Bioconcentration and metabolism of decabromodiphenyl ether (BDE-209) result in thyroid endocrine disruption in zebrafish larvae

Aquatic Toxicology 110–111 (2012) 141–148

Contents lists available at SciVerse ScienceDirect

Aquatic Toxicology journal homepage: www.elsevier.com/locate/aquatox

Bioconcentration and metabolism of decabromodiphenyl ether (BDE-209) result in thyroid endocrine disruption in zebrafish larvae Qi Chen, Liqin Yu, Lihua Yang, Bingsheng Zhou ∗ State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, China

a r t i c l e

i n f o

Article history: Received 25 November 2011 Received in revised form 30 December 2011 Accepted 10 January 2012 Keywords: BDE-209 Hypothalamic–Pituitary–Thyroid axis Gene transcription Bioconcentration and metabolism Thyroid endocrine disruption Zebrafish larvae

a b s t r a c t Polybrominated diphenyl ethers (PBDEs) have the potential to disturb the thyroid endocrine system, but little is known of such effects or underlying mechanisms of BDE-209 in fish. In the present study, bioconcentration and metabolism of BDE-209 were investigated in zebrafish embryos exposed at concentrations of 0, 0.08, 0.38 and 1.92 mg/L in water until 14 days post-fertilization (dpf). Chemical analysis revealed that BDE-209 was accumulated in zebrafish larvae, while also metabolic products were detected, including octa- and nona-BDEs, with nona-BDEs being predominant. The exposure resulted in alterations of both triiodothyronine (T3) and thyroxine (T4) levels, indicating thyroid endocrine disruption. Gene transcription in the hypothalamic–pituitary–thyroid (HPT) axis was further examined, and the results showed that the genes encoding corticotrophin-releasing hormone (CRH) and thyroid-stimulating hormone (TSHˇ) were transcriptionally significantly up-regulated. Genes involved in thyroid development (Pax8 and Nkx2.1) and synthesis (sodium/iodide symporter, NIS, thyroglobulin, TG) were also transcriptionally up-regulated. Up-regulation of mRNA for thyronine deiodinase (Dio1 and Dio2) and thyroid hormone receptors (TR˛ and TRˇ) was also observed. However, the genes encoding proteins involved in TH transport (transthyretin, TTR) and metabolism (uridinediphosphate-glucuronosyl-transferase, UGT1ab) were transcriptionally significantly down-regulated. Furthermore, protein synthesis of TG was significantly up-regulated, while that of TTR was significantly reduced. These results suggest that the hypothalamic–pituitary–thyroid axis can be evaluated to determine thyroid endocrine disruption by BDE-209 in developing zebrafish larvae. © 2012 Elsevier B.V. All rights reserved.

1. Introduction Polybrominated diphenyl ethers (PBDEs) are used worldwide as brominated flame retardants. Although some lower brominated PBDEs (e.g., penta-BDE and octa-BDE) have been banned in the European Union and USA, higher PBDEs such as 2,2 ,3,3 ,4,4 ,5,5 ,6,6 -decabromodiphenyl ether (BDE-209) continue to be widely produced and are currently used around the world, especially in Asia (Guan et al., 2007). Among these Asian countries, BDE-209 is produced mainly in China, where its production was up to 13,500 t per annum in 2001 and up to 30,000 t in 2005 (Xia et al., 2005; Zou et al., 2007). Furthermore, BDE-209 from the increasing production of electronic waste (e-waste) has becoming

Abbreviations: BDE-209, 2,2 ,3,3 ,4,4 ,5,5 ,6,6 -decabromodiphenyl ether; corticotropin-releasing hormone; Dio, deiodinase; HPT axis, CRH, hypothalamic–pituitary–thyroid (HPT) axis; PBDEs, polybrominated diphenyl ethers; TG, thyroglobulin; THs, thyroid hormones; TSH␤, thyroid stimulating hormone; TTR, transthyretin; UGT1ab, diphosphoglucuronosyl transferase. ∗ Corresponding author. Tel.: +86 27 68780042; fax: +86 27 68780123. E-mail address: [email protected] (B. Zhou). 0166-445X/$ – see front matter © 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.aquatox.2012.01.008

a major environmental problem (Martin et al., 2004; Chen et al., 2009). Previous studies have indicated the potential of BDE-209 for environmental persistence and bioaccumulation in humans and wildlife (Alaee et al., 2003). For instance, a high concentration of BDE-209 (4600 ␮g/kg dry weight) was detected in suspended solids in Western Scheldt (de Boer et al., 2003). In the Pearl River of China, the measured concentrations of BDE-209 in sediment and in water were up to 7340 ng/g and 65 ng/L, respectively (Chen et al., 2005; Guan et al., 2007). In waste water and sewage sludge, BDE-209 was detected at up to 2412 ng/L and 22,894 ng/g, respectively, in two sewage treatment plants in the Pearl River Delta, China (Peng et al., 2009). In rivers around e-waste areas and industrial parks of Guangdong, South China, BDE-209 was detected in carp (Cirrhinus molitorell) at levels up to 28,000 ng/g (Zhang et al., 2009a,b). High concentrations of BDE-209 in sediment and water may lead to a high risk of exposure and negative biological effects in aquatic organisms. Moreover, BDE-209 has been widely detected at high levels in the human populations, and its concentration in serum from residents of the same e-waste dismantling region was 3100 ng/g lipid, the highest yet reported (Bi et al., 2007). As PBDEs have similar structures to those of thyroid hormones (THs), they have the potential to disrupt thyroid endocrine

