- Email: [email protected]
Bioinspired DNA self-assembly for targeted cancer cell imaging and drug delivery
Colloids and Surfaces A 585 (2020) 124182
Contents lists available at ScienceDirect
Colloids and Surfaces A journal homepage: www.elsevier.com/locate/colsurfa
Bioinspired DNA self-assembly for targeted cancer cell imaging and drug delivery
T
Si Suna,1, Qian-Ru Xiaob,1, Jing Weic, Ying-Ying Weia, Yang Wanga, Peng-Cheng Gaoa, Yong Jianga,* a
School of Chemistry and Chemical Engineering, Jiangsu Province Hi-Tech Key Laboratory for Biomedical Research, Southeast University, Nanjing 211189, PR China State Key Laboratory of Bioelectronics, School of Biological Sciences and Medical Engineering, Southeast University, Nanjing 210096, PR China c Jiaxing University Nanhu College, Jiaxing 314000, PR China b
GRAPHICAL ABSTRACT
ARTICLE INFO
ABSTRACT
Keywords: DNA assembly Aptamer MCF-7 cell Cell imaging Drug delivery
In this study, a novel beansprout-like aptamer-tethered DNA assembly was developed for targeted cell imaging and drug delivery. The DNA self-assembly was consisted of two aptamer-tethered single-stranded DNAs (“cotyledons”) and a double-strand DNA (“hypocotyl”). With two cotyledons binding to the target cell’s membrane and a hypocotyl intercalated with drugs or fluorescent dyes, the DNA bean sprout (DNA BS) could deliver drugs to the target cancer cell as well as imaging them. The results show that DNA BS has stronger targeting ability, higher cellular uptake, and more efficient delivery of drugs to MCF-7 cells than the monovalent DNA assembly. This work provides a new way to design bioinspired drug carriers for live cell imaging and targeted drug delivery.
1. Introduction Chemotherapy is still the most common strategy for the treatment of
cancer. To improve the efficacy and specificity, researchers have developed numerous materials to deliver the drugs used for chemotherapy [1–3]. DNA is one of the most used materials to develop functional
Corresponding author. E-mail address: [email protected] (Y. Jiang). 1 Si Sun and Qian-Ru Xiao contributed equally to this work. ⁎
https://doi.org/10.1016/j.colsurfa.2019.124182 Received 27 August 2019; Received in revised form 31 October 2019; Accepted 31 October 2019 Available online 04 November 2019 0927-7757/ © 2019 Elsevier B.V. All rights reserved.
Colloids and Surfaces A 585 (2020) 124182
S. Sun, et al.
nanostructures due to its good biocompatibility and the precise and highly efficient complementary base pairing [4–6]. These DNA assemblies were often modified with aptamers to improve their penetration through the cell membranes and the transfection efficiency [7]. Previous studies proved that aptamers could recognize the cell surface receptors and help import the aptamer-tethered particles into target cells [8,9], thus realizing the targeted drug delivery [10–12]. Nucleic acid aptamers are single-stranded oligonucleotide molecules which can fold into unique intramolecular 3D structures and bind to the target cells with high affinity [13]. Recently, aptamer-tethered DNA self-assemblies have been investigated thoroughly for drug delivery, cell diagnosis, and oligonucleotides delivery [14–16]. Tan et al. reported that aptamer-tethered DNA nanotrains which were assembled from two short DNA building blocks could target the cancer cells and deliver the drugs [17]. Moreover, multivalent binding exhibited much higher affinity and selectivity to the target cell than monovalent binding [18], as well as providing an opportunity for integrated platforms with multiple functions [19]. A number of artificial multivalent platforms have been synthesized and applied in the biological field [20–22]. For example, Li et al. fabricated multivalent DNA nano-centipedes with strong binding ability to SMMC-7721 cells. However, the preparation of the nanocentipedes needs costly biotin and streptavidin-modified DNA strands, thus restricting its generalization. In this study, inspired by the shape of bean sprouts, a novel costeffective DNA assembly (DNA BS) tethered with two aptamer molecules was designed as a bi-valent carrier for targeted live cell imaging and drug delivery. As illustrated in Scheme 1, DNA BS was prepared through the hybridization chain reaction (HCR) in a one-pot annealing process [23]. As for the reaction, five complementary single-stranded DNAs (ssDNAs), including one trigger ssDNA (Trigger), two aptamertethered ssDNAs (Primer1, Primer2), and two hairpin repetitive ssDNAs (Linker1, Linker2) were use. The sequences of all the ssDNAs are listed in Table 1. In brief, Primer 1, Primer 2 and the Trigger paired with each other to form the structures of two cotyledons whilst the autonomous cross-opening of Linker 1 and Linker 2 initiated by the Trigger produced a hypocotyl structure. The two aptamers of the DNA BS could help the assembly selectively bind to the target cells and enter through endocytosis. The hypocotyl of the DNA BS intercalated with fluorescent
dyes or doxorubicin (DOX) molecules help realize the targeted live cell imaging and drug delivery. 2. Experimental 2.1. Materials Yeast tRNA (BC Grade) and SYBR Green I (Biotech Grade) were purchased from Sangon Biotech. Co. Ltd. (Shanghai, China). Fetal bovine serum (FBS) (Cell Culture Grade) was purchased from Wisent (Canada). Non-enzy cell detach solution (Biotech Grade) was purchased from Applygen Co. Ltd. (Beijing, China). Lyso Tracker Blue (Biotech Grade) was purchased from KeyGen Biotech. Co. Ltd. (Nanjing, China). (3-(4, 5-dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide) MTT (Biotech Grade) was purchased from Beyotime Biotech. Co. Ltd. (Shanghai, China). DNA sequences were synthesized by Sangon Biotech. Co. Ltd. (Shanghai, China). Michigan Cancer Foundation-7 (MCF-7) cells and Human Foreskin Fibroblast (HFF) cells were obtained from the Chinese Academy of Sciences Cells Bank. All chemicals were used as received. Ultrapure water used in this experiment was distilled. 2.2. Preparation of DNA BS To prepare DNA BS, DNA strands Trigger, Primer 1, Primer 2, Linker 1 and Linker 2 were dissolved in PBS solution to a final concentration of 50 μM. Then, 8 μL of Trigger, Primer 1, Primer 2 were mixed with 20 μL of Linker 1 and Linker 2. The mixture was diluted to a final volume of 100 μL and undertook an annealing process from 95 °C (keeping for 3 min) to room temperature (25 °C) with a PCR-cycler (Eppendorf AG 22331 Hamburg) in 70 min. After that, the sample was kept at room temperature for 24 h to complete the process. The assembled products were used without further treatment. 2.3. Preparation of SYBR Green I and DOX loaded DNA BS To prepare the dye-loaded DNA BS, 1 μL SYBR Green I was diluted in 100 μL PBS solution. Then, 10 μL diluted dye solution was mixed with 100 μL of DNA BS products for 5 min and ultra-filtrated to remove Scheme 1. Schematic illustration of the selfassembling process and the targeted molecule delivery of the DNA BS. In a one pot process, the two aptamer-tethered ssDNAs and the trigger ssDNA pair with each other, forming a bean sprout-shaped DNA with two cotyledons consisted of two aptamers which could selectively target MCF-7 cells and a hypocotyl which could allow the intercalation of fluorescent dyes and drug molecules.
