Biogenic amines content, histamine-forming bacteria, and adulteration of pork and poultry in tuna dumpling products

Food Control 21 (2010) 977–982

Contents lists available at ScienceDirect

Food Control journal homepage: www.elsevier.com/locate/foodcont

Biogenic amines content, histamine-forming bacteria, and adulteration of pork and poultry in tuna dumpling products Hsien-Feng Kung a, Yi-Chen Lee b, Yu-Ru Huang c, Wen-Feng Lin d, Chia-Min Lin b, Wen-Chieh Chen b, Yung-Hsiang Tsai b,* a

Department of Biotechnology, Tajen University, Pingtung, Taiwan, ROC Department of Seafood Science, National Kaohsiung Marine University, Kaohsiung 811, Taiwan, ROC Department of Food Science, National Penghu University, Penghu, Taiwan, ROC d Department of Food Science, National Taiwan Ocean University, Keelung, Taiwan, ROC b c

a r t i c l e

i n f o

Article history: Received 16 June 2009 Accepted 15 December 2009

Keywords: Histamine Tuna dumpling Histamine-forming bacteria Adulteration

a b s t r a c t Nine tuna dumpling products were purchased at nine retail markets in southern Taiwan. Occurrence of biogenic amines, histamine-forming bacteria, and adulteration of pork and poultry were determined. This study showed the high contents of aerobic plate count, total coliform and Escherichia coli in tested tuna dumpling products. Average content of various biogenic amines in all tested samples was less than 2.0 mg/100 g. Fifteen histamine-producing bacterial strains isolated from tested samples produced 8.7– 466 ppm of histamine in trypticase soy broth supplemented with 1.0% L-histidine (TSBH). Assay of multiplex polymerase chain reaction (PCR) revealed adulteration rates were 88.9% (8/9) and 33.3% (3/9) for pork and poultry, respectively, in tuna dumpling. In addition, six samples of tuna dumpling meat were identified as Thunnus obesus, while other three samples were identified as Thunnus thynnus. Ó 2010 Elsevier Ltd. All rights reserved.

1. Introduction Histamine is the causative agent of scombroid poisoning, a food-borne chemical hazard. Scombroid poisoning is usually a mild illness with a variety of symptoms including rash, urticaria, nausea, vomiting, diarrhea, flushing, and tingling and itching of the skin (Taylor, 1986). Severity of the symptoms can vary considerably with the amount of histamine ingested and the individual’s sensitivity to histamine. Scombroid fish such as tuna, mackerel, bonito, and saury that contain high levels of free histidine in their muscle are often implicated in scombroid poisoning incidents (Taylor, 1986). However, several species of nonscombroid fish such as mahi-mahi, bluefish, herring, and sardine have often been implicated in incidents of scombroid poisoning. In Taiwan, several cases of scombroid poisoning have been reported (Chen & Malison, 1987; Tsai, Kung et al., 2005). Besides histamine, other biogenic amines also contribute the occurrence of scombroid poisoning. Biogenic amines including histamine are formed mainly through the decarboxylation of specific free amino acids by exogenous decarboxylases released by the microbial species associated with the seafood (Taylor & Speckard,

* Corresponding author. Address: Department of Seafood Science, National Kaohsiung Marine University, No. 142, 22 Hai-Chuan Rd., Nan-Tzu, Kaohsiung City 811, Taiwan, ROC. Tel.: +886 7 3617141x3609; fax: +886 7 3640634. E-mail address: [email protected] (Y.-H. Tsai). 0956-7135/$ - see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.foodcont.2009.12.011

1983). Many different bacterial species are known to possess histidine decarboxylase and have the ability to produce histamine. Although only Morganella morganii, Klebsiella pneumoniae and Hafnia alvei have been isolated from the fish incriminated in scombroid poisoning, a variety of other bacterial species isolated from fishes have been reported to be capable of producing histamine (Taylor & Speckard, 1983). Among them are the enteric bacteria, that include Proteus vulgaris, Proteus mirabilis, Enterobacter aerogenes, Enterobacter cloacae, Serratia fonticola, Serratia liquefaciens, Raoultella (formerly Klebsiella) planticola, Raoultella ornithinolytica and Citrobacter freundii (Kim et al., 2003; Tsai, Lin et al., 2005) and non-enteric bacteria such as Clostridium spp., Vibrio alginolyticus, Acinetobacter lowffi, Plesiomonas shigelloides, Pseudomonas putida, Pseudomonas fluorescens, Aeromonas spp., and Photobacterium spp. (Okuzumi, Hiraishi, Kobayashi, & Fujii, 1994; Yatsunami & Echigo, 1991). Recently, the presence of histamine-forming Proteus, Enterobacter, Klebsiella, Rahnella and Acinetobacter in sailfish was reported in Taiwan, but the three major histamine-formers, H. alvei, M. morganii and K. pneumonia, were not isolated (Tsai, Kung, Lee, Lin, & Hwang, 2004). Accurate analytical methods are indispensable for the labeling of meat products. Thus, simple and fast procedures were needed. Biomolecular techniques have been extensively used because of high degree of specificity and being applicable to heat processed products (Momcilovic & Rasooly, 2000). Among them, DNA hybridization (Chikuni, Ozutsumi, Koishikawa, & Kato, 1990; Wintero,