142

Q. Chen et al. / Aquatic Toxicology 110–111 (2012) 141–148

activities. Several reports have investigated thyroid endocrine disruption in rodents upon BDE-209 exposure (e.g., Rice et al., 2007; Tseng et al., 2008; Van der Ven et al., 2008; Lee et al., 2010). BDE-209 can be debrominated to lower congeners, which are more bioaccumulative and toxic by both biological and non-biological processes (Stapleton et al., 2004; USEPA, 2008). In fish, recent studies have shown that BDE209 can be metabolized to lower PBDE congeners in juvenile fathead minnows (Pimephales promelas) treated for 28 days and in zebrafish for 5 months (He et al., 2011; Noyes et al., 2011). In fish, the thyroid endocrine system is controlled primarily by the hypothalamic–pituitary–thyroid (HPT) axis, which is responsible for regulating thyroid hormone dynamics by coordinating their synthesis, secretion, transport and metabolism (reviewed by Carr ˜ 2011). Recently, an in vivo model for testing endocrine and Patino, disruption of THs was developed in zebrafish developing larvae. Yu et al. (2010) showed that a mixture of lower PBDE congeners (DE-71) can affect T4 levels and alter gene transcription in the HPT axis. Thus, these gene responses in the HPT axis can be potentially used for evaluation of the biological effects of PBDEs. A recent study also showed that BDE-209 can affect mRNA expression in the thyroid hormone pathway in Chinese rare minnows (Gobiocypris rarus) (Li et al., 2011). However, the potential thyroid endocrine disruption by BDE-209 and underlying mechanisms in fish is not well understood. Therefore, the objective of the present study was to determine whether the developing HPT axis in zebrafish larvae can be used to evaluate thyroid endocrine disruption of BDE-209 and whether it bioaccumulates and is metabolized in zebrafish larvae. After exposure of zebrafish embryos to a range of BDE-209 concentrations, TH levels and gene transcription in the HPT axis and selected protein levels were examined. BDE-209 was determined to be efficiently taken up and bioaccumulated into zebrafish larvae, inducing developmental toxicity and thyroid endocrine disruption. Thus, our study supports the utility of testing genes/proteins in the HPT axis for evaluating the thyroid disruption effects of exposure to BDE-209 in zebrafish larvae. 2. Materials and methods 2.1. Chemicals BDE-209 (CAS: 1163-19-5, purity > 98%) was purchased from Wellington Laboratories (Ontario, Canada). The chemical was dissolved in dimethyl sulfoxide (DMSO) as a stock solution (19.2 g/L). Standards used for PBDE analysis were purchased from Canada Wellington Laboratories, and all solvents were of HPLC and pesticide grade. All other chemicals used were of analytical grade. 2.2. Zebrafish maintenance and embryo exposure Adult zebrafish (Danio rerio) (AB strain) maintenance and embryo exposure were carried out following the method described by Yu et al. (2010). Briefly, embryos that developed normally and reached the blastula stage (2 hours post-fertilization, hpf) were selected for subsequent experiments. Approximately 400 normal embryos were randomly distributed into glass beakers containing 500 mL of BDE-209 solution at various nominal concentrations (0, 0.08, 0.38, 1.92 mg/L). Both the control and exposure groups with 3 replicates in each exposure concentration received 0.01% (v/v) DMSO. The exposure concentrations were based on a previous range finding study which revealed that after exposure to the lowest concentration of BDE-209 (0.08 mg/L), the malformation rates showed an increasing but not statistically significant trend. The embryos were exposed until 14 days post-fertilization (dpf)

during a stage when TH synthesis is at the highest levels in fathead minnow larvae (Crane et al., 2004). During the experimental period, the exposure solution was renewed daily, and zebrafish larvae were fed with cultured live paramecia and Artemia twice daily. The controlled experimental conditions were 28 ± 0.5 ◦ C in a 14 h day/10 h night light cycle. At 14 dpf, the larvae were randomly sampled, frozen in liquid nitrogen immediately and stored at −80 ◦ C for subsequent gene, protein and TH assays. A subset of larvae was analyzed for bioconcentration and metabolites. The hatching, malformation, growth and survival were also recorded. 2.3. RNA isolation and quantitative real-time polymerase chain reaction (qRT-PCR) The procedures for RNA extraction and gene transcription analysis were carried out as previously described by Yu et al. (2010). Briefly, 30 homogenized zebrafish larvae per sample were prepared for total RNA extraction by using Trizol Reagent (Invitrogen, Carlsbad, CA, USA). The total RNA was processed and purified with RNase-free DNaseI (Promega, Madision, WI, USA) to remove genomic DNA contamination. The total RNA content was measured at 260 and 280 nm using a spectrophotometer (M2; Molecular Devices, Sunnyvale, CA, USA). The concentration of total RNA was estimated according to the optical density at 260 nm, while the RNA quality was examined by measuring the 260/280 nm ratios and 1% agarose–formaldehyde gel electrophoresis with ethidium bromide staining. cDNA was synthesized by using M-MLV Reverse Transcriptase (Promega) following the manufacturer’s instruction. qRT-PCR was carried out with a SYBR Green PCR Kit (Toyobo, Osaka, Japan) and analyzed on an ABI 7300 System (PerkinElmer Applied Biosystems, Foster City, CA, USA). The primer sequences of the target genes were obtained as previously described by Yu et al. (2010) and provided in Table 1. The PCR conditions were: initial denaturation for 10 min at 95 ◦ C, followed by 40 cycles of 95 ◦ C for 15 s, 60 ◦ C for 15 s, and 72 ◦ C for 45 s. The results were determined using the threshold cycle (CT) number, which is the signal detected during the log-linear exponential stage of PCR amplification. Each target gene was tested in three replicates, and the level was normalized to the mRNA content of the reference gene Rpl8 (Filby and Tyler, 2007). In the experimental conditions of this study, the Rpl8 gene transcription did not vary (data not shown). 2.4. Protein extraction and Western blot analysis Protein extraction was performed with commercial kits (KeyGEN BioTECH, Nanjing, China) according to the manufacturer’s instructions. Briefly, 200 zebrafish larvae of each treatment were homogenized in 0.5 mL lysis buffer containing proteinase inhibitors (1%, v/v), phosphatase inhibitor (0.1%, v/v) and phenylmethanesulfonyl fluoride (PMSF) (1%, v/v). The samples were then centrifuged at 1000 × g for 10 min at 4 ◦ C. The supernatants were collected and stored at −80 ◦ C for further Western blotting analysis. In our study, the protein levels of thyroglobulin (TG) and transthyretin (TTR) proteins were analyzed. Protein concentrations were measured by the Bradford method. Approximate 40 ␮g each protein sample were loaded into each lane of a 6% or 12% SDS-PAGE gel and then transferred to a nitrocellulose membrane (Amersham Biosciences, USA). The nitrocellulose membrane was blocked for 1 h with 5% non-fat dried milk in tris-buffered saline (TBS) and incubated with primary antibody against TG (Sigma, St. Louis, MO, USA)/TTR (Abcam, USA) at 37 ◦ C for 2 h. The blots were washed six times for 30 min with tris-buffered saline Tween-20 (TBST) and then incubated with AP-conjugated secondary antibody at 37 ◦ C for 1 h. After that the blots were washed six times again, they were developed using a BCIP/NBT Kit (AMRESCO, USA). TTR is

Q. Chen et al. / Aquatic Toxicology 110–111 (2012) 141–148

143

Table 1 Primer sequences for the quantitative reverse transcription-polymerase chain reaction. Gene name

Sense primer (5 –3 )

Antisense primer (5 –3 )

Gene bank accession no.

