Biological control of tobacco bacterial wilt using Trichoderma harzianum amended bioorganic fertilizer and the arbuscular mycorrhizal fungi Glomus mosseae

Biological Control 92 (2016) 164–171

Contents lists available at ScienceDirect

Biological Control journal homepage: www.elsevier.com/locate/ybcon

Biological control of tobacco bacterial wilt using Trichoderma harzianum amended bioorganic fertilizer and the arbuscular mycorrhizal fungi Glomus mosseae Saifei Yuan a, Meiyun Li a, Zhiying Fang a, Yan Liu a, Wen Shi a, Bing Pan a, Kai Wu c, Junxiong Shi b, Biao Shen a,⇑, Qirong Shen a a

Jiangsu Key Laboratory for Organic Solid Waste Utilization, Nanjing Agricultural University, Nanjing 210095, China Institute of Tobacco Science Research, Guiyang 550081, China c Solar Energy Research Institute of Yunnan Normal University, Yunnan 650500, China b

h i g h l i g h t s
The application of either BOF or Gm effectively decreased the disease incidence.
Integrated application of Gm + BOF achieved 68.2% control efficacy in pot experiments.
Application of BOF and Gm alone or in combination suppressed RS population in soil.
The integrated treatment Gm + BOF changed the diversity of microbial community in soil.
Application of BOF and Gm alone or in combination (Gm + BOF) increased tobacco growth.

a r t i c l e

i n f o

Article history: Received 28 March 2015 Revised 21 October 2015 Accepted 26 October 2015 Available online 11 November 2015 Keywords: Biological control Ralstonia solanacearum Bioorganic fertilizer Trichoderma harzianum Glomus mosseae

a b s t r a c t Tobacco bacterial wilt (TBW) caused by Ralstonia solanacearum (RS) is one of the most serious tobacco diseases worldwide and no effective control measures are available to date. This study investigated the potential of Trichoderma harzianum SQR-T037 amended bioorganic fertilizer (BOF) and the arbuscular mycorrhizal fungi (AMF) Glomus mosseae 171 (Gm) on the control of TBW and promotion of plant growth in pot experiments. The results showed that the disease incidence in plants treated with integrated application of G. mosseae 171 and T. harzianum SQR-T037 amended bioorganic fertilizer (Gm + BOF) was the lowest, with a control efficacy of 68.2%, which is greater than that of BOF or Gm alone (26.8% and 14.7%, respectively). The application of BOF or Gm alone significantly reduced the abundance of RS in rhizosphere soil, but the integrated treatment (Gm + BOF) showed the strongest inhibitory effect (with a 21.3% increase in inhibition). The root colonization of G. mosseae 171 in samples treated with Gm + BOF was higher than that in samples with solely Gm treatment, indicating that the BOF significantly promoted G. mosseae mycorrhizal colonization. The results showed that the G. mosseae also had a positive effect on SQR-T037 rhizospheric colonization. Denaturing gradient gel electrophoresis (DGGE) results showed that application of BOF and Gm alone or in combination changed the diversity of the rhizospheric microbial community. The integrated application of Gm + BOF to tobacco plants significantly increases the activity of polyphenol oxidase (PPO), phenylalanine ammonia lyase (PAL), and peroxidase (POD), enzymes associated to systemic resistance. Additionally, the integrated application of Gm with BOF increased the tobacco plant height, shoot dry weight, and root dry weight. In conclusion, a synergistic biological approach integrating application of Gm and BOF for TBW protection seems promising. Ó 2015 Published by Elsevier Inc.

1. Introduction The tobacco bacterial wilt (TBW) is a systemic vascular disease caused by Ralstonia solanacearum (RS) (Yabuuchi et al., 1995), a ⇑ Corresponding author. E-mail address: [email protected] (B. Shen). http://dx.doi.org/10.1016/j.biocontrol.2015.10.013 1049-9644/Ó 2015 Published by Elsevier Inc.

soil-borne bacterial pathogen notorious for its lethality, persistence, complex subspecies, and broad geographic distribution (Elphinstone, 2005). Integration of soil fumigation, resistant cultivars, and short rotation has been suggested as a control strategy for TBW (Schonfeld et al., 2003). However, traditional control methods do not always an effective, since RS can persist for a long time in soil in association with infested plant debris. Thus, the

S. Yuan et al. / Biological Control 92 (2016) 164–171

effectiveness of management practices is limited, once the disease was occurred (Liu et al., 2012). Chemical control using bactericides has proven ineffective, and is also harmful to the environment (Gamliel et al., 2000; Yi et al., 2007). Furthermore, diseaseresistant tobacco cultivars often yield low-quality tobacco (Peng et al., 2007). Thus, biological control might be an option for the management of this disease. The use of beneficial microorganism has been considered as a promising strategy for management of soil diseases (Chen et al., 2011; Lang et al., 2012; Liu et al., 2012). The potential of Trichoderma harzianum for biocontrol of several soil-borne diseases has been demonstrated by previous research (Chen et al., 2011; Elad and Stewart, 2004). Some studies have shown that Trichoderma species, Bacillus species, and Klebsiella species could better colonize plant roots and rhizosphere if they are applied to the soil with a nutrient carrier, such as a decomposed organic fertilizer, a chicken manure (Hao et al., 2009; Yang et al., 2011). The nutrient carrier provides nutrients to the microbes, thus increasing the agent’s viability and making them more competitive in the bulk and rhizosphere soil and on plant roots (Liu et al., 2012). The application of bioorganic fertilizer to control soil-borne disease of such cash crops as banana (Zhang et al., 2011), watermelon (Ling et al., 2010), cucumber (Chen et al., 2011), tomato (Wei et al., 2011), cotton (Lang et al., 2012) and tobacco (Liu et al., 2012) is becoming more and more popular in China. However, no information concerning the biocontrol of TBW by application of Trichoderma amended bioorganic fertilizer is available. Arbuscular mycorrhizal fungi (AMF) have also been applied as biological control agents of plant pathogens. AMF symbiosis is known to control soil-borne disease (Azcón-Aguilar et al., 2002; Pozo et al., 2002) and has a well-established role in soil fertility and improvement of plant nutritional status (Jeffries and Barea, 2001; Jeffries et al., 2003) through several mechanisms, including increased availability of plant nutrients and increased uptake of typically immobile nutrients (Smith and Read, 2008). Variations in incidence and effect of root colonization depend on the plant species and the mycorrhizal fungus involved in symbiosis (Jeffries and Barea, 2001), and are also influenced by soil microorganisms and environmental factors (Azcón-Aguilar et al., 2002; Bowen and Rovira, 1999). Combining AMF and Trichoderma spp. has been shown to increase not only plant growth but also the control efficacy of plant pathogens (Saldajeno et al., 2008; Martínez-Medina et al., 2009) such as Fusarium oxysporum (Srivastava et al., 2010). Nevertheless, the reports on the interactions between soil saprophytes and AMF differ widely, even when the same species of saprophytic fungi are involved. For example, T. harzianum has been found to have antagonistic, neutral, and stimulating effects on AMF (Green et al., 1999; Martínez-Medina et al., 2009). The main objectives of this study were to evaluate the potential of the AMF Glomus mosseae and a T. harzianum SQR-T037-amended bioorganic fertilizer, alone or in combination, to suppress RS and their effects on the microbial structure of the rhizosphere soil and on plant growth.