2
Colloids and Surfaces A 585 (2020) 124182
S. Sun, et al.
Table 1 Sequences of DNA probes. Probes
Sequences (5′-3′)
Trigger Primer 1 Primer 2 Linker 1 Linker 2 FITC-Linker 1
CGTCGTGCAGCAGCAGCAGCAGCATTTTTTGGATCCGCATGACATTCGCCGTAAG GGTGGTGGTGGTTGTGGTGGTGGTGGTTTTTTCTTACGGCGAATGACCGAATCAGCCT GGTGGTGGTGGTTGTGGTGGTGGTGGTTTTTTAGGCTGATTCGGTTCATGCGGATCCA CGTCGTGCAGCAGCAGCAGCAGCAACGGCTTGCTGCTGCTGCTGCTGC TGCTGCTGCTGCTGCTGCACGACGGCAGCAGCAGCAGCAGCAAGCCGT FITC-CGTCGTGCAGCAGCAGCAGCAGCAACGG CTTGCTGCTGCTGCTGCTGC FITC-CGTCGTGCAGCAGCAGCAGCAGCAACGG CTTGCTGCTGCTGCTGCTGC
FITC-Linker 2
the dissociative dye molecules. Similarly, a certain amount of DOX was mixed with DNA BS products and stored at room temperature for 2 h.
2.10. Cell viability assay MTT assay was used to determine the in vitro cytotoxicity. Briefly, MCF-7 cells seeded in 96 well plates were incubated with different concentrations of samples in culture medium for 48 h. Subsequently, culture medium was replaced by 100 μL fresh cell culture medium containing 10 μL (5 mg/mL in PBS) MTT solution and incubate for another 4 h. Finally, the medium was discarded and replaced by 150 μL DMSO per well to dissolve the formazan crystals. The 96 well plates was analyzed by Thermo Go Microplate Absorbance Reader at 490 nm. Cell viability (%) was calculated according to the following equation:
2.4. Agarose gel electrophoresis analysis 3% agarose gel was prepared with 30 mL 1 × TAE buffer and stained with 3 μL Gel Red. The electrophoresis was conducted under 90 V at room temperature and the image was taken by Kodak Gel Logic 112 imaging system. 2.5. Atomic force microscope (AFM) analysis
(At (Au
DNA BS was prepared according to the above-mentioned method and diluted 100 fold with TAE-Mg2+ (40 mM Tris AcOH, 2.0 mM Na2EDTA, 12.5 mM Ac2Mg, pH 8.5). Mica was cleaved by adhensive tapes first and the sample was pipetted onto the mica. After 5 min, the mica was washed 5 times by 100 μL purified water and dried by nitrogen gas. Finally, the sample was analyzed by the Atomic Force Microscope (Bruker Inc.).
Ac ) × 100% Ac )
where At, Au, Ac represent the absorbance of the treated wells, untreated wells and control wells (without cells) respectively. All tests in this part were repeated four times and the results were given as mean ± SEM.
2.6. Fluorescence characterization
3. Results and discussion
The fluorescent dye and DOX-loaded DNA BS was analyzed by fluorescence spectrometry (excitation wavelength: 510 nm) with a Horiba Fluoromax-4 fluorescence spectrometer.
3.1. Agarose gel electrophoresis and AFM analysis of the DNA BS Scheme1 illustrated the construction process of the DNA BS. Briefly, in a one-pot process, two primers and the trigger paired with each other to form the cotyledon-like structures whilst the trigger initiated an autonomous cross-opening of two repetitive hairpin monomers to produce a “hypocotyl-like structure”. The assembled products were evaluated by agarose gel electrophoresis and the results are shown in Fig. 1A. Lane 1 contains low molecular-weight DNA markers (from 25 bp to 500 bp). Lane 2 to Lane 6 contain Band II to Band V produced by the original DNA strands: Linker 1, Linker 2, Trigger, Primer 1 and Primer 2, respectively. The products assembled from two ssDNAs (Trigger + Primer 1) and three ssDNAs (Trigger + Primer 1 + Primer 2) produced band VI and band VII, respectively. Lane 9 contains the bands produced by DNA BS molecules. Band VI exhibited an obvious lower electrophoresis rate than that of Trigger or Primer 1, indicating that the assembly had higher molecular weight than single DNA strands. Similarly, Band VII had lower electrophoresis rate than Band VI, indicating the successful pairing of Trigger + Primer 1 and Trigger + Primer 1 + Primer 2. Furthermore, band in Lane 9 showed a continuously long tail, demonstrating the successful synthesis of long-chain DNAs with different molecular weights. The result of the AFM analysis of DNA BS is shown in Fig. 1B. Though the “cotyledon-like structure” couldn’t be seen clearly due to the low resolution, different lengths of the “hypocotyl-like structure” were observed and the mean length is 49 nm. The results of agarose gel electrophoresis and AFM analysis provide a preliminary presumption that the DNA BS was successfully made.
2.7. Cell culture High-glucose DMEM containing 10% of fetal bovine serum (FBS) was used for both MCF-7 cells and HFF cells. All cells were cultured in an atmosphere of 5% CO2 at 37 °C in standard cell incubator. 2.8. Flow cytometry analysis The washing buffer was prepared by dissolving glucose (4.5 g/L) and MgCl2 (5 mM) in PBS solution. Binding buffer was prepared by dissolving yeast tRNA (0.1 mg/mL) and BSA (1 mg/mL) in washing buffer. After culturing for 24 h, MCF-7 cells or HFF cells were digested with non-enzy cell detach solution and suspended in binding buffer or cell culture medium. Cells were incubated with FITC-labeled DNA samples at 4 °C for 30 min and washed with washing buffer. Finally, the samples were analyzed on a BD Biosciences Accuri C6 flow cytometry. 2.9. Laser confocal scanning microscopic analysis MCF-7 cells and HFF cells were cultured in 35 mm confocal dish for 24 h. Then, cells were incubated with the SYBR Green I-dyed DNA samples at 37 °C for 2 h. Cells were subsequently washed and dyed with Lyso Tracker Blue for 10 min. Finally, the dish was washed twice and immersed with 500 μL PBS solution. Fluorescent images were taken on an Olympus FV3000 Laser confocal scanning microscope with a 60× oil immersion lens. 3
Colloids and Surfaces A 585 (2020) 124182
S. Sun, et al.
Fig. 1. (A) Agarose gel electrophoresis analysis of DNA BS. Lane 1: low molecular weight DNA marker (from 25 bp to 500 bp). Lane 2 to lane 6: ssDNA (Linker 1, Linker 2, Trigger, Primer 1 and Primer 2). Lane 7: assembled products of Trigger, Primer 1. Lane 8: assembled products of Trigger, Primer 1, and Primer 2. Lane 9: the DNA BS products; (B) AFM image of the DNA BS.
Fig. 2. Flow cytometric analysis of the binding affinity and selectivity of the DNA BS with MCF-7 cells (A) and HFF cells (B) in binding buffer and with MCF-7 cells (C) and HFF cells (D) in serum contained cell culture medium.