Rpl8 CRH TSHˇ NIS TG Nkx2.1 Pax8 Dio1 Dio2 UGT1ab TTR TR˛ TRˇ

ttgttggtgttgttgctggt ttcgggaagtaaccacaagc gcagatcctcacttcacctacc ggtggcatgaaggctgtaat ccagccgaaaggatagagttg aggacggtaaaccgtgtcag gaagatcgcggagtacaagc gttcaaacagcttgtcaaggact gcataggcagtcgctcattt ccaccaagtctttccgtgtt cgggtggagtttgacacttt ctatgaacagcacatccgacaagag tgggagatgatacgggttgt

ggatgctcaacagggttcat ctgcactctattcgccttcc gcacaggtttggagcatctca gatacggcatccattgttgg atgctgccgtggaatagga caccatgctgctcgtgtact ctgcactttagtgcggatga agcaagcctctcctccaagtt tgtggtctctcatccaacca gcagtccttcacaggctttc gctcagaaggagagccagta cacaccacacacggctcatc ataggtgccgatccaatgtc

NM 200713 NM 001007379 AY135147 NM 001089391 XM 001335283 NM 131589 AF072549 BC076008 NM 212789 NM 213422 BC081488 NM 131396 NM 131340

considered as an evolutionarily conserved serum protein (Hennebry et al., 2006; Buxbaum and Reixach, 2009). Both TG and TTR in zebrafish (D. rerio) have high homeology with those in Homo sapiens and Mus musculus (Protein Blast by NCBI). Furthermore, Western blotting analysis of TTR in sea bream (Sparus aurata) revealed a band of ∼14 kDa (Morgado et al., 2007). Using a rabbit antihuman TG serum that cross-reacted with lampreys (Lampetra appendix) TG, Western blotting detected a single protein of ∼226 kDa (Manzon and Youson, 2002). In our study, the detected major bands showed ∼16 kDa and ∼260 kDa, respectively for TTR and TG. Therefore, our results certified the validation of using mammalian antibodies to detect proteins in zebrafish. 2.5. Thyroid hormone extraction and measurement Thyroid hormone extraction was performed as described by Yu et al. (2010). Briefly, 200 zebrafish larvae for each treatment were homogenized in 0.4 mL ELISA buffer with an Ultra-Turrax T8 basic homogenizer (IKA, Staufen, Germany). The samples were then disrupted for 5 min by spasmic sonication on ice and with 10 min oscillation. After centrifugation at 5000 × g for 10 min at 4 ◦ C, the supernatants were collected and stored at −80 ◦ C for measurement of THs. The whole body TH levels were measured using enzymelinked immunosorbent assay (ELISA) with a commercial kit for fish (Uscnlife, Wuhan, China) based on the competitive binding enzyme immunoassay technique. The detection limits for T3 and T4 were 0.1 ng/mL and 1.2 ng/mL, respectively. The intra-assay and interassay variations were 4.3% and 7.5% for total T4, and 4.5% and 7.2% for total T3, respectively. No significant cross-reactivity or interference was observed for each kit.

reduced to 0.1 mL prior to gas chromatography (GC)/mass spectrometry (MS) analysis. 2.6.2. Sample analysis Samples were analyzed using an Agilent 6890N/5975C GC/MS (Agilent Technologies, Santa Clara, CA, USA), with negative chemical ionization used in the selected ion monitoring mode. Auto splitless injection onto a J&W Scientific DB-5 MS fused silica capillary column (0.25 mm i.d. × 20 m × 0.1 ␮m film thickness) was used for the determination of PBDE congeners with the carrier gas helium (1.0 mL/min). The ion source, quadrupole and interface temperatures were set to 150, 150 and 305 ◦ C, respectively. 2.6.3. Quality assurance and quality control (QA/QC) Analysis of procedural blanks was performed simultaneously. Recovery of 13 C12-labeled BDE ranged between 80% and 150%. The detection limit was calculated as three times the SD from six runs for the ongoing precision and recovery (OPR) by adding 1.5–7.5 ng PBDEs (7–315 pg/g for di- to deca- BDEs). 2.7. Statistical analysis All data are expressed as means ± standard error (SEM). The normality of the data was verified using the Kolmogorov–Smirnov test. The homogeneity of variances was analyzed by Levene’s test. The differences between the control and each exposure group were evaluated by one-way analysis of variance (ANOVA) followed by Tukey’s test by using SPSS 13.0 software (SPSS, Chicago, IL, USA). A P value < 0.05 was considered statistically significant. 3. Results

2.6. PBDE extraction and analysis

3.1. Developmental toxicity

2.6.1. Extraction and clean-up One hundred zebrafish larvae for each treatment were weighed before and after freeze-drying, and then ground into a fine powder and homogenized with anhydrous sodium sulfate. The samples were placed in a pre-cleaned stainless-steel cell followed by Soxhlet extraction for 48 h using a mixture of dichloromethane (DCM). Before the Soxhlet extraction, 4 ng of each internal standard (13 C12labeled PCB141) were added to each sample. Sample cleanup and quantification were performed as follows. Briefly, lipids were removed from extracts using a gel permeation chromatography column (GPC; 25 mm (i.d.) × 500 mm; Bio-Beads S-X3, Bio-Rad Laboratories, Hercules, CA, USA) by elution with an equivalent mixture of dichloromethane in hexane (1:1, v/v) at a flow rate of 2 mL/min. The concentrated extract was purified by Multilayer Silica Gel Column eluting with dichloromethane and hexane (3:97, v/v) through activated silica gel (60 A˚ average pore size). The volume was further

After 14 days of exposure, BDE-209 did not significantly affect hatching and malformation rates compared with those in controls (Table 2). Significantly reduced survival rates and body weight were Table 2 Development index of zebrafish larvae after exposure to nominated concentrations of BDE-209 (0, 0.08, 0.38 and 1.92 mg/L) in water with DMSO at 0.01% (v/v) for 14 days.a BDE-209 (mg/L)

0

a

97.3 1.67 72.7 0.41

Hatching (%) a Malformation (%) a Survival (%) a Weight (mg)

0.08 ± ± ± ±

0.9 0.33 1.5 0.01

96.7 2.33 72.0 0.40

0.38 ± ± ± ±

2.4 0.33 1.5 0.01

97.3 2.67 69.7 0.39

1.92 ± ± ± ±

0.9 0.33 1.8 0.01

94.0 3.00 68.0 0.37

± ± ± ±

1.2 0.58 0.6* 0.01*

The values represent mean ± standard error (SEM) of 3 replicate group. P < 0.05 indicates significant difference between exposure groups and the control group. a