165

which were sown in plastic pots (18 cm diameter) containing twice-sterilized sandy loam soil. The soil obtained from local farm fields having pH 7.3, 28.4 g kg1 of organic matter, 133.0 mg kg1 of available nitrogen, 25.0 mg kg1 of available P, 221.7 mg kg1 of available K. The plants were grown in a greenhouse (20–25 °C) with a transparent plastic roof and open sides. Water was applied at the bottom of pots until about 4 weeks after planting in order to prevent leaking of G. mosseae spores while watering. Afterwards the plants were surface watered. No fertilizer or chemicals was applied to the soil. Ninety days after planting trifolium in the pot culture, the plants were cut above the soil surface and the soil was crushed by hand. A sucrose centrifugation method (Daniels and Skipper, 1982) was used for evaluation of total number of AMF spores and identification of G. mosseae. After quantification of AMF, the sandy loam soil containing spores of G. mosseae was ready to used as a potting medium inoculum. Tobacco (Nicotiana tabacum L.) seeds (Yunyan 85) were provided by Guizhou Tobacco Science Institute, Guizhou Province, China. The seeds were germinated in a mixed nursery medium composed of perlite, vermiculite, and turf at a ratio of 3:3:4. If the nursery medium was inoculated with 2% (w/w) of AMF inoculum, the tobacco seedlings infected with AMF were referred to as mycorrhizal seedlings. The seedlings without inoculated AMF were referred to as non-mycorrhizal seedlings. All tobacco seedlings were grown in floating polystyrene trays in a greenhouse for approximately 60 days prior to use. 2.2. Preparation of bioorganic fertilizer (BOF) The T. harzianum strain SQR-T037 was obtained from Jiangsu Key Laboratory for Organic Solid Waste Utilization, Nanjing Agriculture University, Nanjing, China. The isolate was cultured on potato dextrose agar (PDA) in an incubator at 28 °C. The organic fertilizer consisted of an amino acid fertilizer and a cattle manure compost in a ratio of 1:1 (w/w). The amino acid fertilizer was made from rapeseed cakes that had undergone aerobic microbial fermentation at <50 °C for 7 days. This amino acid fertilizer contained 44.2% organic matter, 12.9% total amino acids and small molecular peptides, 4.4% N, 3.5% P2O5, and 0.7% K2O. The cattle manure compost was produced by Lianye Ltd. Company (Jiangyin, Jiangsu Province, China) by composting cattle manure for 25 days. This compost contained 35.0% organic matter, 2.5% N, 2.4% P2O5, 1.1% K2O, and 22.3% water. The organic fertilizer enriched with T. harzianum SQR-T037 was named bioorganic fertilizer (BOF). The preparation of BOF followed the procedure described by Yang et al. (2011). Briefly, 1 L suspension of SQR-T037 containing 6.3  107 conidia per milliliter was incorporated into 10 kg organic fertilizer to give a final colony-forming-unit (cfu) level of 106 conidia per gram of BOF. The mixture was maintained at 50–55% humidity at room temperature (20–30 °C) for 5 days and manually stirred every day. Prior to the application, SQR-T037 was quantified in the bioorganic fertilizer by serial dilution on T. harzianum selective medium (Chen et al., 2011). The concentration of SQR-T037 was determined to be 8.1  106 cfu g1 dry weight (DW) of bioorganic fertilizer. 2.3. Experimental design

2. Materials and methods 2.1. Preparation of AMF and tobacco mycorrhizal seedling AMF (G. mosseae 171)-infested soil (10 spores g1 soil) was obtained from Guizhou Tobacco Science Institute, Guizhou Province, China. The AMF spores were multiplied by a pot culture technique using trifolium (Trifolium repens L.) as a host plant (Yao et al., 2013). AMF spores were inoculated on surfacesterilized trifolium seeds (1% sodium hypochlorite for 20 min)

Pot experiments were conducted to examine the efficacy of G. mosseae 171 integrated with BOF on the control of TBW and promotion of growth in tobacco plants. The soil for the TBW control pot experiments was obtained from a tobacco field that had been continuously mono-cultivated for over 20 years at Fuquan City in the Guizhou Province of China. The incidence of TBW reached approximately 90% in 2010. Some properties of the soil were pH 6.5, 12.04 g kg1 of organic C, 170 g kg1 of total N, 0.21 g kg1 of available K and 53.44 mg kg1 of available P. The soil for the

