity was defined as the amount of enzyme required to liberate 1 µmol reducing sugar as D-glucose in 30 min. Protein concentration was measured by the method of Bradford using bovine serum albumin as a standard, in the final step and also during the purification procedure [16].

2.4. SDS-PAGE and Zymogram analysis Denaturing sodium dodecyl sulphate/polyacrylamide gel electrophoresis (SDSPAGE, 12%) was performed to determine the molecular mass of DR8806 cellulase based on the methods of Laemmli [17]. Subsequently, the protein bands were visualized by coomassie brilliant blue R250. Endo-1-4-glucanase activity bands were detected using the zymography method. A 12-percent sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) gel was prepared for zymogram analysis by adding 1% CMC (W/V) before polymerization. Proteins in samples (100 µg) were made soluble in (20 μl) of sample buffer (15.5 ml of 1 M Tris-HCl pH 6.8, 2.5 ml of a 1% solution of bromophenol blue; 7.0 ml of water; and 25 ml of glycerol). After electrophoresis the gels were first washed with 2.5% (w/v) of Triton X-100 for 1 h, and then washed in citrate-phosphate buffer (50 mM KH2PO4, 50 mM citric acid pH 5.2) for 1 h, thereupon incubated at 37 °C for 6 h in the same buffer. After staining with 0.1% (w/v) congo red for 15 min, the gels were further washed with 1 M NaCl until the endoglucanase band becomes visible.

2.5. Effect of pH on enzyme activity and stability

8

pH profile of purified enzyme was determined using the following buffers (50 mM): sodium acetate buffer (pH 3.0-5.5), sodium phosphate buffer (pH 6.0-7.5), Tris-HCl buffer (pH 8.0-9.5) and glycine-NaOH buffer (pH 10.0-12.5). The enzyme stability at various pH values was examined by incubating the enzyme solution with these buffers at 37 °C for 60 min prior to incubation with substrate.

2.6. Effect of temperature on enzyme activity and stability The optimum temperature of the purified endo-1-4-glucanase was determined by performing the standard enzyme assay at different temperatures: 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75 and 80 °C in 0.05 M Tris-HCl buffer (pH 9.5). To determine the enzyme thermal stability, the crude enzyme was incubated (without substrate) at 25 to 80 °C for 60 min and then the sample tube was cooled. The residual enzyme activity was determined as formerly described. To determine the enzyme half-life, DR8806 endoglucanase enzyme was incubated at different temperatures ranging from 45 to 65 °C; the residual activity was assessed at 30 min intervals over a total period of 150 min.

2.7. Enzyme activity towards organic solvents and ionic liquids (ILs) The effect of organic solvents on endo-1-4-glucanase activity was determined following pre-incubation of enzyme for 30 min at 25 °C under 150 rpm shaking in the presence of methanol, acetone, hexane, heptane, toluene, ethanol, chloroform, isopropanol, diethyl alcohol, butanol and isoamyl alcohol (10% v/v and 20% v/v). The incubation was conducted in closed screw cap tubes with silicone rubber gasket in order to prevent evaporation of the enzyme reaction.

9

The effect of imidazolium-based ILs on enzyme activity was investigated after a 30 min-pre incubation of the purified enzyme with different concentrations of ILs (ranging from 2 to 10% v/v) at 55 °C and pH 9.5. The residual enzyme activity was determined under standard assay condition.

2.8. Effect of metal ions on enzyme activity To examine the effect of metal ions on cellulase activity, enzyme assay was performed following pre-incubation of DR8806 endo-1-4-glucanase at 55 °C (optimum temperature) for 30 min in the presence of various metal ions including Ca2+, Mg2+, Zn2+, Cu2+, Na+, Hg+, Ba2+, Mn2+, Fe3+, Co2+, K+, Ni+ and Pb2+ (1, 5 and 10 mM). The enzyme activity of control sample (cellulase without any metal ion) was taken as 100%. Endo-1-4-glucanase activity was measured as previously described.

2.9. Influence of various effectors on enzyme activity The effect of a variety of chemical reagents (1, 5 and 10 mM) on the enzyme activity was investigated by pre-incubating the endo-1-4-glucanase for 30 min at 55 °C in 50 mM Tris-HCl buffer (pH 9.5) containing following chemical agents; oxidizing agents: ammonium persulfate and potassium iodide), reducing agents: ascorbic acid and beta-mercaptoethanol, chelating agents: sodium citrate and EDTA (ethylenediaminetetraacetic acid), detergents: sodium dodecyl sulfate (SDS), CTAB (cetyltrimethylammonium bromide) and Triton X-100, additive: glycerol and inhibitors: PMSF (phenylmethylsulfonyl fluoride) and DTT (dithiothreitol). The enzyme activity without effectors was assumed as 100%.