*

144

Q. Chen et al. / Aquatic Toxicology 110–111 (2012) 141–148

(A)

60

T4 content (ng/g)

50 40 *

30 20 10 0 0

0.08

0.38

1.92

BDE-209 concentration (mg/L)

(B)

5

T3 content (ng/g)

4 *

**

3 2 1 0 0

0.08

0.38

1.92

BDE-209 concentration (mg/L)

The ratio of T3 to T4

(C)

stimulating hormone (TSHˇ) gene transcription was significantly up-regulated by 1.3-, 1.4- and 1.7 fold in a concentrationdependent manner after exposure to 0.08, 0.38 and 1.92 mg/L BDE-209 (Fig. 1). In examining the marker genes involved in thyroid development and growth, Pax8 was significantly up-regulated transcriptionally by 2.6- and 2.8-fold in the 0.38 and 1.92 mg/L BDE-209 exposure groups (Fig. 1), while Nkx2.1 was increased by 2.1-, 2.1- and 2.5-fold upon treatment with 0.08, 0.38 and 1.92 mg/L BDE-209, respectively (P < 0.01) (Fig. 1). The gene responsible for iodide transport (sodium/iodide symporter, NIS) was significantly up-regulated transcriptionally in the group exposed to 1.92 mg/L BDE-209 (2.3-fold) (Fig. 1). Upon treatment with 0.08, 0.38 and 1.92 mg/L BDE-209, the thyroglobulin (TG) gene was transcriptionally significantly up-regulated by 1.7-, 1.9- and 2.8-fold, respectively, in all exposure groups (Fig. 1). Transcription of deiodinase 1 (Dio1) was increased by 1.5- and 1.6-fold in the 0.38 and 1.92 mg/L BDE-209 groups, respectively (P < 0.05) (Fig. 1), while a small but significant up-regulation of Dio2 gene transcription was observed in the 1.92 mg/L exposure group (1.5-fold) (Fig. 1). Significant transcriptional up-regulation of TR˛ (1.6-, 1.7- and 1.7-fold) and TRˇ (1.4-, 1.4- and 2.0-fold) was detected under treatment with 0.08, 0.38 and 1.92 mg/L of BDE-209, respectively (Fig. 1). However, the gene transcription of transthyretin (TTR) was significantly down-regulated (1.3-, 1.7- and 2.2-fold, respectively) in groups exposed to 0.08, 0.38 and 1.92 mg/L BDE-209 (Fig. 1). A small but significant down-regulation of hepatic uridine diphosphoglucuronosyl transferase (UGT1ab) transcription was observed in the 1.92 mg/L exposure group (1.6-fold) (Fig. 1).

3.3. Protein abundance Exposure to BDE-209 significantly up-regulated TG protein expression by 29.3%, 44.8% and 84.3% (P < 0.05) (Fig. 2A and B). Expression of TTR protein was reduced by 34.5%, 40.3% and 30.4% (P < 0.05) (Fig. 2C and D) in the 0.08, 0.38 and 1.92 mg/L groups, respectively, compared with those in the control.

0.18

** 0.12

**

3.4. TH contents

*

0.06

0.00 0

0.08

0.38

1.92

BDE-209 concentration (mg/L) Fig. 1. Levels of: (A) T4, (B) T3 and (C) T3/T4 ratio in zebrafish larvae after exposure to nominal concentrations of BDE-209 (0, 0.08, 0.38, 1.92 mg/L) in water with DMSO at 0.01% (v/v) for 14 days. Values are expressed as means ± SEM of three replicate samples. *P < 0.05 and **P < 0.01 indicate significant differences between exposure groups and the control group.

recorded in the 1.92 mg/L exposure group relative to the control (P < 0.05) (Table 2). 3.2. Gene transcription profile Several genes involved in regulation, transport, binding and metabolism of THs were examined. A small but significantly transcriptional up-regulation of the corticotropin-releasing hormone (CRH) gene was observed in the group exposed to 1.92 mg/L of BDE-209 relative to the control (1.3-fold) (Fig. 1), while thyroid

The body total THs were measured in the larvae at 14 dpf. The total T4 levels were decreased in all the exposure groups and showed a significant difference in the 1.92 mg/L group (41.1%) (Fig. 3A). Meanwhile, significant increases of total T3 levels were observed in the 0.38 and 1.92 mg/L BDE-209 groups (82.1% and 95.7%, respectively) (P < 0.05) (Fig. 3B). The ratios of T3–T4 showed concentration-dependent increases in the 0.08, 0.38 and 1.92 mg/L BDE-209 groups (P < 0.05) (Fig. 3C).

3.5. BDE-209 bioconcentration and metabolism After 14 days of exposure, PBDE concentrations and metabolites were measured in zebrafish larvae (Fig. 4). A concentrationdependent bioconcentration of BDE-209 was measured in the larvae in all exposure groups (2351 ± 906, 3408 ± 796 and 38,627 ± 3138 ng/g (w/w), respectively) (Fig. 4). In the 1.92 mg/L exposure group, the measured PBDEs congeners were BDE-206, BDE-207, BDE-196 and BDE-197 with average concentrations of 511 ± 42, 379 ± 30, 3 ± 3 and 18 ± 2 ng/g (w/w), respectively (Fig. 4). In the 0.38 and 0.08 mg/L exposure groups, the measured PBDEs congeners were BDE-206 and BDE-207 (87 ± 13 and 70 ± 9 ng/g (w/w); 43 ± 23 and 41 ± 9 ng/g (w/w), respectively) (Fig. 4). In the control group, no BDE-209 or its metabolites were detected (Fig. 4). The estimated bioconcentration factors (detected concentrations in larvae/nominated concentrations in water) are 29, 9, and 20 with

Q. Chen et al. / Aquatic Toxicology 110–111 (2012) 141–148

145

Fig. 2. Gene transcription in the HPT axis in zebrafish larvae after exposure to nominal concentrations of BDE-209 (0, 0.08, 0.38 and 1.92 mg/L) in water with DMSO at 0.01% (v/v) for 14 days. Data are expressed as means ± SEM of three replicate samples. *P < 0.05 and **P < 0.01 indicate significant differences between exposure groups and the control group.