4
Colloids and Surfaces A 585 (2020) 124182
S. Sun, et al.
respectively incubated with single-aptamer-tethered DNA nano-trunk (Single-Apt), random sequence-tethered DNA BS (Ram-DNA), mixed solution of Linker 1 and Linker 2 (L1 + L2), and the DNA BS [24] in binding buffer at 4 °C for 30 min, respectively. Results are shown in Fig. 2A. MCF-7 cells treated with both the Single-Apt and the DNA BS exhibited higher fluorescence intensity than the MCF-7 cells without treatment, suggesting that aptamer could help DNA assembly target MCF-7 cells. In addition, the fluorescence intensity of the cells treated with DNA BS was higher than that of the Single-Apt, indicating that the bi-valent DNA BS had higher binding ability than the monovalent nano-trunk. It is in consistency with the previous study that multiple ligands can significantly enhance the binding efficiency [25]. On the other hand, the fluorescence intensity of MCF-7 cells treated with Ram-DNA and L1 + L2 was similar to that of MCF-7 cells without treatment, proving that DNA assemblies without aptamers could not bind to the target cell. Moreover, the fact that cells treated with L1 + L2 showed no enhancement of the fluorescence intensity indicates that Linker 1 and Linker 2 alone could not target MCF7 cells. As shown in Fig. 2B, all the treated cells exhibited similar level of fluorescence intensity to the untreated cells, indicating that none of the DNA assemblies could bind to HFF cells. The results demonstrated DNA BS’ selective binding ability in binding buffer. To further investigate the selective performance of DNA BS, complete cell culture medium containing 10% FBS was used to mimic a more physiological environment [22]. Similarly, the Single-Apt, the Ram-DNA, the L1 + L2, and the DNA BS were first dissolved in cell culture medium. Next, both MCF-7 cells and HFF cells were incubated with the particles at 37 °C for 30 min. Results are shown in Fig. 2C and D. While both the monovalent nano-trunk and the bi-valent DNA BS showed specific binding ability to MCF-7 cells but not to HFF cells, DNA BS nevertheless exhibited higher binding ability than the monovalent
Fig. 3. Fluorescent intensity characterization of free SYBR Green I (red curve and inserted image of the fluorescent curve) and SYBR Green I-loaded DNA BS (green curve). Inserted images: digital photos of the free dye solution and the dye-loaded DNA BS solution under UV light (For interpretation of the references to colour in the figure legend, the reader is referred to the web version of this article).
3.2. Flow cytometry analysis of the DNA BS in binding buffer Flow cytometry analysis was employed to reconnoiter the binding ability and selective recognition of the DNA BS. To visualize the DNA BS, Linker 1 and Linker 2 were labeled with FITC while other sequences were not. Michigan Cancer Foundation-7 (MCF-7) cells (target cells) and Human Foreskin Fibroblast (HFF) cells (control cells) were
Fig. 4. Time-dependent cellular internalization of the DNA BS incubated with MCF-7 cells. Scale bar: 40 μm. 5
Colloids and Surfaces A 585 (2020) 124182
S. Sun, et al.
Fig. 5. LCSM images of cellular internalization of the DNA BS in different cells and Single aptamer-tethered DNA nano-trunk in MCF-7 cells. Scale bar: 40 μm.
Fig. 6. (A) Cytotoxicity of different concentrations of dye-DNA BS and (B) magnified fluorescent image of dye-DNA BS-treated MCF-7 cells. Scale bar: 40 μm.
nano-trunk. Altogether, the results demonstrated that DNA BS could selectively bind to target cells in the physiological environment.
3.4. Time-dependent cellular internalization of the DNA BS Cellular internalization is a vital step to achieve the target living cell imaging and drug delivery. In this study, laser confocal scanning microscopy (LCSM) was used to study the cellular internalization of the DNA BS. Lysosomes were stained with Lyso Tracker Blue to recover the location of the DNA BS [22]. First, we studied the time-dependent cellular internalization of the DNA BS into MCF-7 cells. MCF-7 cells were incubated with SYBR Green I-loaded DNA assemblies for 15 min, 45 min and 120 min, respectively. Results are shown in Fig. 4. It is found that the fluorescence intensity of MCF-7 cells incubated with DNA BS increased with culture time, indicating that the amount of DNA assemblies internalized by MCF-7 cells increased gradually [22,26]. Furthermore, the green fluorescence of SYBR Green I overlapped with
3.3. Fluorescence property of SYBR Green I-dyed DNA BS Results of the fluorescent intensities of free SYBR Green I and SYBR Green I-loaded DNA BS are shown in Fig. 3. Both the fluorescence spectrums and UV light images revealed that SYBR Green I-loaded DNA BS had much higher fluorescence intensity than the free SYBR Green I. This fluorescence property makes DNA BS more suitable for the living cell imaging.
6
Colloids and Surfaces A 585 (2020) 124182
S. Sun, et al.
Fig. 7. (A) DOX loading capacity of the DNA BS tested by fluorescence spectrophotometer and (B) selective cytotoxicity of the drug loaded DNA BS measured by MTT (Mean ± SEM).
the blue fluorescence of Lyso Tracker Blue, implying that DNA BS mainly located at lysosomes after internalization [27].
Apt were loaded with 5 μM DOX (DNA BS-DOX and Single-Apt-DOX). The concentration of the DOX used here was based on previous works [7,22]. MCF-7 cells and HFF cells were respectively incubated with DNA BS-DOX, Single-Apt-DOX, free DOX and 1 μM DNA BS. MTT assay was used to examine the cell viability. Results are shown in Fig. 7B. It is found that free DOX had high cytotoxicity to both MCF-7 cells and HFF cells, whereas DNA BS-DOX only had high cytotoxicity to MCF-7 cells but not to HFF cells, demonstrating a selective cytotoxicity of DNA BSDOX. Moreover, DNA BS-DOX exhibited higher cytotoxicity to MCF-7 cells than the Single-Apt-DOX, indicating that bi-valency is better than monovalency. On the contrary, DNA BS without drugs showed extremely low cytotoxicity to both MCF-7 cells and HFF cells, further demonstrating its good biocompatibility. These results suggest that DNA BS is suitable for targeted drug delivery.
3.5. Selective cellular internalization of the DNA BS To investigate the selective cellular internalization, the target MCF7 cells were incubated with DNA BS and Single-Apt respectively. HFF cells were used as control. Results shown in Fig. 5 exhibit that the blue fluorescence of Lyso Tracker blue was overlapped with the green fluorescence of the DNA BS, suggesting that DNA BS were in the lysosomes after being internalized by MCF-7 cells. On the other hand, HFF cells treated with DNA BS showed low fluorescence intensity, indicating that HFF cells could not efficiently internalize the DNA BS. These results further demonstrated the selective cellular internalization of DNA BS into the target MCF-7 cells. In addition, MCF-7 cells treated with the DNA BS exhibited much higher fluorescence intensity than that with Single-Apt, implying that the bi-valent DNA BS had higher target ability than the monovalent DNA assembly.
4. Conclusion In summary, a novel biocompatible bean sprout-inspired DNA BS was developed for live cell imaging and targeted drug delivery. The DNA BS was fabricated through a facile one-pot process and tethered with two aptamers which could target MCF-7 cells. It is demonstrated that DNA BS had stronger binding affinity, enhanced cellular uptake, and more selective cytotoxicity to the target MCF-7 cells than the monovalent DNA assemblies. We believe that this study provides a new way to design bioinspired drug carriers for live cell imaging and targeted drug delivery.
3.6. Cytotoxicity of the SYBR Green I-labeled DNA BS To evaluate the biocompatibility and potential application of the SYBR Green I-loaded DNA BS (dye-DNA BS), the viability of MCF-7 cells treated with dye-DNA BS were investigated using MTT assay analysis. To start with, cells were incubated with different concentrations of the dye-DNA BS for 48 h. And the data were collected by a microplate reader. Results in Fig. 6A show that the viability value of all the MCF-7 cells treated was above 95% even when the concentration reaches 1000 nM. It can be concluded that the dye-DNA BS has good biocompatibility and suitable for live cell imaging.
Declaration of competing interest There are no conflicts to declare.
3.7. DOX loading capacity of the DNA BS
Acknowledgements
Previous studies have shown that when DOX molecules intercalate into C–G pairs of the DNA double strands, their fluorescence would quench [17,28]. Therefore, we can determine the DOX loading capacity of DNA BS by examining the change of the fluorescence intensity. To begin with, 2 μM DOX was added into different concentrations of DNA BS solutions. Then a fluorescence spectrophotometer was used to measure the drug loading capacity of the DNA BS. The results are shown in Fig. 7A. It can be seen that with the concentration of DNA BS increasing, the fluorescence intensity decreased. When the concentration of DNA BS reached 80 nM, the fluorescence intensity decreased to an extremely low level, indicating 80 nM DNA BS is enough to load 2 μM DOX. Therefore, the estimated DOX loading level of DNA BS is about 1:25.