10

2.10. Effect of commercial detergents on enzyme activity The effect of different commercial detergents on the endo-1-4-glucanase activity was determined. The solid detergents utilized in this study were as follows: Barf (Paxan, Iran), Vash (Henkel, Germany), Softlan (Pakshoo, Iran), Persil (Henkel, Germany), Pril (Henkel,Germany), Shoma (TolyPers, Iran), Finish (Reckitt Benckiser, Canada), Ganj (RaminGostar, Iran) and Darya (TolyPers, Iran). To simulate washing conditions, solid detergents were diluted in tap water up to a final concentration of 5.0 mg ml-1 and then boiled for 60 min for inactivation of enzymes present in detergent. To determine the effect of detergent on the endo-1-4-glucanase activity, the enzyme sample was mixed with detergents solution (1:1) and then incubated under optimum conditions (55 °C and pH 9.5) for 1 h. The residual activity of each sample was then quantified with a control containing no detergent in the reaction mixture.

2.11. Determination of kinetic parameters The enzyme-catalyzed reaction towards hydrolyzing CMC (1% w/v) and avicel (1% w/v) was evaluated under assay conditions. The kinetic constants were determined using carboxymethylcellulose as substrate. The enzyme was assayed at varying substrate concentration from 0.5-2.0%. The Michaelis constant (Km) and the maximum velocity of the reaction (Vmax) were calculated according to LineweaverBurk plot.

2.12. Molecular cloning of cellulase gene A pair of oligonucleotide primers was designed by CLC MainWorkbench version 7 (QIAGEN, Netherland) based on coding sequences for B. subtilis cellulase genes

11

available

at

NCBI

(www.ncbi.nlm.nih.gov).

TCAGATATGAAACGGTCAATC

(Tm

=

The 55.5

cloning °C)

primers and

CTAATTTGGTTCTGTTCCC (Tm = 53.0 °C) were used as forward and reverse primers, respectively. PCR experiments were carried out using the conditions recommended by the manufacturer and the annealing temperatures were chosen based on the melting temperatures of primers. The purified amplicon was cloned into the T/A cloning vector pTZ57R/T in accordance with the manufacturer’s instructions. Competent cells of E. coli DH5α were prepared by using CaCl2 method [18]. Transforming into the E. coli competent cells using heat shock method [18], the cells were cultivated on LB-agar medium containing ampicillin (100 µg/ml). The plasmid DNA was isolated with Fermentas plasmid DNA isolation kit (Fermentas, Maryland, USA). Colony PCR using specific primers and sequencing after plasmid extraction were performed to confirm the presence of the target gene. The nucleotide sequence of B. subtilis DR8806 cellulase gene was determined and submitted to GenBank database. The nucleotide sequence and predicted amino acid sequence were analyzed by the programs of Blast (NCBI). The signal peptide was predicted by the SignalP 4.0 server (http://www.cbs.dtu.dk/services/SignalP/). Enzyme molecular mass and pI were predicted using the ExPASy proteomic server program compute pI/Mw (http://web.expasy.org/compute-pi/). Unrooted phylogenetic tree was constructed using the MEGA-6 program.

2-13 Molecular modeling To identify the disordered regions of a protein, amino acid sequence of endo-1-4glucanase is used. So it is a useful analysis especially when the 3D structure of a protein is not accessible. The protein disorder was predicted using IUPred a

12

conformational disorder prediction server [19-20]. Homology modeling was used for prediction of enzyme structure using Modeller [21].Three methods including PROSITE

[22],

Catalytic

Site

Atlas

[23]

and

EZCAT-BLAST

(http://ezcatdb.cbrc.jp/EzCatDB) [24] were used to check catalytic site for our

sequence.

3. Results and discussion 3.1. Enzyme production and purification A microorganism hydrolyzing carboxymethyl cellulose (CMC) was isolated from Bacillus subtilis DR8806. In this study, CMCase produced by B. subtilis DR8806 was first purified and then biochemically characterized. The cellulolytic activities of B. subtilis DR8806 were investigated by detecting its ability to form halos on CMCcontaining plates (Fig. 1). The enzyme was purified by ammonium sulfate precipitation and Q-Sepharose Fast Flow ion-exchange chromatography. The final preparation was shown to be homogenous and appeared as a single band on SDS-PAGE (Fig. 2a). The molecular mass of the purified CMCase was estimated to be approximately 52 kDa. The molecular mass of the CMCase of Bacillus subtilis DR8806 was larger than those (37-43 kDa) isolated from Bacillus licheniformis AU01 [25], Bacillus sp. CH43 and HR68 [26] and B. circulans [27] and smaller than those (61-130 kDa) produced by Bacillus sp. AC-1 [28], Bacillus sp. No. 1139 [29] and Bacillus sp. KSM-635 [30]. Zymography analysis showed a single band on the gel clearly demonstrating CMCase activity of the isolated enzyme (Fig. 2b). The steps of enzyme purification are summarized in Table 1. A 28-fold purification was achieved with a yield of 4.42%.