treatment of nominal concentrations of 0.08, 0.38 and 1.92 mg/L BDE-209, respectively. 4. Discussion In the present study, we employed developing zebrafish larvae for assessment of thyroid endocrine disruption of BDE-209. Bioconcentration of BDE-209 in the larvae was evident, and BDE-209 could be metabolized. Both T4 and T3 levels were changed by BDE209 exposure in the larvae. The results indicated that the zebrafish larvae HPT axis can be used to evaluate the potential mechanisms of thyroid endocrine disruption of higher PBDE congeners. Although the rates of hatching and malformation of zebrafish were not significantly affected, significant decreases in both body weight and survival rates of zebrafish larvae were observed in the 1.92 mg/L BDE-209-treated group. In a previous study, significant effects on growth (body weight and length) were not observed with chronic exposure to BDE-209 (from 0 to 0.96 mg/L) for 5 months in zebrafish (He et al., 2011), suggesting that the early life stage is more sensitive to toxicant stress. A significant decrease in growth of zebrafish larvae was detected with DE-71 exposure (10 ␮g/L), and increased malformation rates were observed in 3 and 10 ␮g/L DE-71 treated larvae (Yu et al., 2010). These results further support the notion that BDE-209 itself is less toxic than the lighter BDE congeners. In the present study, a significant decrease of T4 levels was observed with BDE-209 exposure. This result is in agreement with several previous reports on thyroid disruption with decreased T4 levels upon BDE-209 exposure in rodents (Rice et al., 2007; Van der Ven et al., 2008; Kim et al., 2009), as well as upon DE-71 treatment in zebrafish larvae (Yu et al., 2010). While decreased T4 levels are generally observed in mammals and fish models exposed to PBDEs, the T3 levels were significantly increased in our study. Decreased levels of T3 concentration in mice have also been reported with BDE-209 treatment in rodent (Lee et al., 2010; Tseng et al., 2008).

However, elevated T3 concentrations were measured in mice upon DE-71 treatment (Blake et al., 2011). Other studies have indicated that the effects of PBDEs on T3 levels were much smaller than those on T4 levels in mammals and fish (Zhou et al., 2001; Tomy et al., 2004). These results indicate that PBDEs induce thyroid endocrine disruption by disturbing T4 levels, but the changes in T3 levels may depend on exposure time, species or concentrations. The increased T3/T4 ratio associated with a decreased T4 level is usually present in primary hypothyroidism (Wilkin and Isles, 1984). Thus, concentation-dependent increases in the T3/T4 ratio in the present study further suggest that disruption of thyroid function was induced by BDE-209 exposure. In the present study, transcription of CRH and TSHˇ genes were significantly upregulated after BDE-209 treatment, indicating a negative feedback mechanism due to reduced T4 levels. Reductions of T4 and accompanying up-regulation of TSHˇ gene transcription have been reported in fathead minnows (P. promelas) (Lema et al., 2009). Hence, changes of CRH and TSHˇ mRNA expression may be associated with the alteration of T4 levels in fish. Consistent with these results, exposure to DE-71 has been shown to reduce the whole body levels of T4 in zebrafish larvae associated with elevated transcription of TSHˇ and CRH (Yu et al., 2010). Therefore, the results of our study indicate that the upregulation of CRH and TSHˇ genes may be attributed to the hypothalamus and pituitary negative feedback mechanism for the regulation of the decreased T4 levels. We also examined genes involved in thyroid development and growth (Nkx2.1a and Pax8) and TH synthesis (TG and NIS). Significant transcriptional up-regulation of Pax8 and Nkx2.1a was observed, suggesting that thyroid growth and development were promoted to compensate for the depressed T4 levels. As thyroid transcription factors, Nkx2.1a (TTF1) and Pax8 regulate the expression of NIS and TG in the thyroid system (Kambe et al., 1996; Zoeller et al., 2007), the increased gene transcription of NIS and TG observed in the present study may be controlled by Nkx2.1a and Pax8 to

146

Q. Chen et al. / Aquatic Toxicology 110–111 (2012) 141–148

Fig. 4. Bioconcentration and metabolites of BDE-209 measured in zebrafish larvae after exposure to nominal concentrations of BDE-209 (0, 0.08, 0.38 and 1.92 mg/L) in water with DMSO at 0.01% (v/v) for 14 days. Data are expressed as means ± SEM of three replicate samples.

Fig. 3. Protein abundance of thyroglobulin (TG) and transthyretin (TTR) in zebrafish larvae after exposure to nominal concentrations of BDE-209 (0, 0.08, 0.38 and 1.92 mg/L) in water with DMSO at 0.01% (v/v) for 14 days. (A) Representative Western blotting of TG; (B) Quantification of the relative expression of TG. (C) Representative Western blotting of TTR. (D) Quantification of the relative expression of TTR. Results are expressed as mean ± SEM of three replicate samples. *P < 0.05 indicates a significant difference between exposure groups and the control group.

compensate for the reduced T4 levels. A significant up-regulation in transcription of these genes has also been reported in DE-71 exposure to zebrafish larvae concomitant with decreased T4 levels (Yu et al., 2010). Furthermore, increased protein expression levels of TG, a precursor protein of THs by iodination, were observed in the present study. Thus, the increased transcription and translation of TG further support the occurrence of a compensating response to lowered T4 levels at the TH synthesis stage. TTR, an important transport protein for THs, was decreased in our study at both the transcriptional and protein levels, suggesting that BDE-209 can influence TH binding proteins and interfere with TH homeostasis. Our results are consistent with previous findings, in which PBDE exposure was found to cause down-regulation of TTR in rodent, bird and fish species (Zhou et al., 2001, 2002; Crump et al., 2008; Yu et al., 2010). It has been suggested that PBDEs and their metabolites can influence the levels of circulating THs by

competitive binding to TTR with high affinity (Boas et al., 2006; Morgado et al., 2009), thus lowering TTR levels may result in a greater clearance of free THs. Although the mechanisms of reduction in TTR are not well-understood, the inhibition of TTR mRNA and protein levels caused by BDE-209 exposure could impact the binding and transport of THs and thus pose a potential risk to thyroid functions. Deiodinases are important regulators of circulating and peripheral TH levels in vertebrates. In fish, it has been demonstrated that Dio2 plays a pivotal role in producing active T3; meanwhile Dio1 is mainly expressed in the kidney and is thought to play a minimal role in plasma TH homeostasis but has a considerable influence on iodine recovery and TH degradation (Van der Geyten et al., 2005). In our study, both Dio1 and Dio2 were significantly up-regulated in the larvae, consistent with previous reports showing that hypothyroidism increases Dio1 and Dio2 mRNA expression (Orozco and Valverde, 2005; Van der Geyten et al., 2005). A recent study also showed significant up-regulation of Dio1 and Dio 2 gene transcription in zebrafish larvae upon exposure to DE-71 for 14 days (Yu et al., 2010). A plausible explanation is that an increase in the transcription of Dio2 may, at least partly, be associated with a reduction in the levels of circulating T4, and increased Dio1 may help to degrade the increased T3 levels. In addition, it has been suggested that uridinediphosphate glucoronosyltransferases (UGT) and sulfotransferases (SULTs) play important roles in TH homeostasis, via the major pathway for T4 conjugation (Visser, 1994; Hood and Klaassen, 2000). Several previous studies in rodents have shown that decreased T4 levels are accompanied by increased UGT activities or gene transcription (Zhou et al., 2001; Hallgren and Darnerud, 2002; Szabo et al., 2009). A reduction of T4 and increased UGT gene transcription were reported in zebrafish larvae after exposure to DE-71 for 14 days (Yu et al., 2010). In the present study, a small but significant down-regulation of UGT1ab mRNA expression was only observed in the highest exposure group. Szabo et al. (2009) indicated that UGT-T4 is not the most sensitive marker for DE-71, and the regulation of UGT to THs is thought to be nuclear receptor specific. Since BDE-209 has a very limited potential to activate the transcriptional factor, aryl hydrocarbon receptor (AhR) (Chen et al., 2001; Villeneuve et al., 2002), the decreased T4 levels in our study may not be directly related to the regulation of UGT. Therefore, the