This work was supported by the Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD), and the Fundamental Research Funds for the Central Universities with grant number 2242016K41020. References [1] W. Wang, H. Guo, L. Zeng, J. Zhou, L. Zhao, G. Zhang, C. Wang, B. Xu, Self-assembly of two ferrocence-and α-cyclodextrin-derived unconventional amphiphiles with redox responsiveness, Colloids Surf. A 558 (2018) 117–122. [2] E. Mei, S. Li, J. Song, R. Xing, Z. Li, X. Yan, Self-assembling collagen/alginate hybrid hydrogels for combinatorial photothermal and immuno tumor therapy, Colloids Surf. A 577 (September 20) (2019) 570–575. [3] J. Shen, Y. Wang, P. Fan, L. Jiang, W. Zhuang, Y. Han, H. Zhang, Self-assembled vesicles formed by C18 unsaturated fatty acids and sodium dodecyl sulfate as a drug delivery system, Colloids Surf. A 568 (2019) 66–74. [4] Y. He, T. Ye, M. Su, C. Zhang, A.E. Ribbe, W. Jiang, C. Mao, Hierarchical selfassembly of DNA into symmetric supramolecular polyhedra, Nature 452 (2008) 198–201.
3.8. Cell viability of the DOX-loaded DNA BS To examine the selective cytotoxicity, both DNA BS and the Single7
Colloids and Surfaces A 585 (2020) 124182
S. Sun, et al. [5] P.W. Rothemund, Folding DNA to create nanoscale shapes and patterns, Nature 440 (2006) 297–302. [6] Y. Dong, Y.R. Yang, Y. Zhang, D. Wang, X. Wei, S. Banerjee, Y. Liu, Z. Yang, H. Yan, D. Liu, Cuboid vesicles formed by frame-guided assembly on DNA origami scaffolds, Angew. Chem. Int. Ed. 56 (2017) 1586–1589. [7] M. Chang, C.-S. Yang, D.-M. Huang, Aptamer-conjugated DNA icosahedral nanoparticles as a carrier of doxorubicin for cancer therapy, Acs Nano 5 (2011) 6156–6163. [8] J. Li, M. Xu, H. Huang, J. Zhou, E. Abdel-Halimb, J.R. Zhang, J.J. Zhu, Aptamerquantum dots conjugates-based ultrasensitive competitive electrochemical cytosensor for the detection of tumor cell, Talanta 85 (2011) 2113–2120. [9] L. Qiu, T. Chen, I. Oçsoy, E. Yasun, C. Wu, G. Zhu, M. You, D. Han, J. Jiang, R. Yu, A cell-targeted, size-photocontrollable, nuclear-uptake nanodrug delivery system for drug-resistant cancer therapy, Nano Lett. 15 (2014) 457–463. [10] K. Liu, H. Li, G.R. Williams, J. Wu, L.M. Zhu, pH-responsive liposomes self-assembled from electrosprayed microparticles, and their drug release properties, Colloids Surf. A 537 (2018) 20–27. [11] H. Sun, S. Li, W. Qi, R. Xing, Q. Zou, X. Yan, Stimuli-responsive nanoparticles based on co-assembly of naturally-occurring biomacromolecules for in vitro photodynamic therapy, Colloids Surf. A 538 (2018) 795–801. [12] J. Yang, L. Yun, G. Zhao, F. Zhang, Y. Chen, C. Wang, Fabrication of pH-responsive system based on cationic gemini surfactant/sodium octanedioate and its application on controlled release of paclitaxel, Colloids Surf. A 539 (2018) 101–108. [13] K. Sefah, D. Shangguan, X. Xiong, M.B. O’Donoghue, W. Tan, Development of DNA aptamers using cell-SELEX, Nat. Protoc. 5 (2010) 1169–1185. [14] D. Kim, Y.Y. Jeong, S. Jon, A drug-loaded aptamer-gold nanoparticle bioconjugate for combined CT imaging and therapy of prostate cancer, ACS Nano 4 (2010) 3689–3696. [15] W. Li, L. Luo, J. Huang, Q. Wang, J. Liu, X. Xiao, H. Fang, X. Yang, K. Wang, Selfassembled DNA nanocentipedes as multivalent vehicles for enhanced delivery of CpG oligonucleotides, Chem. Commun. 53 (2017) 5565–5568. [16] J.K. Herr, J.E. Smith, C.D. Medley, D. Shangguan, W. Tan, Aptamer-conjugated nanoparticles for selective collection and detection of cancer cells, Anal. Chem. 78 (2006) 2918–2924.
[17] G. Zhu, J. Zheng, E. Song, M. Donovan, K. Zhang, C. Liu, W. Tan, Self-assembled, aptamer-tethered DNA nanotrains for targeted transport of molecular drugs in cancer theranostics, Proc. Natl. Acad. Sci. 110 (2013) 7998–8003. [18] J.H. Myung, K.A. Gajjar, J. Saric, D.T. Eddington, S. Hong, Dendrimer-mediated multivalent binding for the enhanced capture of tumor cells, Angew. Chem. Int. Ed. 123 (2011) 11973–11976. [19] K. Ulbrich, K.I. Holá, V. Subr, A. Bakandritsos, J. Tucek, R. Zboril, Targeted drug delivery with polymers and magnetic nanoparticles: covalent and noncovalent approaches, release control, and clinical studies, Chem. Rev. 116 (2016) 5338–5431. [20] R.C. Huang, W.J. Chiu, L.I. Pojung, C.C. Huang, Multivalent aptamer/gold nanoparticle-modified graphene oxide for mass spectrometry-based tumor tissue imaging, Sci. Rep. 5 (2015) 10292. [21] J. Kim, E. Lee, Y.Y. Kang, H. Mok, Multivalent aptamer-RNA based fluorescent probes for carrier-free detection of cellular microRNA-34a in mucin1-expressing cancer cells, Chem. Commun. 51 (2015) 9038–9041. [22] W. Li, X. Yang, L. He, K. Wang, Q. Wang, J. Huang, J. Liu, B. Wu, C. Xu, Selfassembled DNA nanocentipede as multivalent drug carrier for targeted delivery, ACS Appl. Mater. Interfaces 8 (2016) 25733–25740. [23] D. Evanko, Hybridization chain reaction, Nat. Methods 1 (2004) 186–187. [24] H. Motaghi, M.A. Mehrgardi, P. Bouvet, Carbon dots-AS1411 aptamer nanoconjugate for ultrasensitive spectrofluorometric detection of cancer cells, Sci. Rep. 7 (2017) 10513. [25] C. Fasting, C.A. Schalley, M. Weber, O. Seitz, S. Hecht, B. Koksch, J. Dernedde, C. Graf, E.W. Knapp, R. Haag, Multivalency as a chemical organization and action principle, Angew. Chem. Int. Ed. 51 (2012) 10472–10498. [26] S. Yu, R. Dong, J. Chen, F. Chen, W. Jiang, Y. Zhou, X. Zhu, D. Yan, Synthesis and self-assembly of amphiphilic aptamer-functionalized hyperbranched multiarm copolymers for targeted cancer imaging, Biomacromolecules 15 (2014) 1828–1836. [27] L. He, X. Yang, F. Zhao, K. Wang, Q. Wang, J. Liu, J. Huang, W. Li, M. Yang, Selfassembled supramolecular nanoprobes for ratiometric fluorescence measurement of intracellular pH values, Anal. Chem. 87 (2015) 2459–2465. [28] Z.-M. Zhang, P.-C. Gao, Z.-F. Wang, B.-W. Sun, Y. Jiang, DNA-caged gold nanoparticles for controlled release of doxorubicin triggered by a DNA enzyme and pH, Chem. Commun. 51 (2015) 12996–12999.