166

S. Yuan et al. / Biological Control 92 (2016) 164–171

growth promotion pot experiments was healthy paddy soil with the following properties: pH 6.8, 28.5 g kg1 of organic matter, 41.4 g kg1 of total N, 0.19 g kg1 of available K and 8.1 mg kg1 of available P. In experiments for both TBW control and growth promotion, the following treatments were designed: non-mycorrhizal seedlings treated with chemical fertilizer (Control); non-mycorrhizal seedlings treated with bioorganic fertilizer (BOF); mycorrhizal seedlings treated with chemical fertilizer (Gm); and the integrated treatment, mycorrhizal seedlings treated with bioorganic fertilizer (Gm + BOF). The tobacco seedlings were transplanted into plastic pots (5 kg soil per pot). For the BOF treatment, 50 g of bioorganic fertilizer was thoroughly mixed with 500 g soil that was evenly scattered around the seedling roots. In Control and Gm studies, the soil was treated with a chemical fertilizer containing nutrients (NPK) equivalent to that of the bioorganic fertilizer treatment. Every treatment was repeated in 30 pots containing one seedling each. Pots of each treatment were arranged in three 10-pot blocks, which were laid out randomly. The experiments were set up in a greenhouse (16 h light, 20/30 °C night/day temperature and 80% humidity) in Guizhou Tobacco Science Institute, China. 2.4. Sampling and analytical methods 2.4.1. Determination of tobacco agronomic traits Sixty days after seedling, before transplanting, seedlings’ leaves and roots dry weight were determined in 15 plants of each seedling treatment. In the plant growth promotion pot experiments, the plant height, leaves and roots dry weight were measured at the 5th week after transplanting. Once served, leaves from different parts of plants were dried in an oven at 105 °C for 30 min and then incubated at 70 °C for 2 days until they maintained a constant weight. The dry weight values of all leaves from the same shoot were summed up. Roots were harvested and dried in the same way as leaves. 2.4.2. Soil sampling Rhizosphere soil samples were taken at the 5th and the 8th week after transplanting. Rhizosphere soils from three tobacco plants were collected as described by Luo et al. (2004). The roots were shaken vigorously to separate soil not tightly adhering to the roots. Then, the soil still tightly adhering to the roots of each replicated plant was removed by gently brushing and individually collected as rhizosphere soil. The soil total DNA was extracted from 1 g of each sample using the PowerSoil DNA Isolation Kit (MOBIO Laboratories, Carlsbad, CA) according to the manufacturer’s instructions; DNA amounts were determined with a spectrophotometer (NanoDrop, ND2000, Thermo Scientific, Wilmington, DE). 2.4.3. Observation of disease incidence and severity Observations for disease incidence and severity were made every day after transplanting. Since TBW mostly showed its symptom only at the late growth stage (data not shown), the disease incidence was determined as the percentage of tobacco plants with wilting symptoms before harvesting. The disease severity (expressed as the disease index (di)) was scored according to wilt symptoms and the wilt incidence in each treatment (Tobacco, 1996) as follows: 0 = no visible disease symptoms, 1 = a few flecks or small lesions on the stem and a little wilting, 2 = moderate black lesions showed up on the stem but not on the top and more than 50% of leaves wilting on the lesion side, 3 = large lesions extending up to the top of stem and more than two thirds of leaves wilting on the lesion side, and 4 = death of plants. Disease incidence index (DI) was calculated as P [ (number of diseased plants in this index  di)/(total number of plants investigated  highest di)]100%. The control efficacy was calculated as [(CKDI  TDI)/CKDI]  100%, where CKDI is the disease

incidence of the control treatment and TDI is the disease incidence of the treatments. 2.4.4. The G. mosseae colonization After agronomic traits and disease observation at 5th and 8th week, plants were totally uprooted and root systems were thoroughly washed with running tap water to remove adhering soil. To observe the root colonization by G. mosseae 171, root samples were cut into approximately 1 cm sections, cleared in 10% KOH (w/v) at 90 °C for 1 h and stained with 0.05% w/v chlorazol black E in a lacto glycerol solution at 90 °C for 1.5 h (Brundrett et al., 1984). The percentage of root length colonized by hyphae, arbuscules, or vesicles of G. mosseae was assessed according to the method of McGonigle et al. (1990). 2.4.5. Determination of the R. solanacearum (RS) population The abundance of RS in the rhizosphere soils was determined by real-time PCR using the primers, flic_F: GAACGCCAACGGTGCGAACT, and flic_R: GGCGGCCTTCAGGGAGGTC (Schonfeld et al., 2003). The real-time PCR amplifications were conducted in a 7500 Fast Real-Time PCR System (Applied Biosystems) using the SYBRÒ Premix Ex TaqTM (Perfect Real Time) kit (Takara). Plasmid standards for the quantification were generated from a cloned target flic gene, and the standard curves were generated according to a previous report (Lang et al., 2012). The abundance of RS was expressed as 16 S rRNA gene copy numbers as described previously (Whelan et al., 2003). 2.4.6. Rhizosphere colonization of SQR-T037 The measure of T. harzianum SQR-T037 in the rhizosphere soil was quantified by real-time PCR. The primer pair designed by Lopez-Mondejar et al. (2010) was used to amplify a 209-bp fragment from the ITS region, and the probe used here was following the procedure of Chen et al. (2011). The standard curve of T. harzianum was generated according to Huang et al. (2011). The results of quantification were analyzed with the 7500 system SDS Software version 1.4 (Applied Biosystems). 2.4.7. Analysis of the rhizosphere soil microbial diversity The microbial diversity of the rhizosphere soil at the 8th week in different treatments was detected by denaturing gradient gel electrophoresis (DGGE) (Green et al., 2010). Total soil DNA was extracted by a Soil DNA Kit (MOBIO Laboratories, Carlsbad, CA). Two sets of primers were used for PCR amplifying bacterial and fungal DNA fragments from rhizosphere soil. The primer sequences for bacteria were 518 (R): 50 -AGAGTTTGATCCTGGCTCAG-30 and 338 (F) with a GC clamp: 50 -CGCCCGGGGCGCGCCCCGGGCGGGGC GGGGGCACGGACTCCTACGGGAGGCAGCAG-30 . The primer sequ ences for fungi were NS1 (F): 50 -GTAGTCATATGCTTGTCTC-30 and Fungi (R) with a GC clamp: 50 -CGCCCGGGGCGCGCCCCGGGCGGG GCGGGGGCACCCGAICCATTCAATCGGTAIT-30 (Chen et al., 2011). PCR was performed in a 25-ll reaction mixture containing 2.5 ll of 10 Ex Taq buffer (TaKaRa, Japan), 2 ll of 25 mM MgCl2, 2 ll of 2.5 mM dNTP mixture, 0.3 ll of Ex Taq polymerase (5 U/ll, TaKaRa), 1 ll of primers, 1 ll of DNA template, and 15.2 ll of double-distilled water. The procedure for amplifying bacterial DNA consisted of 1 cycle of pre-denaturation for 7 min at 94 °C, 35 cycles of denaturation for 30 s at 94 °C, annealing for 30 s at 63 °C, and extension for 30 s at 72 °C; amplicons were stored at 4 °C. The fungal DNA was amplified in a BioRad PCR system with 1 cycle of pre-denaturation for 5 min at 95 °C, 30 cycles of 95 °C for 30 s, 58 °C for 30 s, and 72 °C for 1 min. DGGE was performed using 8% of polyacrylamide gel in BioRad DGGE system. The denaturing gradient was 40–60% for bacterial DNA and 25–40% for fungi DNA. The electrophoresis was initiated by pre-running at a voltage of 200 V for 10 min and then it was carried out at a fixed voltage of