978

H.-F. Kung et al. / Food Control 21 (2010) 977–982

Thomsen, & Davies, 1990) and PCR methods (Chikuni, Tabata, Kosugiyama, Momma, & Saito, 1994; Fei et al., 1996) have been used for identification of meats and meat products. DNA hybridization generally are more complicated and inadequate than PCR, which easily amplifies target regions of template DNA in a much shorter time (Saiki et al., 1985), and thus is suitable for meat identification. Matsunaga et al. (1999) designed multiplex PCR primers to identify cattle, pig, chicken, sheep, goat, and horse meats. Recently, Dalmasso et al. (2004) developed a multiplex PCR assay to identify animal species (ruminant, poultry, fish, and pork) in feedstuffs. Recently, a case of histamine intoxication associated with tuna dumpling was reported, in Chiayi Prefecture, southern Taiwan March, 2006 (Chen et al., 2008). The high content of histamine (160.8 mg/100 g) in the suspected tuna dumpling sample was detected and could be the etiological factor for this food borne poisoning. Weak histamine-formers such as Enterobacter sp., Pantoea agglomerans, Klebsiella variicola, and Serratia marcescens were isolated from the suspected tuna dumpling. However, there was no report associated with biogenic amines, including histamine, histamine-forming bacteria and related bacteria in commercial tuna dumpling products. Therefore, this research was conducted to analyze nine commonly consumed tuna dumpling products at retail stores in southern Taiwan to obtain better understanding of the safety quality of the products. In order to avoid possible fraudulent and vague labeling of tuna dumpling, a multiplex PCR assay was used to discriminate adulteration of ruminant, poultry, fish and pork in tuna dumpling. In addition, polymerase chain reaction– restriction fragment length polymorphism (PCR–RFLP) was applied to authenticate tuna species of the nine commercial tuna dumpling.

2. Materials and methods 2.1. Samples Nine tuna dumpling products were purchased from nine retail stores in southern Taiwan. All samples were purchased in frozen condition, wrapped in aseptic bags, placed in ice, and transported to the laboratory for use within 8 h. 2.2. Determination of pH value and salt content Ten gram of tuna dumpling samples were homogenized in sterile blenders with 10 ml of distilled water to make thick slurry. The pH of this slurry was measured using a Corning 145 pH meter (Corning Glass Works, Medfield, MA, USA). Salt content in each sample was determined according to the AOAC procedures (1995). Two gram of tuna dumpling sample was homogenized with 18 ml of distilled water, and then was titrated with 0.1 M AgNO3 using 10% w/v K2CrO4 solution as an indicator. 2.3. Microbiological analysis and isolation of histamine-forming bacteria A 25-g portion of the tuna dumpling sample was homogenized at high speed for 2 min in a sterile blender with 225 ml sterile potassium phosphate buffer (0.05 M, pH 7.0). The blender was sterilized by autoclaving for 15 min at 121 °C before use. The homogenates were serially diluted with a sterile phosphate buffer (1:9), and 1.0 ml aliquots of the dilutant was inoculated into aerobic plate count (APC) agar (Difco, Detroit, MI, USA) containing 0.5% NaCl. Bacterial colonies were counted after the plates were incubated at 35 °C for 48 h. Bacterial numbers in the tuna dumpling samples were expressed as log10 colony forming units (CFU)/g.