8
Contents lists available at ScienceDirect
Colloids and Surfaces A journal homepage: www.elsevier.com/locate/colsurfa
Bioinspired DNA self-assembly for targeted cancer cell imaging and drug delivery
T
Si Suna,1, Qian-Ru Xiaob,1, Jing Weic, Ying-Ying Weia, Yang Wanga, Peng-Cheng Gaoa, Yong Jianga,* a
School of Chemistry and Chemical Engineering, Jiangsu Province Hi-Tech Key Laboratory for Biomedical Research, Southeast University, Nanjing 211189, PR China State Key Laboratory of Bioelectronics, School of Biological Sciences and Medical Engineering, Southeast University, Nanjing 210096, PR China c Jiaxing University Nanhu College, Jiaxing 314000, PR China b
GRAPHICAL ABSTRACT
ARTICLE INFO
ABSTRACT
Keywords: DNA assembly Aptamer MCF-7 cell Cell imaging Drug delivery
In this study, a novel beansprout-like aptamer-tethered DNA assembly was developed for targeted cell imaging and drug delivery. The DNA self-assembly was consisted of two aptamer-tethered single-stranded DNAs (“cotyledons”) and a double-strand DNA (“hypocotyl”). With two cotyledons binding to the target cell’s membrane and a hypocotyl intercalated with drugs or fluorescent dyes, the DNA bean sprout (DNA BS) could deliver drugs to the target cancer cell as well as imaging them. The results show that DNA BS has stronger targeting ability, higher cellular uptake, and more efficient delivery of drugs to MCF-7 cells than the monovalent DNA assembly. This work provides a new way to design bioinspired drug carriers for live cell imaging and targeted drug delivery.
1. Introduction Chemotherapy is still the most common strategy for the treatment of
cancer. To improve the efficacy and specificity, researchers have developed numerous materials to deliver the drugs used for chemotherapy [1–3]. DNA is one of the most used materials to develop functional
Corresponding author. E-mail address: [email protected] (Y. Jiang). 1 Si Sun and Qian-Ru Xiao contributed equally to this work. ⁎
https://doi.org/10.1016/j.colsurfa.2019.124182 Received 27 August 2019; Received in revised form 31 October 2019; Accepted 31 October 2019 Available online 04 November 2019 0927-7757/ © 2019 Elsevier B.V. All rights reserved.
Colloids and Surfaces A 585 (2020) 124182
S. Sun, et al.
nanostructures due to its good biocompatibility and the precise and highly efficient complementary base pairing [4–6]. These DNA assemblies were often modified with aptamers to improve their penetration through the cell membranes and the transfection efficiency [7]. Previous studies proved that aptamers could recognize the cell surface receptors and help import the aptamer-tethered particles into target cells [8,9], thus realizing the targeted drug delivery [10–12]. Nucleic acid aptamers are single-stranded oligonucleotide molecules which can fold into unique intramolecular 3D structures and bind to the target cells with high affinity [13]. Recently, aptamer-tethered DNA self-assemblies have been investigated thoroughly for drug delivery, cell diagnosis, and oligonucleotides delivery [14–16]. Tan et al. reported that aptamer-tethered DNA nanotrains which were assembled from two short DNA building blocks could target the cancer cells and deliver the drugs [17]. Moreover, multivalent binding exhibited much higher affinity and selectivity to the target cell than monovalent binding [18], as well as providing an opportunity for integrated platforms with multiple functions [19]. A number of artificial multivalent platforms have been synthesized and applied in the biological field [20–22]. For example, Li et al. fabricated multivalent DNA nano-centipedes with strong binding ability to SMMC-7721 cells. However, the preparation of the nanocentipedes needs costly biotin and streptavidin-modified DNA strands, thus restricting its generalization. In this study, inspired by the shape of bean sprouts, a novel costeffective DNA assembly (DNA BS) tethered with two aptamer molecules was designed as a bi-valent carrier for targeted live cell imaging and drug delivery. As illustrated in Scheme 1, DNA BS was prepared through the hybridization chain reaction (HCR) in a one-pot annealing process [23]. As for the reaction, five complementary single-stranded DNAs (ssDNAs), including one trigger ssDNA (Trigger), two aptamertethered ssDNAs (Primer1, Primer2), and two hairpin repetitive ssDNAs (Linker1, Linker2) were use. The sequences of all the ssDNAs are listed in Table 1. In brief, Primer 1, Primer 2 and the Trigger paired with each other to form the structures of two cotyledons whilst the autonomous cross-opening of Linker 1 and Linker 2 initiated by the Trigger produced a hypocotyl structure. The two aptamers of the DNA BS could help the assembly selectively bind to the target cells and enter through endocytosis. The hypocotyl of the DNA BS intercalated with fluorescent
dyes or doxorubicin (DOX) molecules help realize the targeted live cell imaging and drug delivery. 2. Experimental 2.1. Materials Yeast tRNA (BC Grade) and SYBR Green I (Biotech Grade) were purchased from Sangon Biotech. Co. Ltd. (Shanghai, China). Fetal bovine serum (FBS) (Cell Culture Grade) was purchased from Wisent (Canada). Non-enzy cell detach solution (Biotech Grade) was purchased from Applygen Co. Ltd. (Beijing, China). Lyso Tracker Blue (Biotech Grade) was purchased from KeyGen Biotech. Co. Ltd. (Nanjing, China). (3-(4, 5-dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide) MTT (Biotech Grade) was purchased from Beyotime Biotech. Co. Ltd. (Shanghai, China). DNA sequences were synthesized by Sangon Biotech. Co. Ltd. (Shanghai, China). Michigan Cancer Foundation-7 (MCF-7) cells and Human Foreskin Fibroblast (HFF) cells were obtained from the Chinese Academy of Sciences Cells Bank. All chemicals were used as received. Ultrapure water used in this experiment was distilled. 2.2. Preparation of DNA BS To prepare DNA BS, DNA strands Trigger, Primer 1, Primer 2, Linker 1 and Linker 2 were dissolved in PBS solution to a final concentration of 50 μM. Then, 8 μL of Trigger, Primer 1, Primer 2 were mixed with 20 μL of Linker 1 and Linker 2. The mixture was diluted to a final volume of 100 μL and undertook an annealing process from 95 °C (keeping for 3 min) to room temperature (25 °C) with a PCR-cycler (Eppendorf AG 22331 Hamburg) in 70 min. After that, the sample was kept at room temperature for 24 h to complete the process. The assembled products were used without further treatment. 2.3. Preparation of SYBR Green I and DOX loaded DNA BS To prepare the dye-loaded DNA BS, 1 μL SYBR Green I was diluted in 100 μL PBS solution. Then, 10 μL diluted dye solution was mixed with 100 μL of DNA BS products for 5 min and ultra-filtrated to remove Scheme 1. Schematic illustration of the selfassembling process and the targeted molecule delivery of the DNA BS. In a one pot process, the two aptamer-tethered ssDNAs and the trigger ssDNA pair with each other, forming a bean sprout-shaped DNA with two cotyledons consisted of two aptamers which could selectively target MCF-7 cells and a hypocotyl which could allow the intercalation of fluorescent dyes and drug molecules.