Q. Chen et al. / Aquatic Toxicology 110–111 (2012) 141–148

mechanistic relationships between metabolic genes and THs upon BDE-209 exposure require further study. There are two major thyroid hormone receptor (TR) isoforms (TR␣ and TR␤), which bind T3 and mediate TH-regulated gene expression (Power et al., 2001). In fish and other vertebrates, there is variation in the expression of TR subtypes depending on tissue-specific and developmental state-specific functions (Forrest and Vennström, 2000; Nelson and Habibi, 2009). In the present study, BDE-209 treatment caused up-regulated transcription of the TR˛ and TRˇ genes. An elevation of TR␣ transcription has also been observed in Chinese rare minnows (G. rarus) upon BDE-209 exposure (Li et al., 2011). Previous studies have reported the upregulation of two TRs with T3 treatment (Crump et al., 2008). Hence, the upregulation of TRs in the present study may be due to the increased T3 levels and would influence the transcription of other genes involved in thyroid function. It should be noted that TH levels measured in the present study are not represent thyroidal status in plasma, and the whole body measurements of THs probably reflect the circulatory plasma levels and TH reserves that are present in the thyroid gland, as well as the tissue-associated THs. In addition, we measured gene transcriptions on pools of whole larvae. Taking into consideration the tissue specific gene expressions in fish larvae and adults (Johnson and Lema, 2011), the results of the present study on larvae may have limitations to establish how individuals and specific tissues respond to THs. However, fish larval stages are believed to be more sensitive to toxic chemicals than adults. Hence it is important to investigate effects of potential thyroid disruptors in early life stages, and understanding the patterns of TH throughout development may reveal sensitive windows during which thyroid disruption could have particular importance (Crane et al., 2004). It has been reported that BDE-209 is widely detected and can be accumulated in some species (Bi et al., 2007; Zhang et al., 2009a,b; Tian et al., 2010). In the present study, bioconcentration of BDE-209 was observed in the developing larvae. Moreover, several congeners were detected in zebrafish larvae, and the major metabolites of BDE-209 in zebrafish larvae were found to be nona-BDE. Recent studies have detected additional metabolites in fish after exposure to BDE-209, including penta-BDE, hex-BDE, hepta-BDE, octa-BDE and nona-BDE in fathead minnows (Noyes et al., 2011) and tri-BDE, tetra-BDE, penta-BDE, hex-BDE, hepta-BDE, octa-BDE and nona-BDE in zebrafish (He et al., 2011). In addition, methoxylated BDE metabolites have also been detected in rainbow trout (Oncorhynchus mykiss) (Feng et al., 2010). The limited metabolites of BDE-209 detected in our study compared with previous studies suggest lower metabolic capability in larvae, but it may also be due to the different exposure times and species utilized. It should also be noted that the measured BDE-209 content in the zebrafish larvae from the exposure groups were similar to those reported in fish from the environment (Zhang et al., 2009a,b), suggesting that thyroid endocrine disruption would occur in contaminated wild fish. Thus, the results of the present study may be useful in predicting effects of PBDEs present in the natural environment. In summary, BDE-209 can be bioconcentrated and metabolized in zebrafish larvae. Our results indicate that exposure of BDE-209 to zebrafish larvae influenced levels of THs as well as gene transcription in the HPT axis. As with a previous study using the developing HPT axis to evaluate thyroid endocrine disruption of lower PBDE congeners (DE-71) (Yu et al., 2010), the present study indicates that assessment of the HPT axis is also suitable for determining thyroid endocrine disruption of higher congeners (BDE-209). In addition, due to the crucial roles of THs in neural development, further investigation of the effects of BDE-209 on neurons and thyroid functions is needed.