13

3.2. Effect of pH on enzyme activity and stability The effect of pH on CMCase activity was examined at various pH values ranging from 6.0 to 11.5. The purified enzyme was not active at acidic pH. The optimum pH was found to be 9.5 which was similar to cellulase enzyme from Bacillus sp. KSM635 (pH 9.5) [30], while less than that of Bacillus sp. C14 (pH 11) [6] and more than that of Bacillus cereus (pH 8) [7]. CMCase activity of the purified cellulase was more than 50% of the maximal level at pH range of 8.5-10. The pH stability of DR8806 cellulase was also examined in the pH range of 6.0 to 11.5. Enzyme stability was found to be high at pH 9.5 with 98% of residual activity. The stability of cellulases in the pH range of 6.0-10.0 is useful in textile industry and detergent formulation as well [31].

3.3. Effect of temperature on enzyme activity and stability The thermal stability of purified cellulase was determined at various temperatures ranging from 25 to 80 °C. The DR8806 cellulase enzyme was active in a range of temperatures (45-65 °C) with an optimum temperature of 55 °C. As the temperature increased (>25 °C), the enzyme activity increased; while the activity started to decline as the temperature increased (>55 °C) and it was completely inactivated at 80 °C. The enzyme optimum temperature was lower than some of other Bacillus strains (65 °C (CH43) and 70 °C (RH68)) [26] while it was similar to cellulases from Mucor circinelloides [32], Trichoderma viride [33], Bacillus cereus [7] and an alkaline Bacillus isolate (55 °C) [34]. The optimum temperature was also higher than that of Bacillus sp. NO. 1139 (40 °C) [29]. More than 80% of the original CMCase activity was maintained at temperatures ranging from 40 to 60 °C after 1 h. The enzyme stability rapidly declined above the aforementioned range. The half-life

14

of the purified cellulase was calculated to be 88 min at its optimum temperature (Fig. 3a). 3.4. Effect of organic solvents and ILs on enzyme activity As illustrated in Table 2, no significant inactivation of DR8806 cellulase was observed in the presence of all tested organic solvents. More than 80% of enzyme activity was retained after incubation with most of organic solvents. Water miscible solvents such as hexane, 2-propanol, acetone and ethanol (20% v/v) stimulated enzyme activity by 110%, 114%, 119% and 128%, respectively. CMCase activity was inhibited by toluene, chloroform and methanol at 20% v/v. Enzyme activity was stimulated in the presence of acetone and hexzan; inhibition of cellulase activity toluene was observed in endoglucanase purified from Bacillus halodurans CAS 1 [30]. DR8806 enzyme was also investigated for its CMCase activity against different 1-alkyl-3-methylimidazolium-based ILs including 1-ethyl-3-methylimidazolium bromide ([EMIM][Br]), 1-n-butyl-3-methylimidazolium bromide ([BMIM][Br]), 1hexyl-3-methylimidazoliumbromide

([HMIM][Br])

and

1-butyl-3-

methylimidazolium chloride ([BMIM][Cl]) ( 2-10% v/v). The enzyme-remaining activity was determined after 30-min of enzyme pre-incubation with ILs. As depicted in Fig. 3b, by increasing the concentration of ILs, a decline in the CMCase activity was observed. DR8806 enzyme was found to remain more than 50% of its initial activity at 4% v/v concentrations of ILs.

3.5. Effect of metal ions on DR8806 cellulase activity About one third of enzymes are metaloenzymes, thus the effect of metal ions on a newly isolated enzyme is very important. The enzyme activity was studied in the presence of various cations (Ca2+, Mg2+, Zn2+, Cu2+, Na+, Hg+, Ba2+, Mn2+, Fe3+, 15

Co2+, K+, Ni+ and Pb2+) at three different concentrations (1, 5 and 10 mM) (Table 3). It has been previously reported that some metal ions act as cellulose cofactors, inducing or inhibiting the amino acids of the enzyme active site [35]. Our results demonstrated that the activity of DR8806 cellulase was influenced by metal ions. Hg2+, Zn2+ and Mn2+ ions were found to inhibit enzyme activity while Co2+, Mg2+, K+ and Na+ ions enhanced the enzyme activity. Partial inhibition was also observed in the presence of some metal ions such as Ni+ and Cu2+ cations at a concentration of 5 mM. It has been formerly suggested that the enzymatic inhibition by Hg2+ ions is not just related to binding the thiol groups but may be the result of interactions with tryptophan residue or the carboxyl group of amino acids in the enzyme structure [36]. Similar results were reported that Hg2+ ion inactivated cellulases from B. sphaericus JS1 [37] and Bacillus licheniformis AU01 [25]. While Hg2+ and Mn2+ cations caused a decrease in enzyme activities of Bacillus sp. CH43 and HR68 [26]. In addition, Co2+ ions increased the enzymatic activity of M. circineloides [32] and Trichoderma viride [33] cellulases. Our results are similar to some previous studies in which Co2+ [26] and K+ [38] ions were reported as inducers of cellulase activity.