2
Colloids and Surfaces A 585 (2020) 124182
S. Sun, et al.
Table 1 Sequences of DNA probes. Probes
Sequences (5′-3′)
Trigger Primer 1 Primer 2 Linker 1 Linker 2 FITC-Linker 1
CGTCGTGCAGCAGCAGCAGCAGCATTTTTTGGATCCGCATGACATTCGCCGTAAG GGTGGTGGTGGTTGTGGTGGTGGTGGTTTTTTCTTACGGCGAATGACCGAATCAGCCT GGTGGTGGTGGTTGTGGTGGTGGTGGTTTTTTAGGCTGATTCGGTTCATGCGGATCCA CGTCGTGCAGCAGCAGCAGCAGCAACGGCTTGCTGCTGCTGCTGCTGC TGCTGCTGCTGCTGCTGCACGACGGCAGCAGCAGCAGCAGCAAGCCGT FITC-CGTCGTGCAGCAGCAGCAGCAGCAACGG CTTGCTGCTGCTGCTGCTGC FITC-CGTCGTGCAGCAGCAGCAGCAGCAACGG CTTGCTGCTGCTGCTGCTGC
FITC-Linker 2
the dissociative dye molecules. Similarly, a certain amount of DOX was mixed with DNA BS products and stored at room temperature for 2 h.
2.10. Cell viability assay MTT assay was used to determine the in vitro cytotoxicity. Briefly, MCF-7 cells seeded in 96 well plates were incubated with different concentrations of samples in culture medium for 48 h. Subsequently, culture medium was replaced by 100 μL fresh cell culture medium containing 10 μL (5 mg/mL in PBS) MTT solution and incubate for another 4 h. Finally, the medium was discarded and replaced by 150 μL DMSO per well to dissolve the formazan crystals. The 96 well plates was analyzed by Thermo Go Microplate Absorbance Reader at 490 nm. Cell viability (%) was calculated according to the following equation:
2.4. Agarose gel electrophoresis analysis 3% agarose gel was prepared with 30 mL 1 × TAE buffer and stained with 3 μL Gel Red. The electrophoresis was conducted under 90 V at room temperature and the image was taken by Kodak Gel Logic 112 imaging system. 2.5. Atomic force microscope (AFM) analysis
(At (Au
DNA BS was prepared according to the above-mentioned method and diluted 100 fold with TAE-Mg2+ (40 mM Tris AcOH, 2.0 mM Na2EDTA, 12.5 mM Ac2Mg, pH 8.5). Mica was cleaved by adhensive tapes first and the sample was pipetted onto the mica. After 5 min, the mica was washed 5 times by 100 μL purified water and dried by nitrogen gas. Finally, the sample was analyzed by the Atomic Force Microscope (Bruker Inc.).
Ac ) × 100% Ac )
where At, Au, Ac represent the absorbance of the treated wells, untreated wells and control wells (without cells) respectively. All tests in this part were repeated four times and the results were given as mean ± SEM.
2.6. Fluorescence characterization
3. Results and discussion
The fluorescent dye and DOX-loaded DNA BS was analyzed by fluorescence spectrometry (excitation wavelength: 510 nm) with a Horiba Fluoromax-4 fluorescence spectrometer.
3.1. Agarose gel electrophoresis and AFM analysis of the DNA BS Scheme1 illustrated the construction process of the DNA BS. Briefly, in a one-pot process, two primers and the trigger paired with each other to form the cotyledon-like structures whilst the trigger initiated an autonomous cross-opening of two repetitive hairpin monomers to produce a “hypocotyl-like structure”. The assembled products were evaluated by agarose gel electrophoresis and the results are shown in Fig. 1A. Lane 1 contains low molecular-weight DNA markers (from 25 bp to 500 bp). Lane 2 to Lane 6 contain Band II to Band V produced by the original DNA strands: Linker 1, Linker 2, Trigger, Primer 1 and Primer 2, respectively. The products assembled from two ssDNAs (Trigger + Primer 1) and three ssDNAs (Trigger + Primer 1 + Primer 2) produced band VI and band VII, respectively. Lane 9 contains the bands produced by DNA BS molecules. Band VI exhibited an obvious lower electrophoresis rate than that of Trigger or Primer 1, indicating that the assembly had higher molecular weight than single DNA strands. Similarly, Band VII had lower electrophoresis rate than Band VI, indicating the successful pairing of Trigger + Primer 1 and Trigger + Primer 1 + Primer 2. Furthermore, band in Lane 9 showed a continuously long tail, demonstrating the successful synthesis of long-chain DNAs with different molecular weights. The result of the AFM analysis of DNA BS is shown in Fig. 1B. Though the “cotyledon-like structure” couldn’t be seen clearly due to the low resolution, different lengths of the “hypocotyl-like structure” were observed and the mean length is 49 nm. The results of agarose gel electrophoresis and AFM analysis provide a preliminary presumption that the DNA BS was successfully made.
2.7. Cell culture High-glucose DMEM containing 10% of fetal bovine serum (FBS) was used for both MCF-7 cells and HFF cells. All cells were cultured in an atmosphere of 5% CO2 at 37 °C in standard cell incubator. 2.8. Flow cytometry analysis The washing buffer was prepared by dissolving glucose (4.5 g/L) and MgCl2 (5 mM) in PBS solution. Binding buffer was prepared by dissolving yeast tRNA (0.1 mg/mL) and BSA (1 mg/mL) in washing buffer. After culturing for 24 h, MCF-7 cells or HFF cells were digested with non-enzy cell detach solution and suspended in binding buffer or cell culture medium. Cells were incubated with FITC-labeled DNA samples at 4 °C for 30 min and washed with washing buffer. Finally, the samples were analyzed on a BD Biosciences Accuri C6 flow cytometry. 2.9. Laser confocal scanning microscopic analysis MCF-7 cells and HFF cells were cultured in 35 mm confocal dish for 24 h. Then, cells were incubated with the SYBR Green I-dyed DNA samples at 37 °C for 2 h. Cells were subsequently washed and dyed with Lyso Tracker Blue for 10 min. Finally, the dish was washed twice and immersed with 500 μL PBS solution. Fluorescent images were taken on an Olympus FV3000 Laser confocal scanning microscope with a 60× oil immersion lens. 3
Colloids and Surfaces A 585 (2020) 124182
S. Sun, et al.
Fig. 1. (A) Agarose gel electrophoresis analysis of DNA BS. Lane 1: low molecular weight DNA marker (from 25 bp to 500 bp). Lane 2 to lane 6: ssDNA (Linker 1, Linker 2, Trigger, Primer 1 and Primer 2). Lane 7: assembled products of Trigger, Primer 1. Lane 8: assembled products of Trigger, Primer 1, and Primer 2. Lane 9: the DNA BS products; (B) AFM image of the DNA BS.
Fig. 2. Flow cytometric analysis of the binding affinity and selectivity of the DNA BS with MCF-7 cells (A) and HFF cells (B) in binding buffer and with MCF-7 cells (C) and HFF cells (D) in serum contained cell culture medium.