167

S. Yuan et al. / Biological Control 92 (2016) 164–171

8 V for 16 h. The gel was stained with AgNO3 and developed after completion of electrophoresis. DGGE images for band detection and integrated band area intensities were analyzed with Quantity One computer software (version 4.6.3, Bio-Rad). The relative intensity of a specific band was expressed as the ratio between that band and the total intensity of all bands in that lane. The Shannon’s P diversity index (H) was calculated using the formula H =  Piln P (Pi) =  (ni/N)ln (ni/N), where Pi was the proportional number in a specific group relative to the total number; ni was the intensity of a band and N was the sum of all band intensities in the densitometry profile (Luo et al., 2004). 2.4.8. Defense enzyme activity measurements The leaves of tobacco plants were sampled at the end of the experiment (8th week). The leaves (0.5 g) were weighed and homogenized in 4.5 ml phosphate buffer solution with pestle in a pre-chilled mortar treated with liquid nitrogen. The homogenates were centrifuged at 3000 rpm at 4 °C for 10 min. The supernatants were used for the enzyme activity assay. Activity of polyphenol oxidase (PPO, EC 1.14.18.1), phenylalanine ammonia lyase (PAL, EC 4.3.1.5) and peroxidase (POD, EC 1.11.1.7) were measured as described by Teisson et al. (1979), Whetten and Sederoff (1992) and Murage and Masuda (1997), respectively. 2.5. Data analyses The data were calculated and analyzed using Microsoft ExcelTM and SPSS, version 15.0 (SPSS Inc., Chicago, IL, USA). The statistical significance of results was determined by performing Fisher’s protected least significant difference (LSD) test (P 6 0.05). 3. Results 3.1. Growth promotion effects of G. mosseae and bioorganic fertilizer on tobacco plants The effects of inoculating G. mosseae 171 on tobacco seedling growth are shown in Table 1. The results showed that the leaves and roots dry weight of mycorrhizal seedlings significantly increased after 60 days of growth in nursery compared to that of non-mycorrhizal seedlings. Prior to transplantation into the pots, the root colonization rate by G. mosseae 171 was 65.27%, indicating that the G. mosseae 171 mycorrhizal colonizes well on tobacco seedling roots before transplanting. The growth promotion experiments were carried out with healthy plants using healthy paddy soil instead of the diseased soil and ended in 5th week. The results showed that application of bioorganic fertilizer (BOF) or G. mosseae 171 (Gm) alone was effective for growth promotion in tobacco plants. The BOF and Gm treatments significantly increased tobacco plant height and dry weight compared to control treatment (Table. 2). Meanwhile, the integrated treatment Gm + BOF showed significantly stronger

Table 1 Dry weight and G. mosseae mycorrhizal colonization of the 60 days old seedlings before transplanting. Treatment

Leaves dry weight (g/plant)

Roots dry weight (g/plant)

G. mosseae colonization (%)

Non-mycorrhizal seedling Mycorrhizal seedling

0.95 ± 0.13b

0.50 ± 0.08b

–

1.32 ± 0.11a

0.67 ± 0.06a

65.27 ± 3.92

Data are means ± standard error of fifteen replicates. Values in the same column with different letters represent significant difference between treatments according to the LSD test (p 6 0.05).

growth promotion effect compared to BOF and Gm treatment, especially in leaves and roots dry weight (Table. 2). Plant height, leaves and roots dry weight best results in the Gm + BOF treatment increased by 40.12%, 58.90%, and 63.24% compared to the control, respectively. 3.2. The biocontrol efficacy of TBW by bioorganic fertilizer and G. mosseae The results showed that application of T. harzianum SQR-T037 amended bioorganic fertilizer (BOF) and G. mosseae 171 (Gm) alone or combined could effectively suppress TBW disease when compared to control treatment (Fig. 1). By the end of the experiments (8th week), the disease incidence in the BOF and Gm treatments decreased by 26.8% and 14.7% compared to control, respectively, indicating that application of bioorganic fertilizer or G. mosseae 171 could reduce the occurrence of disease. However, integrated treatment Gm + BOF showed the best control efficacy of TBW by 68.2%, significantly higher than BOF and Gm treatments (Fig. 1). 3.3. The population of R. solanacearum (RS) in the rhizosphere soil A real-time PCR assay was used to estimate the population of RS in rhizosphere soil at the end of experiments (8th week). The results indicated that application of bioorganic fertilizer (BOF) or G. mosseae 171 alone significantly suppressed the population of RS in rhizosphere soils, which was reduced by 11.7 and 10.0% compared to control treatment, respectively (Fig. 2). The Gm + BOF treatment showed the strongest inhibitory effect on RS population, which was only 5.66 log copies g1 soil in Gm + BOF treatment at 8th week, corresponding to 21.3% reduction compared to control treatment (7.19 log copies g1 soil) (Fig. 2). The RS population was significantly lower in Gm + BOF treatment than in Gm or BOF treatments (Fig. 2). These results indicated that integrated application of bioorganic fertilizer with G. mosseae 171 had an additive suppressive effect on RS growth. 3.4. The G. mosseae root colonization and the T. harzianum population in the rhizosphere soil The results showed that the G. mosseae root colonization increased in the first 5 weeks after transplantation and then decreased (Fig. 3). The highest mycorrhizal colonization rate of 75.8% was achieved in Gm + BOF treatment at the 5th week. During the entire experiment period (8 weeks), G. mosseae root colonization in Gm + BOF treatment was significantly higher than in Gm treatment, indicating that the bioorganic fertilizer significantly promoted the G. mosseae colonization (Fig. 3). The results demonstrated that G. mosseae had an enriching effect on SQR-T037 rhizospheric colonization, as the SQR-T037 populations were higher in Gm + BOF than in BOF treatment

Table 2 Plant height, leaves and roots dry weight of tobacco plants at the 5th week after transplanting. Treatment

Plant height (cm)

Leaves dry weight (g)

Root dry weight (g)

Control BOF Gm Gm + BOF

49.60 ± 3.36b 64.27 ± 4.76a 63.83 ± 4.68a 69.50 ± 3.40a

31.68 ± 2.58c 41.81 ± 3.76b 42.55 ± 1.56b 50.93 ± 3.82a

17.22 ± 1.35c 23.50 ± 2.16b 22.39 ± 2.12b 28.11 ± 3.15a

Values in the same column with different letters represent significant difference between treatments according to the LSD test (p 6 0.05). Control, non-mycorrhizal seedlings treated with chemical fertilizer; BOF, non-mycorrhizal seedlings treated with bioorganic fertilizer; Gm, mycorrhizal seedlings treated with chemical fertilizer; Gm + BOF, the integrated treatment, mycorrhizal seedlings treated with bioorganic fertilizer.