147

Acknowledgments This work was supported by grants from the National Nature Science Foundation of China (20890113), the Chinese Academy of Sciences (KCZCX2-YW-Q02-05) and the State Key Laboratory of Freshwater Ecology and Biotechnology (Y15B131F01). References Alaee, M., Arias, P., Sjödin, A., Bergman, A., 2003. An overview of commercially used brominated flame retardants, their applications, their use patterns in different countries/regions and possible modes of release. Environ. Int. 29, 683–689. Bi, X., Thomas, G.O., Jones, K.C., Qu, W., Sheng, G., Martin, F.L., Fu, J., 2007. Exposure of electronics dismantling workers to polybrominated diphenyl ethers, polychlorinated biphenyls, and organochlorine pesticides in South China. Environ. Sci. Technol. 41, 5647–5653. Blake, C.A., McCoy, G.L., Hui, Y.Y., LaVoie, H.A., 2011. Perinatal exposure to lowdose DE-71 increases serum thyroid hormones and gonadal osteopontin gene expression. Exp. Biol. Med. 236, 445–455. Boas, M., Feldt-Rasmussen, U., Skakkebaek, N.E., Main, K.M., 2006. Environmental chemicals and thyroid function. Eur. J. Endocrinol. 154, 599–611. Buxbaum, J.N., Reixach, N., 2009. Transthyretin: the servant of many masters. Cell. Mol. Life Sci. 66, 3095–3101. ˜ R., 2011. The hypothalamus–pituitary–thyroid axis in teleosts and Carr, J.M., Patino, amphibians: endocrine disruption and its consequences to natural populations. Gen. Comp. Endocrinol. 170, 299–312. Chen, D., Bi, X., Zhao, J., Chen, L., Tan, J., Mai, B., Sheng, G., Fu, J., Wong, M., 2009. Pollution characterization and diurnal variation of PBDEs in the atmosphere of an E-waste dismantling region. Environ. Pollut. 157, 1051–1057. Chen, G., Konstantinov, A.D., Chittim, B.G., 2001. Synthesis of polybrominated diphenyl ethers and their capacity to induce CYP-1A by the Ah receptor mediated pathway. Environ. Sci. Technol. 35, 3749–3756. Chen, S., Zeng, E., Luo, X., Yu, M., Sheng, G., Fu, J., 2005. Polybrominated diphenyl ethers (PBDEs) in surficial sediments of the Pearl River delta and adjacent South China Sea. Acta Sci. Circumstantiae 25, 1265–1271 (in Chinese). Crane, H.M., Pickford, D.B., Hutchinson, T.H., Brown, J.A., 2004. Developmental changes of thyroid hormones in the fathead minnow, Pimephales promelas. Gen. Comp. Endocrinol. 139, 55–60. Crump, D., Jagla, M.M., Chiu, S., Kennedy, S.W., 2008. Detection of PBDE effects on mRNA expression in chicken (Gallus domesticus) neuronal cells using real-time RT-PCR and a new differential display method. Toxicol. In Vitro 22, 1337–1343. de Boer, J., Wester, P.G., van der Horst, A., Leonards, P.E., 2003. Polybrominated diphenyl ethers in influents, suspended matter, sediments, sewage treatment plant and effluents and biota from the Netherlands. Environ. Pollut. 122, 63–74. Feng, C., Xu, Y., He, Y., Luo, Q., Zha, J., Wang, Z., 2010. Debrominated and methoxylated polybrominated diphenyl ether metabolites in rainbow trout (Oncorhynchus mykiss) after exposure to decabromodiphenyl ether. J. Environ. Sci. 22, 1425–1434. Filby, A.L., Tyler, C.R., 2007. Appropriate ‘housekeeping’ genes for use in expression profiling the effects of environmental estrogens in fish. BMC Mol. Biol. 8, 8–10. Forrest, D., Vennström, B., 2000. Functions of thyroid hormone receptors in mice. Thyroid 10, 41–52. Guan, Y., Wang, J., Ni, H., Luo, X., Mai, B., Zeng, E., 2007. Riverine inputs of polybrominated diphenyl ethers from the Pearl River Delta (China) to the coastal ocean. Environ. Sci. Technol. 41, 6007–6013. Hallgren, S., Darnerud, P.O., 2002. Polybrominated diphenyl ethers (PBDEs), polychlorinated biphenyls (PCBs) and chlorinated paraffins (CPs) in rats-testing interactions and mechanisms for thyroid hormone effects. Toxicology 177, 227–243. He, J., Yang, D., Wang, C., Liu, W., Liao, J., Xu, T., Bai, C., Chen, J., Lin, K., Huang, C., Dong, Q., 2011. Chronic zebrafish low dose decabrominated diphenyl ether (BDE-209) exposure affected parental gonad development and locomotion in F1 offspring. Ecotoxicology 20, 1813–1822. Hennebry, S.C., Wright, H.M., Likic, V.A., Richardson, S.J., 2006. Structural and functional evolution of transthyretin and transthyretin-like proteins. Proteins 64, 1024–1045. Hood, A., Klaassen, C.D., 2000. Differential effects of microsomal enzyme inducers on in vitro thyroxine (T4) and triiodothyronine (T3) glucuronidation. Toxicol. Sci. 55, 78–84. Johnson, K.M., Lema, S.C., 2011. Tissue-specific thyroid hormone regulation of gene transcripts encoding iodothyronine deiodinases and thyroid hormone receptors in striped parrotfish (Scarus iseri). Gen. Comp. Endocrinol. 172, 505–517. Kambe, F., Nomura, Y., Okamoto, T., Seo, H., 1996. Redox regulation of thyroid-transcription factors, Pax-8 and TTF-1, is involved in their increased DNA-binding activities by thyrotropin in rat thyroid FRTL-5 cells. Mol. Endocrinol. 10, 801–812. Kim, T.H., Lee, Y.J., Lee, E., Kim, M.S., Kwack, S.J., Kim, K.B., Chung, K.K., Kang, T.S., Han, S.Y., Lee, J., Lee, B.M., Kim, H.S., 2009. Effects of gestational exposure to decabromodiphenyl ether on reproductive parameters, thyroid hormone levels, and neuronal development in Sprague-Dawley rats offspring. J. Toxicol. Environ. Health Part A 72, 1296–1303. Lee, E., Kim, T.H., Choi, J.S., Nabanata, P., Kim, N.Y., Ahn, M.Y., Jung, K.K., Kang, I.H., Kim, T.S., Kwack, S.J., Park, K.L., Kim, S.H., Kang, T.S., Lee, J., Lee, B.M.,