3.6. Influence of various effectors on enzyme activity EDTA, β-mercaptoethanol, Triton X-100 and SDS (sodium dodecyl sulfate) were found to inhibit the enzyme activity (Table 4). It was also observed that the cellulase activity decreased rapidly with the effector concentrations. SDS could interact with the hydrophobic group of amino acids resulting in the decreased enzyme activity. Full inhibition of DR8806 cellulase was observed at 10 mM of SDS may be caused by disrupting of the tertiary structure of the enzyme. EDTA is a metal chelating agent and inhibition of the enzymes by EDTA suggests that the enzyme may contain

16

inorganic groups which formed inactive complexes with EDTA [37]. It was also observed that the enzyme activity decreased as the concentration of βmercaptoethanol increased. Increase in concentration of this reducing agent brings about changes in the conformation of enzyme active site by breaking disulfide bonds; thus, results in loss of enzyme activity [39]. This indicates that the disulfide bonds play an important role in maintaining the structure of cellulose from Bacillus subtilis DR8806. Interestingly, our results showed that the addition of βmercaptoethanol dramatically reduced CMCase activity of DR8806 enzyme. PMSF inhibited the enzyme activity indicating the participation of seryl hydroxyl groups in enzyme catalysis [36]. The presence of β-mercaptoethanol and SDS inhibited the EG I activity of enzyme from Melanocarpus sp. MTCC 3922 [40]. Among various compounds and metal ions; SDS and EDTA showed inhibitory effect on cellulose purified from Trichoderma viride [33].

3.7. Stability of enzyme towards commercial solid detergents In the present study, the influence of commercial solid detergents on enzyme stability was examined. In general, cellulases used in detergent industry should not lose their activity in the presence of commercial detergents. DR8806 endo-1-4glucanase retained its activity in the presence of some commercial detergents such as Prill (101%), Vash (102%) Finish (100%), Shoma (99%) and Gang (89%) (Fig. 4). Thus, the stability of the purified endo-1-4-glucanase towards these aforementioned commercial detergents suggests its potential as a suitable additive to commercial detergents. 3.8. Enzyme kinetics

17

Our results using various substrates revealed that CMC was a better substrate (100%) for DR8806 CMCase than avicel with the activity of 28%. Thus, the isolated enzyme has a higher affinity towards CMC than avicel. The Michaelis constants (Vmax and Km apparent) of the purified cellulase from Bacillus subtilis DR8806 were calculated by incubating the purified enzyme with various concentrations of CMC as substrate (0.5-2.5%). As estimated from Michaelis-Menten plot (Fig. 5), Km apparent and Vmax values were 1.49 % (165 mM) and 66.66 µM min-1 mg-1, respectively. Some previous reports have also demonstrated Km values in the range of 0.6-7.2 mg/ml for CMC [41- 42].

3.9. Cloning and sequence analysis of endo-1-4-glucanase gene The nucleotide sequence of Bacillus subtilis DR8806 have been submitted to GenBank under the accession number KM377648. The sequence of the putative cellulase gene contains a complete ORF of 1500 bp which encodes a 499 amino acid precursor with a molecular mass of 52.26 kDa and a theoretical pI of 8.19. Detected by SignalP 4.0 software, putative signal peptide was proposed to comprise 29 amino acid residues followed by a cleavage site between positions 29 (Ala) and 30 (Ala). The alignment of various sequences of Bacillus cellulase revealed a high degree of sequence similarity at amino acid levels (supplementary S1). The amino acid sequence of endo-glucanase DR8806 was generally similar to that reported of six other cellulase genes (ACR59602.1, ABV45393.1, BAL46915.1, CAA47429.1, AIV00153.1 and AAA22307.1) of B. subtilis. Comparing with the six amino acid sequences of cellulases and the related enzymes, amino acid sequence of the isolated enzyme had above 98% identity with them. The sequence of DR8806 cellulase gene product had the most identity to B. subtilis cellulase (CAA47429.1) as shown in Fig.