168

S. Yuan et al. / Biological Control 92 (2016) 164–171

Fig. 1. Effects of different treatments on the disease incidence of TBW at the 8th week after transplanting. The bars with different letters indicate significant differences as determined by the LSD test (p 6 0.05). Control, non-mycorrhizal seedlings treated with chemical fertilizer; BOF, non-mycorrhizal seedlings treated with bioorganic fertilizer; Gm, mycorrhizal seedlings treated with chemical fertilizer; Gm + BOF, the integrated treatment, mycorrhizal seedlings treated with bioorganic fertilizer.

Fig. 3. Percentage of G. mosseae root colonization. *Indicates significant difference according to the LSD test (p 6 0.05). Gm, mycorrhizal seedlings treated with chemical fertilizer; Gm + BOF, the integrated treatment, mycorrhizal seedlings treated with bioorganic fertilizer.

(Fig. 4). The population levels of SQR-T037 were not significantly different between Gm + BOF and BOF treatment at the 5th week after transplanting, but at 8 weeks after transplantation, the population of SQR-T037 in the Gm + BOF (5.04 log copies g1 soil) was significantly higher than in the BOF treatment (4.22 log copies g1 soil) (Fig. 4). In general, the SQR-T037 population was significantly higher in the 5th week than in 8th week after transplantation (Fig. 4).

3.5. The change of the microbial diversity in the rhizosphere soil The DGGE profiles and diversity indices of microbial community in the rhizosphere soils at the end of experiments (8 weeks) are shown in Fig. 5 and Table 3. The results showed that application of G. mosseae increased the bacterial diversity, since the Gm and Gm + BOF treatments showed significantly higher Shannon’s diversity index (H) compared to Control, while there was nonsignificant difference between BOF and Control treatment (Fig. 5 (a) and Table 3). Therefore, the significant increase of H in Gm + BOF treatment might be due to the sole effect of the G. mosseae.

Fig. 4. Population of the T. harzianum SQR-T037 in tobacco plants with rhizosphere soil. The bars with different letters indicate significant difference as determined by the LSD test (p 6 0.05). BOF, control seedlings treated with bioorganic fertilizer; Gm + BOF, the integrated treatment, mycorrhizal seedlings treated with bioorganic fertilizer.

The DGGE results showed that fungal diversity was decreased in the bioorganic fertilizer treatments (BOF and Gm + BOF) as compared to the Control treatment, while, the Gm treatment showed non-significantly decrease compared to Control (Fig. 5(b) and Table 3). Therefore, the significant decrease of H in Gm + BOF treatment might be due to the sole effect of the bioorganic fertilizer. 3.6. Induction of tobacco defense enzymes by G. mosseae and bioorganic fertilizer

Fig. 2. Population of RS in the tobacco rhizosphere soil at the 8th week after transplanting. The bars with different letters indicate significant differences as determined by the LSD test (p 6 0.05). All treatments are the same as shown in Fig. 1.

Based on the biocontrol effect, the induction of the defense enzymes (PPO, PAL, and POD) in tobacco plants was determined (Fig. 6). Application of G. mosseae or bioorganic fertilizer alone significantly induced enzymatic activity compared to control. However, maximal enzyme activities of PPO, PAL, and POD were obtained in plants under Gm + BOF treatment (Fig. 6), which was consistent with the biocontrol efficacy (Fig. 1). These results demonstrated that the integrated application of G. mosseae 171 with the bioorganic fertilizer has an additive ability to induce resistance in tobacco plants.

S. Yuan et al. / Biological Control 92 (2016) 164–171

169

Fig. 5. The DGGE profiles of the microbial community in rhizosphere soil at the 8th week after transplanting. All treatments are the same as shown in Fig. 1.

Table 3 Shannon’s diversity index (H) of rhizosphere microbes in different treatments. Treatment

Control

BOF

Gm

Gm + BOF

Bacterial-H Fungi-H

3.24 ± 0.05b 2.46 ± 0.05a

3.32 ± 0.09ab 2.19 ± 0.06b

3.42 ± 0.03a 2.39 ± 0.05a

3.43 ± 0.02a 2.19 ± 0.04b

Values in the same column with different letters represent significant difference between treatments according to the LSD test (p 6 0.05). All treatments are the same as shown in Table 2.

4. Discussion The biocontrol capability of T. harzianum has been documented in several reports (Martínez-Medina et al., 2009; Keswani et al., 2014; Yedidia et al., 2003). Various biocontrol mechanisms of Trichoderma spp. have been reported, such as mycoparasitism, secondary metabolites production, competition, or induction of local and systemic defense responses (Huang et al., 2011; Keswani et al., 2014; Yedidia et al., 2003). However, studies on the application of T. harzianum to control bacterial wilts are rare. Glomus species have been assessed for biological control of diseases in many studies (Pozo et al., 2002; Ozgonen and Erkilic, 2007; Martínez-Medina et al., 2011), but their biocontrol role in repressing pathogenic RS is rarely reported. The present study demonstrated that the inoculation of G. mosseae 171 alone could decrease TBW incidence by 17.4% (Fig. 1) and the population of RS in the soil (Fig. 2). Many prior studies showed that combined application of AMF with antagonistic fungi could increase soil-borne disease suppression. For instance, root rot of geranium plants caused by Fusarium solani and Macrophomina phaseolina were more effectively inhibited by the combined application of T. harzianum or Penicillium oxalicum and G. mosseae (Haggag and Abd-Ellatif, 2001), and dampingoff of cucumber caused by Ralstonia solani was greatly reduced by combined application of T. harzianum and G. mosseae (Chandanie et al., 2009). Conversely, several examples of combined application of different biocontrol agents showed no better or, in some cases, worse biocontrol efficiency than the isolates used singly (Larkin and Fravel, 1998). To our knowledge, this study is the first report on integrated application of an AMF with a T. harzianum strain for TBW control management. In this study, the integrated