To isolate histamine-forming bacteria, a 0.1 ml aliquot of the sample dilutant was spread on histamine-forming bacterium isolation agar (HBI agar) fortified with L-histidine (Niven, Jeffreg, & Corlett, 1981). Following incubation of the differential agar plates for 4 d at 35 °C, colonies with blue or purple color on the plates were picked and further streaked on trypticase soy agar (TSA) (Difco) to obtain pure cultures. Their ability to produce biogenic amines was determined by inoculating the isolates in trypticase soy broth (TSB) (Difco) supplemented with 1% L-histidine (TSBH) and incubated without shaking at 35 °C for 24 h. One milliliter of the culture broth was taken for quantitation of biogenic amines. Analyses of total coliform and Escherichia coli in these tuna dumpling samples were conducted using the three-tube most probable number (MPN) methods (FDA, 1992). Lauryl sulfate tryptose broth (LST broth) and brilliant green lactose bile (2%) broth (BGLB broth) were used for presumptive and confirmed tests for total coliform, respectively. E. coli was determined by using the LST broth and EC broth. Cultures that showed positive production of gas were then confirmed by streaking on eosine methylene blue agar (EMBA) and IMViC test. 2.4. Identification of histamine-forming isolates The presumptive histamine-forming isolates were identified on the basis of morphology, Gram stain, endospore stain, catalase and oxidase reaction. The identity of histamine-forming isolates was further confirmed by amplifying and sequencing approximately 1400 bp of the 16S ribosomal DNA (rDNA) for bacteria (Kuhnert, Capaul, Nicolet, & Frey, 1996; Kuhnert, Heyberger-Meyer, Nicolet, & Frey, 2000). Amplification of histamine-forming bacteria was performed using the universal primers UNI-L (50 -AGAGTTTGATCATGGCTCAG-30 ) and UNI-R (50 -GTGTGACGGGCGGTGTGTAC-30 ) (Kuhnert et al., 1996, 2000). Bacterial cells were cultured overnight in 2 ml of TSB at 35 °C and then centrifuged at 5000g for 10 min. The cell pellet was washed and resuspended in 0.5 ml of TE-buffer (10 mM Tris–HCl, 1 mM EDTA; pH 8.0), and then lysed by 20% sodium dodecyl sulfate (SDS). After the solution was boiled for 20 min and the cellular debris was discarded following centrifugation at 13000g for 3 min, total DNA in the supernatant was precipitated with 70% ethanol and used as template DNA for PCR. PCR amplification was performed in 20 ll reaction mixture containing 10 mM Tris–HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 20 pmol of each primer, a 0.2 mM concentration for each of the four deoxynucleotide triphosphates, 0.5U of Taq DNA polymerase (Applied Biosystems, Foster City, CA, USA), and template DNA (10 ng). Amplifications were carried out for 35 cycles (94 °C for 30 s, 55 °C for 30 s, and 72 °C for 60 s) in a GeneAmp PCR 2400 Thermal Cycler (Applied Biosystems) with an initial denaturation at 94 °C for 4 min and a final extension at 72 °C for 7 min (Kuhnert et al., 1996, 2000). Amplicons were detected by electrophoresis on a 1.5% agarose gel staining with ethidium bromide. Amplicons were purified using a QIAquick PCR Purification Kit (Qiagen, Valencia, CA, USA) eluted in Tris–HCl buffer (10 mM, pH 8.5) prior to sequencing. The amplified DNA was directly sequenced with the ABI TaqDye Deoxy Terminator Cycle sequencing kit and ABI Model 377 automated DNA sequencer (Applied Biosystems). The sequences were analyzed with the BLAST (NCBI) for identification of histamine-forming bacteria. 2.5. Determination of total volatile base nitrogen (TVBN) The TVBN content of the tuna dumpling sample was measured by the method of Conway’s dish (Cobb, Aoaniz, & Thompson, 1973). The TVBN extract of the fish sample in 6% trichloroacetic acid (TCA, Sigma, St. Louis, MO, USA) was absorbed by boric acid

H.-F. Kung et al. / Food Control 21 (2010) 977–982

and then titrated with 0.02 N HCl. The TVBN content was expressed in mg/100 g fish. 2.6. Biogenic amine analysis Totally, nine biogenic amines contents were determined. Each tuna dumpling sample was ground in a Waring Blender for 3 min. The ground samples (5 g) were transferred into a 50-ml centrifuge tubes, and then homogenized with 20 ml of 6% trichloroacetic acid (TCA) for 3 min. The homogenate was centrifuged (10000g, 10 min, 4 °C) and filtered through Whatman No. 2 filter paper (Whatman, Maidstone, England). The filtrate was then placed in a volumetric flask, and TCA was added to bring to a final volume of 50 ml. Samples of standard biogenic amine solutions and 1 ml aliquots of the tuna dumpling extracts were derivatized with dansyl chloride according to the previously described method (Chen et al., 2010). One milliliter of each bacterial culture broth was also dansylated using the same procedures for tuna dumpling extracts. The dansyl derivatives were filtrated through a 0.45-lm filter, and 20 ll aliquots were used for high performance liquid chromatograph (HPLC) injection. The contents of biogenic amines in the tuna dumpling samples were determined with a HPLC (Hitachi, Tokyo, Japan) consisting of a Model L-7100 pump, a Rheodyne Model 7125 syringe loading sample injector, a Model L-4000 UV–Vis detector (set at 254 nm), and a Model D-2500 Chromato-integrator. A LiChrospher 100 RP18 reversed-phase column (5 lm, 125  4.6 mm, E. Merck, Damstadt, Germany) was used for chromatographic separation. The gradient elution program began with 50:50 (v/v) acetonitrile:water at a flow rate of 1.0 ml/min for the 19 min, followed by a linear increase to 90:10 acetonitrile:water (1.0 ml/min) during the next 1.0 min. The acetonitrile:water mix decreased to 50:50 (1.0 ml/ min) for 10 min. 2.7. Multiplex PCR for animal DNA analysis The DNA extraction of tuna dumpling meat was prepared according to the method of Dalmasso et al. (2004). PCR amplification was conducted in 25 ll of 75 mM Tris–HCl (pH 8.8), 1.5 unit of Platinum Taq DNA polymerase (Invitrogen, USA), 0.2 mM dNTP mix, 2 mM MgCl2, 20, 20, 12.5 and 10 pmol of ruminant, pork, fish and poultry primers, and 250 ng template. The sets of primers reported by Dalmasso et al. (2004) were ruminant primer (50 GAAAGGACAAGAGAAATAAGG 30 and 50 TAGGCCCTTTTCTAGGGCA 30 ), pork primer (50 CTACATAAGAATATCCACCACA 30 and 50 ACATTGTGGGATCTTCTAGGT 30 ), fish primer (50 TAAGAGGG CCGGTAAAACTC 30 and 50 GTGGGGTATCTAATCCCA 30 ) and poultry primer (50 TGAGAACTACGAGCACAAAC 30 and 50 GGGCTATTGAGCTCACTGTT 30 ). Amplification was performed in a Thermal Cycler 2400 (Applied Biosystems, Foster City, CA) with the following cycling conditions; after an initial heat denaturation step at 94 °C for 10 min, 35 cycles were programmed as follows: 94 °C for 30 s, 60 °C for 1 min, 72 °C for 1 min and final extension at 72 °C for 5 min. Amplicons were resolved by electrophoresis on 3% agarose gel (Invitrogen, USA) run in Tris Acetate EDTA buffer for 70 min at 110 V and stained with ethidium bromide (0.4 ng/ml) for 20 min (Dalmasso et al., 2004). 2.8. PCR–RFLP for tuna fish species analysis The DNA was extracted by using magnetic bead technique with the Chemagic DNA Tissue 10 Kit (Chemagen, Baesweiler, Germany) according to the manufacturer’s procedures. About 10 mg of sample was incubated with protease K and lysis buffer at 56 °C until lysis was completed, then magnetic beads were added. After incubation, magnetic beads binding DNA were separated by a mag-