148

Q. Chen et al. / Aquatic Toxicology 110–111 (2012) 141–148

Kim, H.S., 2010. Evaluation of liver and thyroid toxicity in Sprague-Dawley rats after exposure to polybrominated diphenyl ether BDE-209. J. Toxicol. Sci. 35, 535–545. Lema, S.C., Dickey, J.T., Schultz, I.R., Swanson, P., 2009. Thyroid hormone regulation of mRNAs encoding thyrotropin beta-subunit, glycoprotein alpha-subunit, and thyroid hormone receptors alpha and beta in brain, pituitary gland, liver, and gonads of an adult teleost, Pimephales promelas. J. Endocrinol. 202, 43–54. Li, W., Zhu, L., Zha, J., Wang, Z., 2011. Effects of decabromodiphenyl ether (BDE209) on mRNA transcription of thyroid hormone pathway and spermatogenesis associated genes in Chinese rare minnow (Gobiocypris rarus) Environ. Toxicol., in press. Manzon, R.G., Youson, J.H., 2002. KClO4 inhibits thyroidal activity in the larval lamprey endostyle in vitro. Gen. Comp. Endocrinol. 128, 214–223. Martin, M., Lam, P.K.S., Richardson, B.J., 2004. An Asian quandary: where have all of the PBDEs gone? Mar. Pollut. Bull. 49, 375–382. Morgado, I., Santos, C.R.A., Jacinto, R., Power, D.M., 2007. Regulation of transthyretin by thyroid hormones in fish. Gen. Comp. Endocrinol. 152, 189–197. Morgado, I., Campinho, M.A., Costa, R., Jacinto, R., Power, D.M., 2009. Disruption of the thyroid system by diethystilbestrol and ioxynil in the sea bream (Sparus aurata). Aquat. Toxicol. 94, 87–93. Nelson, E.R., Habibi, H.R., 2009. Thyroid receptor subtypes: structure and function in fish. Gen. Comp. Endocrinol. 161, 90–96. Noyes, P.D., Hinton, D.E., Stapleton, H.M., 2011. Accumulation and debromination of decabromodiphenyl ether (BDE-209) in juvenile fathead minnows (Pimephales Promelas) induces thyroid disruption and liver alterations. Toxicol. Sci. 122, 265–274. Orozco, A., Valverde, R.C., 2005. Thyroid hormone deiodination in fish. Thyroid 15, 799–813. Peng, X., Tang, C., Yu, Y., Tan, J., Huang, Q., Wu, J., Chen, S., Mai, B., 2009. Concentrations, transport, fate, and releases of polybrominated diphenyl ethers in sewage treatment plants in the Pearl River Delta, South China. Environ. Int. 35, 303–309. Power, D.M., Llewellyn, L., Faustino, M., Nowell, M.A., Bjornsson, B.T., Einarsdottir, I.E., Canario, A.V.M., Sweeney, G.E., 2001. Thyroid hormones in growth and development of fish. Comp. Biochem. Physiol. Part C 130, 447–459. Rice, D.C., Reeve, E.A., Herlihy, A., Zoeller, R.T., Thompson, W.D., Markowski, V.P., 2007. Developmental delays and locomotor activity in the C57BL6/J mouse following neonatal exposure to the fully brominated PBDE, decabromodiphenyl ether. Neurotoxicol. Teratol. 29, 511–520. Stapleton, H.M., Letcher, R.J., Li, J., Baker, J.E., 2004. Dietary accumulation and metabolism of polybrominated diphenyl ethers by juvenile carp (Cyprinus carpio). Environ. Toxicol. Chem. 23, 1939–1946. Szabo, D.T., Richardson, V.M., Ross, D.G., Diliberto, J.J., Kodavanti, P.R., Birnbaum, L.S., 2009. Effects of perinatal PBDE exposure on hepatic phase I, phase II, phase III, and deiodinase 1 gene expression involved in thyroid hormone metabolism in male rat pups. Toxicol. Sci. 107, 27–39. Tian, S., Zhu, L., Liu, M., 2010. Bioaccumulation and distribution of polybrominated diphenyl ethers in marine species from Bohai Bay. China. Environ. Toxicol. Chem. 29, 2278–2285.

Tomy, G.T., Palace, V.P., Halldorson, T., Braekevelt, E., Danell, R., Wautier, K., Evans, B., Brinkworth, L., Fisk, A.T., 2004. Bioaccumulation, biotransformation, and biochemical effects of brominated diphenyl ethers in juvenile lake trout (Salvelinus namaycush). Environ. Sci. Technol. 38, 1496–1504. Tseng, L.H., Li, M.H., Tsai, S.S., Lee, C.W., Pan, M.H., Yao, W.J., Hsu, P.C., 2008. Developmental exposure to decabromodiphenyl ether (PBDE 209): effects on thyroid hormone and hepatic enzyme activity in male mouse offspring. Chemosphere 70, 640–647. U.S. EPA., Washington, DC., 2008. Toxicological Review of Decabromodiphenyl ether (BDE-209). EPA/635/R-07/008F. Van der Geyten, S., Byamungu, N., Reyns, G.E., Kühn, E.R., Darras, V.M., 2005. Iodothyronine deiodinases and the control of plasma and tissue thyroid hormone levels in hyperthyroid tilapia (Oreochromis niloticus). J. Endocrinol. 184, 467–479. Van der Ven, L.T., van de Kuil, T., Leonards, P.E., Slob, W., Cantón, R.F., Germer, S., Visser, T.J., Litens, S., Håkansson, H., Schrenk, D., van den Berg, M., Piersma, A.H., Vos, J.G., Opperhuizen, A., 2008. A 28-day oral dose toxicity study in Wistar rats enhanced to detect endocrine effects of decabromodiphenyl ether (decaBDE). Toxicol. Lett. 179, 6–14. Villeneuve, D.L., Kannan, K., Priest, B.T., 2002. In vitro assessment of potential mechanism-specific effects of polybrominated diphenyl ethers. Environ. Toxicol. Chem. 21, 2431–2433. Visser, T.J., 1994. Role of sulfation in thyroid hormone metabolism. Chem. Biol. Interact. 92, 293–303. Wilkin, T.J., Isles, T.E., 1984. The behavior of the triiodothyronine/thyroxine (T3/T4) ratio in normal individuals, and its implications for the regulation of euthyroidism. J. Endocrinol. Invest. 7, 319–322. Xia, J., Wang, L., Luo, H., 2005. Present status and developing tendency of flame retardant. Appl. Chem. Ind. 34, 1–4 (in Chinese). Yu, L., Deng, J., Shi, X., Liu, C., Yu, K., Zhou, B., 2010. Exposure to DE-71 alters thyroid hormone levels and gene transcription in the hypothalamic–pituitary–thyroid axis of zebrafish larvae. Aquat. Toxicol. 97, 226–233. Zhang, W., Cai, Y., Sheng, G., Chen, D., Fu, J., 2009a. Tissue distribution of decabrominated diphenyl ether (BDE-209) and its metabolites in sucking rat pups after prenatal and/or postnatal exposure. Toxicology 283, 49–54. Zhang, Y., Wu, J., Luo, X., Chen, S., Mai, B., Yang, Z., 2009b. Bioaccumulation of polybrominated diphenyl ethers in a contaminated freshwater food web from an E-Waste recycling site, South China. Asian J. Ecotoxicol. 4, 13–78 (in Chinese). Zhou, T., Ross, D.G., DeVito, M.J., Crofton, K.M., 2001. Effects of short-term in vivo exposure to polybrominated diphenyl ethers on thyroid hormones and hepatic enzyme activities in weanling rats. Toxicol. Sci. 61, 76–82. Zhou, T., Taylor, M.M., DeVito, M.J., Crofton, K.M., 2002. Developmental exposure to brominated diphenyl ethers results in thyroid hormone disruption. Toxicol. Sci. 66, 105–116. Zoeller, R.T., Tan, S.W., Tyl, R.W., 2007. General background on the hypothalamic–pituitary–thyroid (HPT) axis. Crit. Rev. Toxicol. 37, 11–53. Zou, M., Ran, Y., Gong, J., 2007. Polybrominated diphenyl ethers in watershed soils of the Pearl river delta, China: occurrence, inventory, and fate. Environ. Sci. Technol. 41, 8262–8267.