4
Colloids and Surfaces A 585 (2020) 124182
S. Sun, et al.
respectively incubated with single-aptamer-tethered DNA nano-trunk (Single-Apt), random sequence-tethered DNA BS (Ram-DNA), mixed solution of Linker 1 and Linker 2 (L1 + L2), and the DNA BS [24] in binding buffer at 4 °C for 30 min, respectively. Results are shown in Fig. 2A. MCF-7 cells treated with both the Single-Apt and the DNA BS exhibited higher fluorescence intensity than the MCF-7 cells without treatment, suggesting that aptamer could help DNA assembly target MCF-7 cells. In addition, the fluorescence intensity of the cells treated with DNA BS was higher than that of the Single-Apt, indicating that the bi-valent DNA BS had higher binding ability than the monovalent nano-trunk. It is in consistency with the previous study that multiple ligands can significantly enhance the binding efficiency [25]. On the other hand, the fluorescence intensity of MCF-7 cells treated with Ram-DNA and L1 + L2 was similar to that of MCF-7 cells without treatment, proving that DNA assemblies without aptamers could not bind to the target cell. Moreover, the fact that cells treated with L1 + L2 showed no enhancement of the fluorescence intensity indicates that Linker 1 and Linker 2 alone could not target MCF7 cells. As shown in Fig. 2B, all the treated cells exhibited similar level of fluorescence intensity to the untreated cells, indicating that none of the DNA assemblies could bind to HFF cells. The results demonstrated DNA BS’ selective binding ability in binding buffer. To further investigate the selective performance of DNA BS, complete cell culture medium containing 10% FBS was used to mimic a more physiological environment [22]. Similarly, the Single-Apt, the Ram-DNA, the L1 + L2, and the DNA BS were first dissolved in cell culture medium. Next, both MCF-7 cells and HFF cells were incubated with the particles at 37 °C for 30 min. Results are shown in Fig. 2C and D. While both the monovalent nano-trunk and the bi-valent DNA BS showed specific binding ability to MCF-7 cells but not to HFF cells, DNA BS nevertheless exhibited higher binding ability than the monovalent
Fig. 3. Fluorescent intensity characterization of free SYBR Green I (red curve and inserted image of the fluorescent curve) and SYBR Green I-loaded DNA BS (green curve). Inserted images: digital photos of the free dye solution and the dye-loaded DNA BS solution under UV light (For interpretation of the references to colour in the figure legend, the reader is referred to the web version of this article).
3.2. Flow cytometry analysis of the DNA BS in binding buffer Flow cytometry analysis was employed to reconnoiter the binding ability and selective recognition of the DNA BS. To visualize the DNA BS, Linker 1 and Linker 2 were labeled with FITC while other sequences were not. Michigan Cancer Foundation-7 (MCF-7) cells (target cells) and Human Foreskin Fibroblast (HFF) cells (control cells) were
Fig. 4. Time-dependent cellular internalization of the DNA BS incubated with MCF-7 cells. Scale bar: 40 μm. 5
Colloids and Surfaces A 585 (2020) 124182
S. Sun, et al.
Fig. 5. LCSM images of cellular internalization of the DNA BS in different cells and Single aptamer-tethered DNA nano-trunk in MCF-7 cells. Scale bar: 40 μm.
Fig. 6. (A) Cytotoxicity of different concentrations of dye-DNA BS and (B) magnified fluorescent image of dye-DNA BS-treated MCF-7 cells. Scale bar: 40 μm.
nano-trunk. Altogether, the results demonstrated that DNA BS could selectively bind to target cells in the physiological environment.
3.4. Time-dependent cellular internalization of the DNA BS Cellular internalization is a vital step to achieve the target living cell imaging and drug delivery. In this study, laser confocal scanning microscopy (LCSM) was used to study the cellular internalization of the DNA BS. Lysosomes were stained with Lyso Tracker Blue to recover the location of the DNA BS [22]. First, we studied the time-dependent cellular internalization of the DNA BS into MCF-7 cells. MCF-7 cells were incubated with SYBR Green I-loaded DNA assemblies for 15 min, 45 min and 120 min, respectively. Results are shown in Fig. 4. It is found that the fluorescence intensity of MCF-7 cells incubated with DNA BS increased with culture time, indicating that the amount of DNA assemblies internalized by MCF-7 cells increased gradually [22,26]. Furthermore, the green fluorescence of SYBR Green I overlapped with
3.3. Fluorescence property of SYBR Green I-dyed DNA BS Results of the fluorescent intensities of free SYBR Green I and SYBR Green I-loaded DNA BS are shown in Fig. 3. Both the fluorescence spectrums and UV light images revealed that SYBR Green I-loaded DNA BS had much higher fluorescence intensity than the free SYBR Green I. This fluorescence property makes DNA BS more suitable for the living cell imaging.
6
Colloids and Surfaces A 585 (2020) 124182
S. Sun, et al.
Fig. 7. (A) DOX loading capacity of the DNA BS tested by fluorescence spectrophotometer and (B) selective cytotoxicity of the drug loaded DNA BS measured by MTT (Mean ± SEM).
the blue fluorescence of Lyso Tracker Blue, implying that DNA BS mainly located at lysosomes after internalization [27].
Apt were loaded with 5 μM DOX (DNA BS-DOX and Single-Apt-DOX). The concentration of the DOX used here was based on previous works [7,22]. MCF-7 cells and HFF cells were respectively incubated with DNA BS-DOX, Single-Apt-DOX, free DOX and 1 μM DNA BS. MTT assay was used to examine the cell viability. Results are shown in Fig. 7B. It is found that free DOX had high cytotoxicity to both MCF-7 cells and HFF cells, whereas DNA BS-DOX only had high cytotoxicity to MCF-7 cells but not to HFF cells, demonstrating a selective cytotoxicity of DNA BSDOX. Moreover, DNA BS-DOX exhibited higher cytotoxicity to MCF-7 cells than the Single-Apt-DOX, indicating that bi-valency is better than monovalency. On the contrary, DNA BS without drugs showed extremely low cytotoxicity to both MCF-7 cells and HFF cells, further demonstrating its good biocompatibility. These results suggest that DNA BS is suitable for targeted drug delivery.
3.5. Selective cellular internalization of the DNA BS To investigate the selective cellular internalization, the target MCF7 cells were incubated with DNA BS and Single-Apt respectively. HFF cells were used as control. Results shown in Fig. 5 exhibit that the blue fluorescence of Lyso Tracker blue was overlapped with the green fluorescence of the DNA BS, suggesting that DNA BS were in the lysosomes after being internalized by MCF-7 cells. On the other hand, HFF cells treated with DNA BS showed low fluorescence intensity, indicating that HFF cells could not efficiently internalize the DNA BS. These results further demonstrated the selective cellular internalization of DNA BS into the target MCF-7 cells. In addition, MCF-7 cells treated with the DNA BS exhibited much higher fluorescence intensity than that with Single-Apt, implying that the bi-valent DNA BS had higher target ability than the monovalent DNA assembly.
4. Conclusion In summary, a novel biocompatible bean sprout-inspired DNA BS was developed for live cell imaging and targeted drug delivery. The DNA BS was fabricated through a facile one-pot process and tethered with two aptamers which could target MCF-7 cells. It is demonstrated that DNA BS had stronger binding affinity, enhanced cellular uptake, and more selective cytotoxicity to the target MCF-7 cells than the monovalent DNA assemblies. We believe that this study provides a new way to design bioinspired drug carriers for live cell imaging and targeted drug delivery.
3.6. Cytotoxicity of the SYBR Green I-labeled DNA BS To evaluate the biocompatibility and potential application of the SYBR Green I-loaded DNA BS (dye-DNA BS), the viability of MCF-7 cells treated with dye-DNA BS were investigated using MTT assay analysis. To start with, cells were incubated with different concentrations of the dye-DNA BS for 48 h. And the data were collected by a microplate reader. Results in Fig. 6A show that the viability value of all the MCF-7 cells treated was above 95% even when the concentration reaches 1000 nM. It can be concluded that the dye-DNA BS has good biocompatibility and suitable for live cell imaging.
Declaration of competing interest There are no conflicts to declare.
3.7. DOX loading capacity of the DNA BS
Acknowledgements
Previous studies have shown that when DOX molecules intercalate into C–G pairs of the DNA double strands, their fluorescence would quench [17,28]. Therefore, we can determine the DOX loading capacity of DNA BS by examining the change of the fluorescence intensity. To begin with, 2 μM DOX was added into different concentrations of DNA BS solutions. Then a fluorescence spectrophotometer was used to measure the drug loading capacity of the DNA BS. The results are shown in Fig. 7A. It can be seen that with the concentration of DNA BS increasing, the fluorescence intensity decreased. When the concentration of DNA BS reached 80 nM, the fluorescence intensity decreased to an extremely low level, indicating 80 nM DNA BS is enough to load 2 μM DOX. Therefore, the estimated DOX loading level of DNA BS is about 1:25.