979

netic separator. The beads were washed twice by wash buffer, and then DNA was extracted from beads by adding elution buffer. Two sets of primers were used to amplify and identify animal species. Sequence of these two primers are: (1) Cb126L (50 -GCY TYT ACT ACG GYT CYT AC-30 ) (Y-xC/T) and Cb126H (50 -CCC CTC AGA ATG ATA TTT GTC C-30 ) and (2) Cb146L (50 -CCT CGC AAT ACA CTA TAC CCC-30 ) and Cb146H (50 -CGA TGT GGA AGT AGA TGC AG-30 ). The primer sets of Cb126L/H and Cb146L/H could be used to amplify, respectively, 126 bp and 146 bp of cytochrome b gene in this study (Lin & Hwang, 2007). Each PCR reaction was performed in a total volume of 100 ll, containing 10 ll of template DNA, 2 lM of each primer, 200 lM of dNTP, and 2.5U of Pro Taq DNA polymerase (Amresco, Solon, OH, USA) in a PCR buffer that included 20 mM of Tris–HCl (pH 8.0), 15 mM of MgCl2, 1% Triton X-100, 500 mM of KCl and 0.1% (w/v) gelatin. The PCR amplifications were carried out in a GeneAmp PCR System 2400 (Perkin–Elmer, Foster City, CA, USA) programmed to perform a denaturation step at 95 °C for 10 min, followed by 30 cycles consisting of 1 min at 95 °C, 1 min at 50 °C and 1 min at 72 °C. The final extension step was 10 min or longer. Five restriction enzymes including Bsp1286I, HincII, RsaI, ScaI and MboII (Promega, Madison, WI, USA) were determined for this study. Each digestion was performed in 10 ll of mixture that contains 100 ng PCR product, 5U restriction endonuclease, 1:10 dilution of bovine serum albumin and 10 digestion buffer. Digestive reactions were incubated at optimal assay temperature (37 °C) for 2 h. The results of RFLP analysis in DNA electrophoresis were read and photographed as described above, except that the concentration of agarose gel was increased to 4%.