application of G. mosseae and T. harzianum SQR-T037 amended bioorganic fertilizer (Gm + BOF) showed the best control efficacy of TBW in pot experiments (Fig. 1). Our results demonstrated that integrated inoculation of G. moseae and T. harzianum had an additive effect on improvement of tobacco growth (Table. 2). The beneficial soil microbes and their activities play important roles in the transformation of plant nutrients from unavailable to available forms and the improvement of soil fertility (Adesemoye and Kloepper, 2009; Jain et al., 2015). The capacity of AMF to promote plant growth has been widely reported over the years (Barea et al., 2002). Mycorrhizae may raise plant tolerance to pathogens by enhancing plant nutrition, competing for nutrients and infection sites with pathogens, and changing root morphology (Linderman, 2000). Similar results were found by Haggag and Abd-Ellatif (2001) using the combined inoculation of G. mosseae and T. harzianum to enhance growth of geranium plants. The interaction between AMF and T. harzianum and its effect on plant growth may vary depending on the inherent characteristics of the AMF and the T. harzianum strain (Saldajeno et al., 2008). A significant increase in the G. mosseae root colonization was observed in the rhizosphere in the integrated treatment (Gm + BOF) (Fig. 3). We suggest that the increasing colonization of G. mosseae in the Gm + BOF treatment was probably due to the promotion of formation and allocation of photosynthate by the organic fertilizer, which benefits G. moseae colonization as shown by Møller et al. (2009). T. harzianum SQR-T037 may also have significant effect on the G. moseae root colonization. At the same time, G. moseae significantly improved the colonization of SQR-T037 in rhizosphere soils (Fig. 4). Saldajeno and Hyakumachi (2011) demonstrated that G. mosseae promoted Phoma sp. GS8-2 colonization in bentgrass. The G. mosseae and SQR-T037 colonization decrease at the 8th week compared with that at the 5th week after transplanting (Figs. 3 and 4) is likely because the pathogenic RS reached the highest level at 8th week. The abundance of RS showed a significant negative correlation with the G. mosseae (r = 0.964, p = 0.002) and SQR-T037 (r = 0.922, p = 0.042) rhizospheric colonization, in agreement with previous work (Møller et al., 2009). Our results show that the BOF and G. mosseae significantly changed the diversity of the microbial community (Fig. 5 and Table 3). AMF are known to affect other microorganisms surviving

170

S. Yuan et al. / Biological Control 92 (2016) 164–171

mechanical barriers with basal resistance responses at the pathogen infection site of host plants (Ryu et al., 2004). The induced systemic resistance in tobacco was been shown to be augmented by increased activity of various defense-related enzymes, such as the b-1,3-glucanase isozymes PPO, PAL, and POD (Tuzun, 2001). It has found that PPO plays an important role in disease resistance by oxidizing phenolics to create highly toxic quinones in the diseased plant tissue (Friedman, 1997). The activity of PPO was significantly increased by Rhodotorula mucilaginosa treatment when compared with control fruits and this increase enhanced the plants’ resistance to pathogens (Li et al., 2011). In our experiment, Gm + BOF treatment led to a significant increase in the PPO activity of tobacco (Fig. 6A). Another enzyme, PAL, catalyzes the nonoxidative deamination of the amino acid L-phenylalanine to trans-cinnamic acid in the phenylpropanoid biosynthesis pathway (Daayf et al., 1997). The role of PAL in imparting resistance to tobaccos against bacterial canker disease has been discussed previously (Umesha, 2006). In our experiment, the Gm + BOF treatment resulted in a significant increase in the PAL activity in tobacco (Fig. 6B). POD participates in cell wall polysaccharide deposition processes, such as the oxidation of phenols and the lignification of host plant cells, during the defense reaction against pathogens (Prabha and Patwardhan, 1986). The activity of POD maintained higher levels in the Gm + BOF treatment (Fig. 6C). Therefore, integrated application of G. mosseae and SQR-T037 likely induced the defense responses of PPO, PAL, and POD against RS. In conclusion, application of BOF and Gm showed effective biocontrol of TBW disease on tobacco plants. The integrated treatment (Gm + BOF) showed more effectiveness in suppressing TBW disease than application of either Gm or the BOF alone and significantly increased tobacco growth in pot experiments. However, divergent results of biological control trials in field vs. greenhouse trials are common, and field trials are an essential next step to confirm the above findings.

Acknowledgments This research was financially supported by Programs of Study and Application of Key Technologies for Soil Bioremediation in Guizhou Province (110201002019) and Study and Application of Key Technologies for Tobacco Soil Microbial Ecological Remediation in Guizhou Province (201018).

References

Fig. 6. The influence of different treatment on the accumulation of PPO (A), PAL (B), and POD (C) in tobacco plants. The data are the means of three replicates. The bars with different letters indicate significant differences as determined by the LSD test (p 6 0.05). All treatments are the same as shown in Fig. 1.

in the rhizosphere by changing the composition of root exudates, resulting in co-operation between AMF and other microorganisms in relation to plant growth and health (Barea et al., 2005). The change of microbial communities in the rhizosphere of mycorrhizal plants could potentially affect the performance of T. harzianum. Our previous preliminary report showed that SQR-T037 amended bioorganic fertilizer could alter the community of microorganisms in the rhizosphere (Chen et al., 2011). However, more research is needed to understand the mode of interaction between AMF, biocontrol agents and organic fertilizer as well as their interactions with the tobacco plant in question. Beneficial microorganisms may elicit systemic resistance against the pathogens through the manipulation of chemical and

Adesemoye, A.O., Kloepper, J.W., 2009. Plant-microbes interactions in enhanced fertilizer-use efficiency. Appl. Microbiol. Biotechnol. 85, 1–12. Azcón-Aguilar, C., Jaizme-Vega, M., Calvet, C., 2002. The contribution of arbuscular mycorrhizal fungi to control of soil-borne plant pathogens. In: Gianinazzi, S., Schüepp, H., Barea, J.M., Haselwandter, K. (Eds.), Mycorrhizal Technology in Agriculture: From Genes to Bioproducts. Birkhäuser Verlag, Basel, pp. 187–197. Barea, J.M., Toro, M., Orozco, M.O., Campos, E., Azcón, R., 2002. The application of isotopic (32P and 15N) dilution techniques to evaluate the interactive effect of phosphate-solubilizing rhizobacteria, mycorrhizal fungi and Rhizobium to improve the agronomic efficiency of rock phosphate for legume crops. Nutr. Cycl. Agroecosyst. 63, 35–42. Barea, J.M., Pozo, M.J., Azcón, R., Azcón-Aguilar, C., 2005. Microbial co-operation in the rhizosphere. J. Exp. Bot. 56, 1761–1778. Bowen, G.D., Rovira, A.D., 1999. The rhizosphere and its management to improve plant growth. Adv. Agron. 66, 1–102. Brundrett, M.C., Piché, Y., Peterson, R.L., 1984. A new method for observing the morphology of vesicular-arbuscular mycorrhizae. Can. J. Bot. 62, 2128–2134. Chandanie, W.A., Kubota, M., Hyakumachi, M., 2009. Interactions between the arbuscular mycorrhizal fungus Glomus mosseae and plant growth promoting fungi and their significance for enhancing plant growth and suppressing damping-off of cucumber (Cucumis sativus L.). Appl. Soil Ecol. 41, 336–341. Chen, L.H., Yang, X.M., Raza, W., Luo, J., Zhang, F.G., Shen, Q.R., 2011. Solid-state fermentation of agro-industrial wastes to produce bioorganic fertilizer for the biocontrol of Fusarium wilt of cucumber in continuously cropped soil. Bioresour. Technol. 102, 3900–3910.