This work was supported by the Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD), and the Fundamental Research Funds for the Central Universities with grant number 2242016K41020. References [1] W. Wang, H. Guo, L. Zeng, J. Zhou, L. Zhao, G. Zhang, C. Wang, B. Xu, Self-assembly of two ferrocence-and α-cyclodextrin-derived unconventional amphiphiles with redox responsiveness, Colloids Surf. A 558 (2018) 117–122. [2] E. Mei, S. Li, J. Song, R. Xing, Z. Li, X. Yan, Self-assembling collagen/alginate hybrid hydrogels for combinatorial photothermal and immuno tumor therapy, Colloids Surf. A 577 (September 20) (2019) 570–575. [3] J. Shen, Y. Wang, P. Fan, L. Jiang, W. Zhuang, Y. Han, H. Zhang, Self-assembled vesicles formed by C18 unsaturated fatty acids and sodium dodecyl sulfate as a drug delivery system, Colloids Surf. A 568 (2019) 66–74. [4] Y. He, T. Ye, M. Su, C. Zhang, A.E. Ribbe, W. Jiang, C. Mao, Hierarchical selfassembly of DNA into symmetric supramolecular polyhedra, Nature 452 (2008) 198–201.
3.8. Cell viability of the DOX-loaded DNA BS To examine the selective cytotoxicity, both DNA BS and the Single7
Colloids and Surfaces A 585 (2020) 124182
S. Sun, et al. [5] P.W. Rothemund, Folding DNA to create nanoscale shapes and patterns, Nature 440 (2006) 297–302. [6] Y. Dong, Y.R. Yang, Y. Zhang, D. Wang, X. Wei, S. Banerjee, Y. Liu, Z. Yang, H. Yan, D. Liu, Cuboid vesicles formed by frame-guided assembly on DNA origami scaffolds, Angew. Chem. Int. Ed. 56 (2017) 1586–1589. [7] M. Chang, C.-S. Yang, D.-M. Huang, Aptamer-conjugated DNA icosahedral nanoparticles as a carrier of doxorubicin for cancer therapy, Acs Nano 5 (2011) 6156–6163. [8] J. Li, M. Xu, H. Huang, J. Zhou, E. Abdel-Halimb, J.R. Zhang, J.J. Zhu, Aptamerquantum dots conjugates-based ultrasensitive competitive electrochemical cytosensor for the detection of tumor cell, Talanta 85 (2011) 2113–2120. [9] L. Qiu, T. Chen, I. Oçsoy, E. Yasun, C. Wu, G. Zhu, M. You, D. Han, J. Jiang, R. Yu, A cell-targeted, size-photocontrollable, nuclear-uptake nanodrug delivery system for drug-resistant cancer therapy, Nano Lett. 15 (2014) 457–463. [10] K. Liu, H. Li, G.R. Williams, J. Wu, L.M. Zhu, pH-responsive liposomes self-assembled from electrosprayed microparticles, and their drug release properties, Colloids Surf. A 537 (2018) 20–27. [11] H. Sun, S. Li, W. Qi, R. Xing, Q. Zou, X. Yan, Stimuli-responsive nanoparticles based on co-assembly of naturally-occurring biomacromolecules for in vitro photodynamic therapy, Colloids Surf. A 538 (2018) 795–801. [12] J. Yang, L. Yun, G. Zhao, F. Zhang, Y. Chen, C. Wang, Fabrication of pH-responsive system based on cationic gemini surfactant/sodium octanedioate and its application on controlled release of paclitaxel, Colloids Surf. A 539 (2018) 101–108. [13] K. Sefah, D. Shangguan, X. Xiong, M.B. O’Donoghue, W. Tan, Development of DNA aptamers using cell-SELEX, Nat. Protoc. 5 (2010) 1169–1185. [14] D. Kim, Y.Y. Jeong, S. Jon, A drug-loaded aptamer-gold nanoparticle bioconjugate for combined CT imaging and therapy of prostate cancer, ACS Nano 4 (2010) 3689–3696. [15] W. Li, L. Luo, J. Huang, Q. Wang, J. Liu, X. Xiao, H. Fang, X. Yang, K. Wang, Selfassembled DNA nanocentipedes as multivalent vehicles for enhanced delivery of CpG oligonucleotides, Chem. Commun. 53 (2017) 5565–5568. [16] J.K. Herr, J.E. Smith, C.D. Medley, D. Shangguan, W. Tan, Aptamer-conjugated nanoparticles for selective collection and detection of cancer cells, Anal. Chem. 78 (2006) 2918–2924.
[17] G. Zhu, J. Zheng, E. Song, M. Donovan, K. Zhang, C. Liu, W. Tan, Self-assembled, aptamer-tethered DNA nanotrains for targeted transport of molecular drugs in cancer theranostics, Proc. Natl. Acad. Sci. 110 (2013) 7998–8003. [18] J.H. Myung, K.A. Gajjar, J. Saric, D.T. Eddington, S. Hong, Dendrimer-mediated multivalent binding for the enhanced capture of tumor cells, Angew. Chem. Int. Ed. 123 (2011) 11973–11976. [19] K. Ulbrich, K.I. Holá, V. Subr, A. Bakandritsos, J. Tucek, R. Zboril, Targeted drug delivery with polymers and magnetic nanoparticles: covalent and noncovalent approaches, release control, and clinical studies, Chem. Rev. 116 (2016) 5338–5431. [20] R.C. Huang, W.J. Chiu, L.I. Pojung, C.C. Huang, Multivalent aptamer/gold nanoparticle-modified graphene oxide for mass spectrometry-based tumor tissue imaging, Sci. Rep. 5 (2015) 10292. [21] J. Kim, E. Lee, Y.Y. Kang, H. Mok, Multivalent aptamer-RNA based fluorescent probes for carrier-free detection of cellular microRNA-34a in mucin1-expressing cancer cells, Chem. Commun. 51 (2015) 9038–9041. [22] W. Li, X. Yang, L. He, K. Wang, Q. Wang, J. Huang, J. Liu, B. Wu, C. Xu, Selfassembled DNA nanocentipede as multivalent drug carrier for targeted delivery, ACS Appl. Mater. Interfaces 8 (2016) 25733–25740. [23] D. Evanko, Hybridization chain reaction, Nat. Methods 1 (2004) 186–187. [24] H. Motaghi, M.A. Mehrgardi, P. Bouvet, Carbon dots-AS1411 aptamer nanoconjugate for ultrasensitive spectrofluorometric detection of cancer cells, Sci. Rep. 7 (2017) 10513. [25] C. Fasting, C.A. Schalley, M. Weber, O. Seitz, S. Hecht, B. Koksch, J. Dernedde, C. Graf, E.W. Knapp, R. Haag, Multivalency as a chemical organization and action principle, Angew. Chem. Int. Ed. 51 (2012) 10472–10498. [26] S. Yu, R. Dong, J. Chen, F. Chen, W. Jiang, Y. Zhou, X. Zhu, D. Yan, Synthesis and self-assembly of amphiphilic aptamer-functionalized hyperbranched multiarm copolymers for targeted cancer imaging, Biomacromolecules 15 (2014) 1828–1836. [27] L. He, X. Yang, F. Zhao, K. Wang, Q. Wang, J. Liu, J. Huang, W. Li, M. Yang, Selfassembled supramolecular nanoprobes for ratiometric fluorescence measurement of intracellular pH values, Anal. Chem. 87 (2015) 2459–2465. [28] Z.-M. Zhang, P.-C. Gao, Z.-F. Wang, B.-W. Sun, Y. Jiang, DNA-caged gold nanoparticles for controlled release of doxorubicin triggered by a DNA enzyme and pH, Chem. Commun. 51 (2015) 12996–12999.
8