3. Results and discussion Values of the pH, salt content, total volatile basic nitrogen (TVBN), aerobic plate count (APC), total coliform (TC) and E. coli, in the nine tuna dumpling samples from the nine retail stores were presented in Table 1. The levels of pH, salt content, TVBN, APC, TC and E. coli in all samples ranged from 4.6 to 5.4, 0.4% to 0.8%, 7.0 to 11.6 mg/100 g, 6.9 to 9.0 log CFU/g, 2200 to 140,000 most probable number (MPN)/g, and <3 to 18,000 MPN/g, respectively. Based on the Taiwanese regulatory standard of 6.47 log CFU/g of APC for frozen foods to be served after cooking, 100% (9/9) of the tuna dumpling samples were unacceptable. Although Taiwanese regulatory standard of TC for frozen foods to be served after cooking is not set, all tuna dumpling samples contained more than the 2200 MPN/g of total coliform (Table 1). Five of the nine tuna dumpling samples (55.6%) contained more than 1000 MPN/g of E. coli, which are more than the 50 MPN/g regulatory limit in Taiwan for frozen foods to be served after cooking (Table 1). The contents of TVBN in all the tuna dumpling samples were below the Taiwanese regulatory level of 15 mg/100 g (Table 1). Based on the high levels of APC, TC and E. coli detected in the tuna dumpling samples, those commercial tuna dumpling could been seriously contaminated during processing. These results are in agreement with the previous report of Chen et al. (2008), in which high content of APC, TC and E. coli in suspected tuna dumpling implicated a food poisoning. The contents of biogenic amines in the tested tuna dumpling products were summarized in Table 2. None of the nine tested samples contained cadaverine, tryptamine, 2-phenylethylamine and agmatine (Table 2). The average content of each of the remaining five biogenic amines in all samples was less than 2.0 mg/100 g. The levels of histamine in all samples ranged from <0.05 to 1.79 mg/100 g. However, strong evidence exists that biogenic amines such as putrescine, cadaverine, spermine, and spermidine in fish tissue can increase the toxic effects of histamine by inhibiting intestinal histamine-metabolizing enzymes such as diamine

980

H.-F. Kung et al. / Food Control 21 (2010) 977–982

Table 1 Values of the pH, salt content, total volatile basic nitrogen (TVBN), aerobic plate count (APC), total coliform (TC) and E. coli in nine tuna dumpling samples from retail stores. Sample

pH

Salt content (%)

TVBN (mg/100 g)

APC (logCFU/g)

A B C D E F G H I

4.9 5.2 5.4 4.9 4.6 4.9 5.2 5.3 4.8

0.4 0.7 0.8 0.6 0.6 0.7 0.6 0.8 0.8

11.1 9.4 10.4 10.6 9.2 11.6 7.0 9.0 7.1

8.1 8.0 7.3 8.8 9.0 7.8 8.4 6.9 8.6

Mean ± SD

5.0 ± 0.3

0.7 ± 0.1

9.5 ± 1.6

Table 2 The levels of biogenic amines in nine tuna dumpling samples from retail stores. Source

A B C D E F G H I

Levels of biogenic amine (mg/100 g) Puta

Cad

Try

Phe

Spd

Spm

His

Tyr

Agm

0.72 ND ND ND ND ND ND 0.04 0.13

NDb ND ND ND ND ND ND ND ND

ND ND ND ND ND ND ND ND ND

ND ND ND ND ND ND ND ND ND

0.40 ND 0.32 0.25 0.59 ND ND 0.22 0.19

ND ND ND ND ND ND ND ND 0.20

1.52 ND 1.24 ND ND 0.11 1.79 ND ND

ND 1.92 ND ND ND ND 0.23 ND ND

ND ND ND ND ND ND ND ND ND

a Put: putrescine; Cad: cadaverine; Try: tryptamine; Phe: 2-phenylethylamine; Spd: spermidine; Spm: spermine; His: histamine; Tyr: tyramine; Agm: agmatine. b ND: not detected (amine level less than 0.05 mg/100 g).

oxidase. Therefore, the biogenic amines can increase histamine uptake and liberating endogenous histamine in intestinal fluids (Flick, Oria, & Douglas, 2001). Quality loss and histamine accumulation often occur after frozen tuna or mackerel are thawed and kept for a long period of time at room temperature. Since histamine is heat resistant, its toxicity remains intact in canned or cooked fish products (Lopez-Sabater, Rodriguez-Jerez, Hernandez-Herrero, & Mora-Ventura, 1994). Identification of 15 histamine-forming bacteria isolated from the tuna dumpling products was listed in Table 3. The identification was determined by the 16S rDNA sequences and comparative analysis with NCBI database. Fifteen histamine-producing bacterial strains were identified as R. ornithinolytica (four strains), E. aeroge-