S. Yuan et al. / Biological Control 92 (2016) 164–171 Daayf, F., Bel-Rhlid, R., Bélanger, R.R., 1997. Methyl ester of p-coumaric acid: a phytoalexin-like compound from long english cucumber leaves. J. Chem. Ecol. 23, 1517–1526. Daniels, B.A., Skipper, H.D., 1982. In: Schenck, N.C. (Ed.), Method: and Principles of Mycorrhizal Research. American Phytopathological Society, St Paul, MN, pp. 29– 35. Elad, Y., Stewart, A., 2004. Microbial control of Botrytis spp. In: Elad, Y., Williamson, B., Tudzynski, P., Delan, N. (Eds.), Botrytis: Biology, Pathology and Control. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 223–241. Elphinstone, J.G., 2005. Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. APS Press, St. Paul, MN. Friedman, M., 1997. Chemistry, biochemistry, and dietary role of potato polyphenols. A review. J. Agric. Food Chem. 45, 1523–1540. Gamliel, A., Austerweil, M., Kritzman, G., 2000. Non-chemical approach to soilborne pest management-organic amendments. Crop Prot. 19, 847–853. Green, H., Larsen, J., Olsson, P.A., Jensen, D.F., Jakobsen, I., 1999. Suppression of the biocontrol agent Trichoderma harzianum by mycelium of the arbuscular mycorrhizal fungus Glomus intraradices in root-free soil. Appl. Environ. Microbiol. 65, 1428–1434. Green, S.J., Leigh, M.B., Neufeld, J.D., 2010. Denaturing Gradient Gel Electrophoresis (DGGE) for Microbial Community Analysis. Springer, Berlin. Haggag, W.M., Abd-Ellatif, F.M., 2001. Interaction between vesicular arbuscular mycorrhizae and antagonistic biocontrol microorganisms on controlling root rot disease incidence of geranium plants. Online J. Biological Sci. 1, 1147–1153. Hao, Y.J., Wei, J., Liu, C.Y., Wang, Y., Wang, W.L., 2009. Effect of biological soil amendment reducing on replant diseases of cucumber. Acta Agric. Boreali. Sin. 24, 231–234. Huang, X.Q., Chen, L.H., Ran, W., Shen, Q.R., Yang, X.M., 2011. Trichoderma sp. strain SQR-T37 and its bio-organic fertilizer could control Rhizoctonia solani dampingoff disease in cucumber seedlings mainly by the mycoparasitism. Appl. Microbiol. Biot. 91, 741–755. Jain, A., Singh, A., Singh, S., Singh, H.B., 2015. Biological management of Sclerotinia sclerotiorum in pea using plant growth promoting microbial consortium. J. Basic Microbiol. 55 (8), 961–972. Jeffries, P., Barea, J.M., 2001. Arbuscular mycorrhiza a key component of sustainable plant-soil ecosystems. In: Hock, B. (Ed.), The Mycota, vol. IX. Springer Fungal Associations, Berlin, pp. 95–113. Jeffries, P., Gianinazzi, S., Perotto, S., Turnau, K., Barea, J.M., 2003. The contribution of arbuscular mycorrhizal fungi in sustainable maintenance of plant health and soil fertility. Biol. Fert. Soils 37, 1–16. Keswani, C., Mishra, S., Sarma, B.K., Singh, S.P., Singh, H.B., 2014. Unraveling the efficient applications of secondary metabolites of various Trichoderma spp. Appl. Microbiol. Biot. 98 (2), 533–544. Lang, J., Hu, J., Ran, W., Xu, Y., Shen, Q., 2012. Control of cotton Verticillium wilt and fungal diversity of rhizosphere soils by bio-organic fertilizer. Biol. Fert. Soils 48, 191–203. Larkin, R.P., Fravel, D.R., 1998. Efficacy of various fungal and bacterial biocontrol organisms for control of Fusarium wilt of tomato. Plant Dis. 82, 1022–1028. Li, R., Zhang, H., Liu, W., Zheng, X., 2011. Biocontrol of postharvest gray and blue mold decay of apples with Rhodotorula mucilaginosa and possible mechanisms of action. Int. J. Food Microbiol. 146, 151–156. Linderman, R.G., 2000. In: Kapulnik, Y., Douds, D.D., Jr. (Eds.), Effects of Mycorrhizal Fungi on Plant Tolerance to Diseases. Kluwer Academic Publishers, The Netherlands, pp. 345–365. Ling, N., Xue, C., Huang, Q.W., Yang, X.M., Xu, Y.C., Shen, Q.R., 2010. Development of a mode of application of bioorganic fertilizer for improving the biocontrol efficacy to Fusarium wilt. Biocontrol 55, 673–683. Liu, Y., Shi, J., Feng, Y., Yang, X., Li, X., Shen, Q., 2012. Tobacco bacterial wilt can be biologically controlled by the application of antagonistic strains in combination with organic fertilizer. Biol. Fert. Soils 49, 447–464. Lopez-Mondejar, R., Anton, A., Raidl, S., Ros, M., Pascual, J.A., 2010. Quantification of the biocontrol agent Trichoderma harzianum with real-time TaqMan PCR and its potential extrapolation to the hyphal biomass. Bioresour. Technol. 101, 2888– 2891. Luo, H.F., Qi, H.Y., Zhang, H.X., 2004. Assessment of the bacterial diversity in fenvalerate-treated soil. World J. Microbiol. Biotechnol. 20, 509–515. Martínez-Medina, A., Pascual, J.A., Lloret, E., Roldán, A., 2009. Interactions between arbuscular mycorrhizal fungi and Trichoderma harzianum and their effects on Fusarium wilt in melon plants grown in seedling nurseries. J. Sci. Food Agric. 89, 1843–1850. Martínez-Medina, A., Roldán, A., Pascual, J.A., 2011. Interaction between arbuscular mycorrhizal fungi and Trichoderma harzianum under conventional and low input fertilization field condition in melon crops: growth response and Fusarium wilt biocontrol. Appl. Soil Ecol. 47, 98–105. McGonigle, T.P., Miller, M.H., Evans, D.G., Fairchild, G.L., Swan, J.A., 1990. A new method which gives an objective measure of colonization of roots by vesiculararbuscular mycorrhizal fungi. New Phytol. 115, 495–501. Møller, K., Kristensen, K., Yohalem, D., Larsen, J., 2009. Biological management of gray mold in pot roses by co-inoculation of the biocontrol agent Ulocladium atrum and the mycorrhizal fungus Glomus mosseae. Biol. Control 49, 120–125.