18

6 and in which endo-glucanase DR8806 differ at one amino acid residues (Ser 291) which is different from the amino acid residues (Asn 291). At least similarity of DR8806 cellulase was related to B. subtilis (ACR59601.1; 11.98%) and B. subtilis (AHZ57098.1; 12.4%). Our results showed the isolated enzyme has new features of cellulase extracted from B. subtilis DR8806. Further sequence analysis showed that the predicted amino acid sequence of the cellulase DR8806 gene was a beta 1-4 glycosyl hydrolase family 5 with a carbohydrate binding module family 3 (CBM-3) at its N terminus (Fig. 7). The BLAST results also show that this query sequence has two putative conserved domains [43]. The conserved domains detected in this protein using CD search with E-value 4.23e-75 with E-value 3.87e-24 are: 1: interval 50-296 belongs to the cellulase (glycosyl hydrolase family 5) with Pfam accession number 00150. 2: interval 356-437 belongs to the CBM-3 (cellulose binding domain) with Pfam accession 00942 and these two parts also contribute to a longer interval (9-445) which belongs to the BglC (aryl-phospho-beta-D-glucosidase, GH1 family [carbohydrate transport and metabolism]) with Pfam Accession COG2730 of carbohydrate active enzymes [43]( not shown on the Fig. 7) .

3.10. Three-dimensional structure of the enzyme Disordered protein regions often lead to difficulties in purification and crystallization of proteins, and become a bottleneck in high throughput structural determination. On the other hand, the prediction of disordered regions is a critical step in the functional annotation of protein [44]. Various factors have been suggested to be important in terms of protein disorder, including flexibility, aromatic content, secondary structure preferences and various scales associated with

19

hydrophobicity. Beside, low mean hydrophobicity, high net charge was also suggested to contribute to disorder. The results obtained by IUPred showed a high tendency to disorder for residue 331 to 381 (Fig. 8a). There are some related PDB codes in PDB database (3PZT A, 4XZW A, 1LF1 A, 1QHZ A, 4A3H A, 1H5V A, 2L8A A) with query cover under 65%. Numerous online servers and tools are available for homology or comparative modeling. The first step of this method is to find the best matching template by performing a sequence homology search with BLASTP. In addition to the sequence similarity the phylogeny relation is an important factor of templates. Here two template proteins were selected. The first is 2L8A , a solution NMR PDB file from CBM3, Carbohydrate-Binding Module Family 3, and the second is 3PZV[45], a X-RAY diffraction crystallography with resolution of 2.87 Å from Cellulase (glycosyl hydrolase family-5) family. Amino acids 27-332 aligned to amino acids 22-327 of 3PZV with Coverage:100% and Identity:100%; Amino acids 354-499 aligned to amino acids 4-148 of 2LA8A with Coverage:100%, Identity:99%, and only one gap in front of Glu at site 468. Some models were generated and loop refinement was carried out on the 3D models (Fig. 8b). Structural evaluation was accomplished with the QMEAN server [46]. The QMEAN score [47] is a composite score consisting of a linear combination of 6 terms. The pseudo-energies of the contributing terms are given below together with their Z-scores with respect to scores obtained for high-resolution experimental structures of similar size solved by X-ray crystallography: C-beta interaction energy: -149.20 (Z-score: -0.60); all-atom pairwise energy: -6281.92 (Z-score: -2.24); Solvation energy: 5.36 (Z-score: -3.74); Torsion angle energy: -92.26 (Z-score: 1.64); Secondary structure agreement: 81.0% (Z-score: 0.31); Solvent accessibility

20

agreement: 69.7% (Z-score: -2.21); Total QMEAN-score: 0.571 (Z-score: 2.35)(estimated model reliability between 0-1) and visualization of generated models was performed using UCSF Chimera 1.8 [48]. In our case, the PROSITE results show a Glycosyl hydrolases family 5 signature form site 62 to 171, our PDB structures matches to Prosite entry PS00659 (GlycosylHydrol-F5) Glycosyl hydrolases family-5 signature. The consensus pattern is [LIV][LIVMFYWGA](2)-[DNEQG]-[LIVMGST]-{SENR}-N-E-[PV]-RHDNSTLIVFY]. The Prosite confirms Glu as catalytic residue at the active site. More than 60 PDBs from Glycosyl hydrolases of family-5 matched to this signature. The Catalytic Site Atlas (CSA) (https://www.ebi.ac.uk/thornton-srv/databases/CSA/) is a database documenting enzyme active sites and catalytic residues in 3D structure of enzymes. It defines a classification of catalytic residues which includes only those residues thought to be directly involved in some aspect of the reaction catalyzed by an enzyme. Unfortunately there is not any PDB math in the Catalytic Site Atlas; EzCatBLAST is a sequence search tool designed for enzyme active-site comparison, using the NCBI BLAST system. EzCat-BLAST is a satellite tool of the EzCatDB enzyme reaction database, which provides manually annotated active-site information and hierarchical classification of enzyme reactions. It is also coded to run for enzyme sequences in the Swiss-Prot database (supplementary S2). Our results suggested that Glu as catalytic residue for our sequence.