TC (MPN/g) 24,000 130,000 14,000 23,000 25,000 22,000 140,000 4900 2200

8.1 ± 0.7

40,589 ± 54,351

E. coli (MPN/g) 18,000 1000 <3 <3 <3 1600 1000 <3 1000 2511 ± 5839

nes (two strains), Acinetobacter baylyi (one strain), P. agglomerans (one strain) and Bacillus pumilus (one strain) for prolific histamine-formers (>180 ppm), and Pantoea sp. (one strain), S. marcescens (one strain), Bacillus megaterium (one strain), Klebsiella oxytoca (two strains) and K. pneumoniae (one strain). Producing histamine capability of these bacteria was ranged from 8.7 ppm to 466 ppm in trypticase soy broth supplemented with 1.0% L-histidine (TSBH). Among them, six of 15 bacterial species produced less than 180 ppm histamine were considered as weak histamine-formers (Table 3). Some of them also produced different amounts of putrescine, cadaverine, and tyramine through the action of their respective decarboxylase enzymes on various amino acids that also existed in TSBH (Table 3). In this study, most of histamine-forming isolates (12 of 15) belonged to the family, Enterobacteriaceae, such as: R. ornithinolytica, E. aerogenes, P. agglomerans, Pantoea sp., S. marcescens, K. oxytoca and K. pneumoniae. Meanwhile, R. ornithinolytica (four strains) and E. aerogenes (two strains) produced 244.6–466.3 ppm of histamine in TSBH (Table 3), accounting for 40% of histamine-forming isolates. R. ornithinolytica and E. aerogenes have often been isolated from various species of scombroid fish. R. ornithinolytica and E. aerogenes were most frequently reported prolific histamine-formers in tuna (Lopez-Sabater, Rodriguez-Jerez, Hernandez-Herrero, Roig-Sagues, & Mora-Ventura, 1996), albacore (Kim et al., 2001), and sailfish (Tsai et al., 2004). Recently, the enteric bacteria, R. ornithinolytica and E. aerogenes isolated from dried milkfish were reported to be potent histamine-formers capable of producing >500 ppm of histamine in TSBH (Hsu et al., 2009; Tsai et al., 2007). Based on the results of the higher levels of APC, E. coli, TC, and histamine-forming bacteria strains, the tested samples could be seriously contaminated during food preparation and processing.

Table 3 Identification of histamine-forming bacteria from the tuna dumpling samples collected at retail stores by 16S rDNA, and their production of histamine and other biogenic amines (ppm) in culture broth.

a b

Strain

Organism identified

Percentage identity (%)

Gene bank accession number

Hisa

Put

Cad

Tyr

2A2-1 1D3-1 3F1-2 2I2-2 1B3-1 3H2-1 4G2-1 2C3-1 1C3-2 3H1-1 2D4-2 1A3-2 2E3-1 2E3-2 1A3-1

Raoultella ornithinolytica Raoultella ornithinolytica Raoultella ornithinolytica Raoultella ornithinolytica Enterobacter aerogenes Enterobacter aerogenes Pantoea agglomerans Acinetobacter baylyi Bacillus pumilus Pantoea sp. Bacillus megaterium Serratia marcescens Klebsiella oxytoca Klebsiella oxytoca Klebsiella pneumoniae

99 99 99 99 99 99 99 99 100 99 99 99 99 99 99

AM184250.1 AM184250.1 AB364958.1 AB364958.1 AB244456.1 EU855208.1 EF428993.1 EU604245.1 FJ234439.1 EF192586.1 FJ009396.1 EU031439.1 AB353048.1 EF127829.1 EU360791.1

382.0 244.6 407.9 381.2 466.3 429.1 180.1 354.3 226.7 21.1 17.9 16.1 8.7 12.8 9.0

NDb 12.8 21.8 22.8 22.0 86.6 67.3 ND 27.1 50.1 ND 45.7 ND 16.5 15.7

136.3 263.2 253.4 169.5 121.0 134.1 339.9 184.1 163.8 18.1 7.0 384.7 306.8 241.9 311.7

1.0 6.2 0.4 0.4 0.1 ND 0.1 ND ND 0.1 1.1 0.4 1.2 ND ND

Put: putrescine; Cad: cadaverine; His: histamine; Tyr: tyramine. ND: not detected (amine level less than 0.05 ppm).

981

H.-F. Kung et al. / Food Control 21 (2010) 977–982

M

N

A

B

C

D

E

F

G

H

I

Pork 290 bp 300 bp 200 bp

Fish 224 bp

100 bp

Poultry 183 bp

Fig. 1. Multiplex PCR of DNA from commercial tuna dumpling samples. Lane A–I, tuna dumpling samples; Lane N, negative control; M, 100 bp ladder.

Table 4 Results of ruminant, pork and poultry meats adulteration in the tuna dumpling samples. Sample

Ruminant

Pork

Poultry

A B C D E F G H I

        

+ + +  + + + + +

  +     + +

cII, RsaI, ScaI and MboII could be used to distinguish these four tuna species (Lin & Hwang, 2007). In this study, DNA from six samples (66.7%) of the tuna dumpling could be cut into 74 and 52 bp by RsaI, but not by HincII, and were identified as T. obesus. Other three samples (33.3%) were identified as T. thynnus by digesting for 75 and 51 bp, and 102 and 24 bp by Bsp1286I and RsaI in 126 bp fragment, respectively, as well as for 70, 66 and 10 bp by HincII in 146 bp fragment (Table 5). Therefore, six samples of tuna dumpling meat were identified as T. obesus, while other three samples were identified as T. thynnus (Table 5).