171

Murage, E.N., Masuda, M., 1997. Response of pepper and eggplant to continuous light in relation to leaf chlorosis and activities of antioxidative enzymes. Sci. Hortic. (Amsterdam) 70, 269–279. Ozgonen, H., Erkilic, A., 2007. Growth enhancement and Phytophthora blight (Phytophthora capsici Leonian) control by arbuscular mycorrhizal fungal inoculation in pepper. Crop Prot. 26, 1682–1688. Peng, X.Q., Zhou, G.S., Deng, Z.P., Kuang, C.F., Luo, K., Liu, H.Y., 2007. Screening, identification and control efficacy of tobacco antagonistic endophytic bacteria against Ralstonia solanacearum. Acta Phytopathol. Sin. 37, 670–674. Pozo, M.J., Cordier, C., Dumas-Gaudot, E., Gianinazzi, S., Barea, J.M., Azcón-Aguilar, C., 2002. Localized versus systemic effect of arbuscular mycorrhizal fungi on defence responses to Phytophthora infection in tomato plants. J. Exp. Bot. 53, 525–534. Prabha, T., Patwardhan, M., 1986. Polyphenol oxidase (PPO) and peroxidase (POD) enzyme activities and their isoenzyme patterns in ripening fruits. Acta Aliment. Hung. 15, 199–207. Ryu, C.M., Murphy, J.F., Mysore, K.S., Kloepper, J.W., 2004. Plant growth-promoting rhizobacteria systemically protect Arabidopsis thaliana against Cucumber mosaic virus by a salicylic acid and NPR1-independent and jasmonic acid dependent signaling pathway. Plant J. 39, 381–392. Saldajeno, M.G.B., Hyakumachi, M., 2011. The plant growth promoting fungus Fusarium equiseti and the arbuscular mycorrhizal fungus Glomus mosseae stimulate plant growth and reduce severity of anthracnose and damping off diseases in cucumber (Cucumis sativus) seedlings. Ann. Appl. Biol. 159, 28–40. Saldajeno, M.G.B., Chandanie, W.A., Kubota, M., Hyakumachi, M., 2008. Effects of interactions of arbuscular mycorrhizal fungi and beneficial saprophytic mycoflora on plant growth and disease protection. In: Siddiqui, Z.A., Akhtar, M.S., Futai, K. (Eds.), Mycorrhizae: Sustainable Agriculture and Forestry. Springer Sciences, Netherlands, pp. 211–226. Schonfeld, J., Gelsomino, A., van Overbeek, L.S., Gorissen, A., Smalla, K., van Elsas, J. D., 2003. Effects of compost addition and simulated solarisation on the fate of Ralstonia solanacearum biovar 2 and indigenous bacteria in soil. FEMS Microbiol. Ecol. 43, 63–74. Smith, S.E., Read, D.J., 2008. Mycorrhizal Symbiosis, third ed. Academic Press, London, p 787. Srivastava, R., Khalid, A., Singh, U.S., Shama, A.K., 2010. Evaluation of arbuscular mycorrhizal fungus, fluorescent Pseudomonas and Trichoderma harzianum formulation against Fusarium oxysporum F. sp. lycopersici for the management of tomato wilt. Biol. Control 53, 24–31. Teisson, C., Combres, J., Martin-Prevel, P., Marchal, J., 1979. Internal browning of pineapples: (III symptoms, IV) biochemical approach. Fruits 34, 315–338. Tobacco N.A.T.C.o., 1996. Tobacco standards of People’s Republic of China, Grade an investigating method of tobacco disease. State Tobacco Monopoly Administration, Beijing. Tuzun, S., 2001. The relationship between pathogen-induced systemic resistance (ISR) and multigenic (horizontal) resistance in plants. Eur. J. Plant Pathol. 107, 85–93. Umesha, S., 2006. Note: phenylalanine ammonia lyase activity in tomato seedlings and its relationship to bacterial canker disease resistance. Phytoparasitica 34, 68–71. Wei, Z., Yang, X., Yin, S.X., Shen, Q.R., Ran, W., Xu, Y.C., 2011. Efficacy of Bacillusfortified organic fertiliser in controlling bacterial wilt of tomato in the field. Appl. Soil Ecol. 48, 152–159. Whelan, J.A., Russell, N.B., Whelan, M.A., 2003. A method for the absolute quantification of cDNA using real-time PCR. J. Immunol. Methods 27, 261–269. Whetten, R.W., Sederoff, R.R., 1992. Phenylalanine ammonia-lyase from loblolly pine: purification of the enzyme and isolation of complementary DNA clones. Plant Physiol. 98, 380–386. Yabuuchi, E., Kosako, Y., Yano, I., Hotta, H., Nishiuchi, Y., 1995. Transfer of 2 Burkholderia and an Alcaligenes Species to Ralstonia Gen-Nov-Proposal of Ralstonia-Pickettii (Ralston, Palleroni and Doudoroff 1973) Comb-Nov, Ralstonia-Solanacearum (Smith 1896) Comb-Nov and Ralstonia-Eutropha (Davis 1969). Comb. Nov. Microbiol. Immunol. 39, 897–904. Yang, X.M., Chen, L.H., Yong, X.Y., Shen, Q.R., 2011. Formulations can affect colonization and biocontrol efficiency of Trichoderma harzianum SQR-T037 against Fusarium wilt of cucumbers. Biol. Fert. Soils 47, 239–248. Yao, J., Wang, M.S., Wang, T.M., Wang, F., Ma, Y., Qiu, Z.Z., 2013. Effects of arbuscular mycorrhizal fungi on photosynthetic characteristics in leaves of flue-cured tobacco. Chin. Tob. Sci. 34 (4), 30–35. Yedidia, I., Shoresh, M., Kerem, Z., Benhamou, N., Kapulnik, Y., Chet, I., 2003. Concomitant induction of systemic resistance to Pseudomonas syringae pv. lachrymans in cucumber by Trichoderma asperellum (T-203) and accumulation of phytoalexins. Appl. Environ. Microbiol. 69, 7343–7353. Yi, Y.J., Liu, R.S., Yin, H.Q., Luo, K., Liu, E.M., Liu, X.D., 2007. Isolation, identification and field control efficacy of endophytic strain against tobacco bacterial wilt. Chin. J. Appl. Ecol. 18, 554–558. Zhang, N., Wu, K., He, X., Li, S., Zhang, Z., Shen, B., Yang, X.M., 2011. A new bioorganic fertilizer can effectively control banana wilt by strong colonization with Bacillus subtilis N11. Plant Soil 344, 87–97.