4. Conclusion The present study was a report of purification, characterization and gene identification of endo-1-4-glucanase from B. subtilis DR8806. The enzyme was purified by ion-exchange chromatography with 28-fold purification and a specific 21

activity of 60 U mg-1. The isolated enzyme displayed a molecular mass of 52 kDa by SDS-PAGE and optimal activity at 55 ºC and pH 9.5. Molecular modeling revealed that the two of Glu 165 and 169 as catalytic residue participate at active site. In addition, it had a great tolerance and stability in different organic solvents. These features of the enzyme have a potential for use in hydrolyzing cellulosic substrates. The nest step of the study is manipulation of identified cellulase gene by protein engineering to provide more amount of tailored-made enzyme for further characterization and subsequent industrial usages.

Acknowledgement We gratefully thank Research Council of Ferdowsi University of Mashhad for their financial support (Grant number: 3/30085; 19-11-1392). We would like to appreciate from Shamshi Emtenani and Shirin Emtenani for their invaluable contribution. Finally, the authors would like to thank Hossein Lanjanian for his helps in modeling part

References [1] D.K. Trinh, D.T. Quyen, T.T. Do, N.M. Nghiem, Turk. J. Biol. 37 (2013) 377-

384. [2] D. Pol, R.S. Laxman, M. Rao, J. Biochem. Bio. 49 (2012) 189-194. [3] H. Ariffin, N. Abdullah, M.S. Umi Kalsom, Y. Shirai, M.A. Hassan, Int. J. Eng. Technol. 3 (2006) 47-53. [4] M. Suto, F. Tomita, J. Biosci. Bioeng. 92 (2001) 305-311. [5] P. Vijayaraghavan, S.G. Vincent, Pol. J. Microbiol. 61 (2012) 51-55. 22

[6] A. Aygan, B. Arikan, Int. J. Agr. Biol. 10 (2008) 369-374. [7] L.M. Robson, G.H. Chambliss, Appl. Environ. Microbiol. 47 (1984) 1039-1046. [8] N. Dhillon, S. Chhibber, M. Saxena, S. Pajni, D.V. Vadehra, Biotechnol. Lett. 7 (1985) 695-697. [9] N. Trivedi, V. Gupta, M. Kumar, P. Kumari, C.R.K. Reddy, B. Jha, Carbohydr. Polym. 83 (2011) 891-897. [10] K, Ozaki, S. Ito, J. Gen. Microbiol. 137 (1991) 41-48. [11] S. Ito, Extremophiles. 1 (1997) 61-66. [12] Y.K. Kim, S.C. Lee, Y.Y. Cho, H.J. Oh, Y.H. Ko, ISRN. Microbiology. 2012 (2012) 1-9. [13] O.M. Abdel-Fatah, M.M. Hassan, A.M. Elshafei, B.M. Haroun, H.M. Atta, A.M. Othman, Braz. J. Microbiol. 43 (2012) 1-11. [14] K. Horikoshi, M. Nakao, Y. Kurono, N. Sashihara, Can. J. Microbiol. 30 (1984) 774-779. [15] G.L. Miller, Anal. Chem. 31 (1959) 426-428. [16] M.M. Bradford, Anal. Biochem. 72 (1976) 248-254. [17] U.K. Laemmli, Nature. 227 (1970) 680-685. [18] J. Sambrook, D.W. Russell, Molecular cloning: a laboratory manual, Cold Spring Harbor Laboratory Press, New York, 2001. [19] Z. Dosztanyi, V. Csizmók, P. Tompa, I. Simon. J. Mol. Biol. 347 (2005) 827839. 23

[20] Z. Dosztanyi, V. Csizmók, P. Tompa, I, Simon. Bioinformatics. 21 (2005) 3433-3434 [21]B. Webb, M.S. Madhusudhan, M-Y. Shen, G.Q. Dong, M.A. Marti-Renom, N. Eswar, F. Alber, M. Topf, B. Oliva, A. Fiser, R. Sanchez, B. Yerkovich, A. Badretdinov, F. Melo, J.P. Overington, E. Feyfant and A. Sali. MODELLER, A Protein Structure Modeling Program, Release 9.13. [22] C. J. A. Sigrist, L. Cerutti, N. Hulo, A. Gattiker, L. Falquet, M. Pagni, Brief Bioinform. 3 (2002) 265-274. [23]G. J. Bartlett, C. T. Porter, N. Borkakoti, J. M. Thornton, J. Mol. Biol. 324 (2002) 105-121. [24] N. Nagano, N. Nakayama, K. Ikeda, M. Fukuie, K. Yokota, T. Doi, T. Kato, K. Tomii. Nucleic Acids Res. 43 (2015) D453–D458. [25] N. Annamalai, M.V. Rajeswari, S. Elayaraja, R. Thavasi, S. Vijayalakshmi, T. Balasubramanian, Waste Biomass. Valorization. 3 (2012) 305-310. [26] C. Mawadza, R. Hatti-Kaul, R. Zvauya, B. Mattiasson, J. Biotechnol. 83 (2000) 177-187. [27] Y. Hakamada, K. Endo, S. Takizawa, T. Kobayashi, T. Shirai, T. Yamane, S. Ito, Biochim. Biophys. Acta. 1570 (2002) 174-180. [28] Y.H. Li, M. Ding, J. Wang, G.J. Xu, F. Zhao, Appl. Microbiol. Biotechnol. 70 (2006) 430-436. [29] F. Fukumori, T. Kudo, K. Horikoshi, J. Gen. Microbiol. 131 (1985) 3339-3345.