4. Conclusion Table 5 Identification of tuna fish species in the tuna dumpling samples with PCR–RFLP analysis. Sample Enzyme cuts in 126 bp fragments (bp)

A B C D E F G H I

Bsp1286I RsaI

ScaI MboII

126 126 75 + 51 126 75 + 51 126 126 75 + 51 126

126 126 126 126 126 126 126 126 126

74 + 52 74 + 52 102 + 24 74 + 52 102 + 24 74 + 52 74 + 52 102 + 24 74 + 52

126 126 126 126 126 126 126 126 126

HincII cut in 146 bp fragments (bp)

Species identification

146 146 70 + 66 + 10 146 70 + 66 + 10 146 146 70 + 66 + 10 146

Thynnus obesus T. obesus T. thynnus T. obesus T. thynnus T. obesus T. obesus T. thynnus T. obesus

Results of the multiplex PCR assay for meat species deification of ruminant, pork, fish and poultry were shown in Fig. 1 and Table 4. The four set primers generated specific fragments of 104 bp for ruminant, 183 bp for poultry, 224 bp for fish, and 290 bp for pork. As for all tuna dumpling meats, the fish species has always been detected and no ruminant species was detected. Three samples (C, H and I) contained poultry meat, whereas, pork was detected in eight samples (A, B, C, E, F, G, H and I). Only one sample, D, did not contain the pork and poultry (Fig. 1 and Table 4). The PCR–RFLP analysis of nine commercial tuna dumpling for tuna species identification was shown in Table 5. Lin and Hwang (2007) demonstrated that a PCR–RFLP method was applied to authenticate species of Thunnus thynnus, Thunnus alalunga, Thunnus obesus and Thunnus albacares in tuna products. It was successful to amplify the 126 bp and 146 bp fragments of partial mitochondrial cytochrome b gene in above four tuna species by using two primer sets of Cb126L/H and Cb146L/H, respectively. The digestion of five restriction enzymes including Bsp1286I, Hin-

This study showed that most tuna dumpling products sold in southern Taiwan contained APC and E. coli levels greater than Taiwanese regulatory limit of 6.47 log CFU/g and 50 MPN/g, respectively. The histamine contents in all tested tuna dumpling products were below the 5 mg/100 g US Food and Drug Administration (FDA) guideline. While the bacterial isolates of Pantoea sp. (one strain), S. marcescens (one strain), B. megaterium (one strain), K. oxytoca (two strains) and K. pneumoniae (one strain) were identified to be weak histamine-formers, the R. ornithinolytica (four strains), E. aerogenes (two strains), A. baylyi (one strain), P. agglomerans (one strain) and B. pumilus (one strain) isolates were proven to be prolific histamine-formers with ability to produce >180 ppm histamine in TSBH medium. All meat samples contained tuna meat of T. obesus or T. thynnus, but most of them were adulterated with pork or poultry.

Acknowledgements The study was supported by the National Science Council, Taiwan, R.O.C. (Contract No. NSC 97-2313-B-127 -002 -MY2) and the research grant provided by National Kaohsiung Marine University.

References AOAC (1995). Official methods of analysis of AOAC international (16th ed.). Arlington, VA: AOAC International. Chen, H. C., Huang, Y. R., Hsu, H. H., Lin, C. S., Chen, W. C., Lin, C. M., et al. (2010). Determination of histamine and biogenic amines in fish cubes (Tetrapturus angustirostris) implicated in a food-borne poisoning. Food Control, 21, 13–18. Chen, H. C., Kung, H. F., Chen, W. C., Lin, W. F., Hwang, D. F., Lee, Y. C., et al. (2008). Determination of histamine and histamine-forming bacteria in tuna dumpling implicated in a food-borne poisoning. Food Chemistry, 106, 612–618. Chen, K. T., & Malison, M. D. (1987). Outbreak of scombroid fish poisoning, Taiwan. American Journal of Public Health, 77, 1335–1336. Chikuni, K., Ozutsumi, K., Koishikawa, T., & Kato, S. (1990). Species identification of cooked meats by DNA hybridization assay. Meat Science, 27, 119–128.