24

[30] T. Yoshimatsu, K. Ozaki, S. Shikata, Y.I. Ohta, K. Koike, S. Kawai, S. Ito, J. Gen. Microbiol. 136 (1990) 1973-1979. [31] B. Azzeddine, M. Abdelaziz, C. Estelle, K. Mouloud, B. Nawel, B. Nabila, B. Said, Arch. Biol. Sci. 65 (2013) 549-558. [26 32] B.C. Saha, Process. Biochem. 39 (2004) 1871-1876. [33] I. Hafiz Muhammad Nasir, A. Ishtiaq, Z. Muhammad Anjum, I. Muhammad, Adv. Biosci. Biotechnol. 2 (2011) 149-156. [34] K. Endo, Y. Hakamada, S. Takizawa, H. Kubota, N. Sumitomo, T. Kobayashi, S. Ito, Appl. Microbiol. Biotechnol. 57 (2001) 109-116. [35] G.D. Haki, S.K. Rakshit, Bioresour. Technol. 89 (2003) 17-34. [36] N. Annamalai, M.V. Rajeswari, S. Elayaraja, T. Balasubramanian, Carbohydr. Polym. 94 (2013) 409-415. [37] J. Singh, N. Batra, R.C. Sobti, J. Ind. Microbiol. Biotechnol. 31 (2004) 51-56. [38] B.K. Kim, B.H. Lee, Y.J. Lee, I.H. Jin, C.H. Chung, J.W. Lee, Enzyme. Microb. Technol. 44 (2009) 411-416. [39] C.M. Wang, C.L. Shyu, S.P. Ho, S.H. Chiou, Lett. Appl. Microbiol. 47 (2008) 46-53. [40] J. Kaur, B.S. Chadha, B.A. Kumar, H.S. Saini, Bioresour. Technol. 98 (2007) 74-81. [41] C.H. Kim, Appl. Environ. Microbiol. 61 (1995) 959-965.

25

[42] C.Y. Wang, Y.R. Hsieh, C.C. Ng, H. Chan, H.T. Lin, W.S. Tzeng, Y.T. Shyu, Enzyme. Microb. Technol. 44 (2009) 373-379. [43] CAZypedia, an online encyclopedia of carbohydrate-active enzymes. [44] A. Marchler-Bauer, S. Lu, J.B. Anderson, F. Chitsaz, M.K. Derbyshire, C. Deweese-Scott, M. Gwadz, Nucleic acids res. 39 (2011) 225-229. [45] C. R. Santos, J. H. Paiva, M. L Sforca, J. L. Neves, R. Z. Navarro J. Cota, P. K. Akao, Z. B. Hoffmam, A. N. Meza, J. H. Smetana, M. L. Nogueira, Biochem. J. 441 (2012) 95-104. [46] P. Benkert, M. Kuenzli, T. Schwede, Nucleic. Acids. Res. 1 (2009) 510-514. ]47] P. Benkert, S. C. E. Tosatto, D. Schomburg, Proteins: Structure, Function, and Bioinformatics. 71 (2008) 261-277. [48] E. F. Pettersen. T. D. Goddard, C. C. Huang, G. S. Couch, D. M. Greenblatt, E. C Mengand, T. E. Ferrin, Journal of computational chemistry. 25 (2004) 1605-1612.

26

Figure captions Fig. 1 Cellulase activity on CMC-containing plate. A halo colour around of the punched wells shows the hydrolysis of carboxymethyl cellulose by endoglucanase activity.

Fig. 2 (a) Polyacrylamide gel electrophoresis analysis of the purified cellulase from Bacillus Subtilis DR8806 from various purification steps. SDS-PAGE: Lane 1 M marker, Lane 2 sample after dialysis, Lane 3 purified enzyme after Q-Sepharose column. (b) zymography analysis of CMCase on gel electrophoresis.

27

Fig. 3 Half-life of the purified endo-1-4-glucanase (a). The enzyme a half-life of 88 min at its optimum temperature. Influence of various imidazolium-based ionic liquids (2-10% v/v) on the activity of endo-1-4-glucanase obtained from B. subtilis DR8806 (b).

a Residual activity (%)

120 45 °C 60 °C

100

50 °C 65 °C

55 °C

80 60 40 20 0 0

20

40

60 80 100 120 140 160 Time (min)

b Relative activity(%)

100

B(MIM)CL B(MIM)Br

E(MIM)Br H(MIM)Br

80 60 40 20 0 0

1

2

3

4

5

6

Ionic liquid (%)

28

7

8

9 10

Relative activity (%)

Fig. 4 Effect of different commercial solid detergents on endo-1-4-glucanase.