982

H.-F. Kung et al. / Food Control 21 (2010) 977–982

Chikuni, K., Tabata, T., Kosugiyama, M., Momma, M., & Saito, M. (1994). Polymerase chain reaction assay for detection of sheep and goat meats. Meat Science, 37, 337–345. Cobb, B. F., Aoaniz, I., & Thompson, C. A. (1973). Biochemical and microbial studies on shrimp: Volatile nitrogen and amino nitrogen analysis. Journal of Food Science, 38, 431–435. Dalmasso, A., Fontanella, E., Piatti, P., Civera, T., Rosati, S., & Bottero, M. T. (2004). A multiplex PCR assay for the identification of animal species in feedstuffs. Molecular and Cellular Probes, 18, 81–87. FDA (1992). Bacteriological analytical manual. Arlington, VA: AOAC International. Fei, S., Okayama, T., Yamanoue, M., Nishikawa, I., Mannen, H., & Tsuji, S. (1996). Species identification of meats and meat products by PCR. Animal Science and Technology, 67, 900–905 (Japanese). Flick, G. J., Oria, M. P., & Douglas, L. (2001). Potential hazards in cold-smoked fish: Biogenic amines. Journal of Food Science., 66(Suppl.), S-1088–S-1099. Hsu, H. H., Cuang, T. C., Lin, H. C., Huang, Y. R., Lin, C. M., Kung, H. F., et al. (2009). Histamine content and histamine-forming bacteria in dried milkfish (Chanos chanos) products. Food Chemistry, 114, 933–938. Kim, S. H., Barros-Velazquez, J., Ben-Gigirey, B., Eun, J. B., Jun, S. H., Wei, C. I., et al. (2003). Identification of the main bacteria contributing to histamine formation in seafood to ensure product safety. Food Science and Biotechnology, 12, 451–460. Kim, S. H., Field, K. G., Morrissey, M. T., Price, R. J., Wei, C. I., & An, H. (2001). Source and identification of histamine-producing bacteria from fresh and temperatureabused albacore. Journal of Food Protection, 64, 1035–1044. Kuhnert, P., Capaul, S., Nicolet, J., & Frey, J. (1996). Phylogenetic positions of Clostridium chauvoei and Clostridium septicum based on 16S rRNA gene sequences. International Journal of Systematic Bacteriology, 46, 1174–1176. Kuhnert, P., Heyberger-Meyer, B., Nicolet, J., & Frey, J. (2000). Characterization of PaxA and Its operon: A cohemolytic RTX toxin determinant from pathogenic Pasteurella aerogenes. Infection and Immunity, 68, 6–12. Lin, W. F., & Hwang, D. F. (2007). Application of PCR–RFLP analysis on species identification of canned tuna. Food Control, 18, 1050–1057. Lopez-Sabater, E. I., Rodriguez-Jerez, J. J., Hernandez-Herrero, M., & Mora-Ventura, M. A. T. (1994). Evaluation of histidine decarboxylase activity of bacteria isolated from sardine (Sardina pilchardus) by an enzymatic method. Letter in Applied Microbiology, 19, 70–75. Lopez-Sabater, E. I., Rodriguez-Jerez, J. J., Hernandez-Herrero, M., Roig-Sagues, A. X., & Mora-Ventura, M. A. T. (1996). Sensory quality and histamine formation

during controlled decomposition of tuna (Thunnus thynnus). Journal of Food Protection, 59, 167–174. Matsunaga, T., Chikuni, K., Tanabe, R., Muroya, S., Shibata, K., Yamada, J., et al. (1999). A quick and simple method for the identification of meat species and meat products by PCR assay. Meat Science, 51, 143–148. Momcilovic, D., & Rasooly, A. (2000). Detection and analysis of animal materials in food and feed. Journal of Food Protection, 63, 1602–1609. Niven, C. F., Jeffreg, M. B., & Corlett, D. A. (1981). Differential plating medium for quantitative detection of histamine-producing bacteria. Applied and Environmental Microbiology, 41, 321–322. Okuzumi, M., Hiraishi, A., Kobayashi, T., & Fujii, T. (1994). Photobacterium histaminum sp. nov., a histamine-producing marine bacterium. International Journal of Systemic Bacteriology, 44, 631–636. Saiki, R. K., Schart, S., Faloona, F., Mullis, K. B., Horn, G. T., Erlich, H. A., et al. (1985). Enzymatic amplification of b-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science, 230, 1350–1354. Taylor, S. L. (1986). Histamine food poisoning: Toxicology and clinical aspects. Critical Reviews in Toxicology, 17, 91–117. Taylor, S. L., & Speckard, M. (1983). Isolation of histamine-producing bacteria from frozen tuna. Marine Fisheries Review, 45, 35–39. Tsai, Y. H., Kung, H. F., Chen, H. C., Chang, S. C., Hsu, H. H., & Wei, C. I. (2007). Determination of histamine and histamine-forming bacteria in dried milkfish (Chanos chanos) implicated in a food-born poisoning. Food Chemistry, 105, 1289–1296. Tsai, Y. H., Kung, H. F., Lee, T. M., Chen, H. C., Chou, S. S., Wei, C. I., et al. (2005). Determination of histamine in canned mackerel implicated in a food born poisoning. Food Control, 16, 579–585. Tsai, Y. H., Kung, H. F., Lee, T. M., Lin, G. T., & Hwang, D. F. (2004). Histamine related hygienic qualities and bacteria found in popular commercial scombroid fish fillets in Taiwan. Journal of Food Protection, 67, 407–412. Tsai, Y. H., Lin, C. Y., Chang, S. C., Chen, H. C., Kung, H. F., Wei, C. I., et al. (2005). Occurrence of histamine and histamine-forming bacteria in salted mackerel in Taiwan. Food Microbiology, 22, 461–467. Wintero, A. K., Thomsen, P. D., & Davies, W. (1990). A comparison of DNA-hybridization, immunodiffusion, countercurrent immunoelectrophoresis and isoelectric focusing for detecting the admixture of pork to beef. Meat Science, 27, 75–85. Yatsunami, K., & Echigo, T. (1991). Isolation of salt tolerant histamine-forming bacteria from commercial rice-bran pickle sardine. Bulletin of the Japanese Society of Scientific Fisheries, 57, 1723–1728.