120 100 80 60 40 20 0

Commerical detergents

Fig. 5 Lineweaver-Burk plots of the purified endo-1-4-glucanase produced by B. subtilis DR8806. 0.07

1/V (µM min-1)

0.06 0.05 0.04 0.03 y = 0.0224x + 0.0159 R² = 0.9922

0.02 0.01 0 0

0.5

1 1.5 1/S (%w/v)

2

2.5

29

Fig. 6 The phylogenetic tree of cellulase amino acid sequences of Bacillus subtilis strains. Protein sequences of the corresponding cellulases from B. subtilis strains obtained from GenBank were incorporated into the tree and analyzed by the neighbor-joining method. The accession numbers and amount of identity for each sequence to DR8806 cellulase are as follows: B. subtilis DR8806 (KM377648), B. subtilis (ACR59602.1; 98.6% homology), B. subtilis (AAA22307.1; 93.39%), B. subtilis (ABV45393.1; 99%), B. subtilis (ABK63475.1; 98.8%), B. subtilis (BAL46915.1; 99% homology), B. subtilis (CAA47429.1; 99.8%), B. subtilis (ABS70712.1;

93.39%),

B.

subtilis

(ACR59601.1;

11.98%),

B.

subtilis

(AIV00153.1; 99.2%), and B. subtilis (AHZ57098.1; 12.4%). The sequence of Geobacillus sp. C56-T3 (ADI25824.1; 2.21 %) was used as the out-group.

30

Fig. 7 Schematic of different parts of endo-1-4-glucanase extracted from B. subtilis DR8806. Cellulase activity domain and carbohydrate binding module family 3 (CBM3) have been illustrated. SP; signal peptide and numbers show the number of amino acids in the sequence of endo-1-4-glucanase.

N-

SP

Cellulase domain

31

CBM3

-C

Fig. 8 Disorder tendency of amino acid (residues from 331 to 381) in the sequence of endo-1-4-glucanase predicted by IUPred server (a) and the result of complete sequence homology modeling (b). Amino acids 27-332 (red and green) aligned to amino acids 22-327 of 3PZV; Amino acids 354-499 (blue) aligned to amino acids 4148 of 2LA8A. The red beta sheet is being built by the amino asides 162 to 171 (VIYEIANEPN). They are matched with the PROSITE output of Glycosyl hydrolases family 5 signature. Two Glu residues (165 and 169) are probably responsible for catalytic activity.

a

b

32

Table 1 Purification steps of the cellulase enzyme isolated from Bacillus subtilis DR8806.

Purification steps

Crude enzyme Ammonium

sulfate

Protein (mg)

Total activity (U)

Specific activity (U mg-1)

Purification fold

Yield (%)

631.0

1356

2.1

1.0

100.0

38.0

578

15.2

7.1

42.6

0.8

46

60.0

28.0

4.42

precipitation Q-sepharose

33

Table 2 Effect of organic solvents on the activity of purified CMCase a. Organic solvent

Relative activity (%) 10% v/v

20% v/v

Control

100

100

Hexane

92

110

Toluene

86

62

Chloroform

84

71

Iso-amylalkhol

97

84

Butanol

90

95

2-propanol

94

114

Acetone

81

119

Ethanol

87

128

Methanol

80

57

a

The enzyme was pre-incubated with different organic solvents at 10% and 20% v/v at 25 °C for 30 min prior to CMCase assay. A sample reaction without organic solvent was taken as control.

34

Table 3 Effect of metal ions on enzyme activity a. Metal salts

a

Relative activity (%) 1 mM

5 mM

10 mM

Control

100

100

100

MgCl2

109

109

129

CuCl2

114

98

63

MnCl2

69

10

0

CaCl2

55

98

100

KCl

118

113

105

NaCl

115

106

105

FeCl3

28

57

116

ZnCl2

23

2.1

0

CoCl2

130

125

100

PbCl2

51

8.4

0

BaCl2

106

100

100

HgCl2

7

4

0

NiCl

101

88

45

CMCase activity was measured under the standard assay conditions following incubation of enzyme

with various metal ions (1, 5 and 10 mM). The percentage of enzyme activity for control was taken as 100%.

35

Table 4 Effects of different chemical reagents on DR8806 CMCase activity. Relative activity (%)

Reagent 1

5

10

mM

mM

mM

100

100

100

SDS

67

59

0

Triton X-100

91

78

62

80

91

96

EDTA

48

46

26

Dithiothreitol

84

59

50

CTAB

85

64

50

Potassium iodide

43

35

15

Ammonium

84

79

54

15

0

0

Control Detergents

Additives Glycerol Inhibitors

persulfate Mercaptoethanol

36