Biomimetic fabrication of new bioceramics-introduced fibrous scaffolds: From physicochemical characteristics to in vitro biological properties

Materials Science & Engineering C 94 (2019) 547–557

Contents lists available at ScienceDirect

Materials Science & Engineering C journal homepage: www.elsevier.com/locate/msec

Biomimetic fabrication of new bioceramics-introduced fibrous scaffolds: From physicochemical characteristics to in vitro biological properties

T

⁎

Tao Liua,b, , Yingrui Chena, Dongzhi Laia, Lixiang Zhanga, Xiaodan Panb, Jianyong Chena, Hequn Wengc a

College of Materials and Textiles, Zhejiang Sci-Tech University, Hangzhou 310018, China Keyi College, Zhejiang Sci-Tech University, Shaoxing 312369, China c Department of Emergency, Yixing People's Hospital, Yixing 214200, China b

A R T I C LE I N FO

A B S T R A C T

Keywords: Silk fibroin MGHA Electrospinning Composite Mesenchymal stem cells

The combination of biodegradable polymers and bioactive inorganic materials is a promising method to mimic native tissue in bone regeneration. Toward this direction, electrospun fibrous scaffolds were successfully fabricated in the silk fibroin (SF) matrix containing new bioceramics on the basis of mesoporous bioactive glass/ hydroxyapatite nanocomposite (MGHA). The physicochemical properties and surface hydrophilicity of these biphasic composite could be tailored by the addition of MGHA content. The increase in surface hydrophilicity and bioactivity of the as-spun composite fibers were observed with the increasing the nanoparticle contents while decreasing their tensile strength. In vitro cytotoxicity evaluation based on human bone marrow-derived mesenchymal stem cells (hMSCs) revealed that a positive osteogenic differentiation effect on SF/MGHA7 sample as evidenced by an increased alkaline phosphatase (ALP) activity, and upregulated osteoblastic gene expression compared with SF samples. These findings supported the suitability of the SF/MGHA composite system for its potential application in cell–material combination in bone tissue engineering.

1. Introduction Nonunion or critically sized bone fractures habitually often use autografts or allografts to support for healing. However, these bone grafts suffer from multiple limitations including tissue availability, disease transmission, and donor morbidity [1]. In this regard, the synthetic alternatives of combining organic and inorganic compositions are considered to be attractive; where the organic matrix affords resilience and shape-ability, the inorganic component improves mechanical and biological properties [2,3]. Among the scaffold forms, the fibrous architecture that mimics the excetral cellular matrix (ECM) has been widely used to facilitate interaction with cells and repair damaged tissues including bone [4–7]. The engineered electrospun mats with controlled pore porosity, fiber diameters between 100 nm and 5 μm, as well as interfiber spacing within 200 μm can initiate cellular events. Along the fibers, osteoprogenitor or stem cells have been shown to readily recognize the fibrous architecture, develop their shape on the surface, and consequently differentiate into an osteogenic lineage under proper biochemical cues [8–10]. Currently, the scaffolds have been used as the delivery vehicles for loading therapeutic molecules and their subsequent delivery, such as ⁎

drugs, proteins, and genes [11]. As classified therapeutics, ions, such as silicon (Si) and calcium (Ca) ions, can also be introduced to modify the healing microenvironment and initiate osteogenesis [12,13]. One method of delivery is the release of Si and Ca ions from bioactive glasses, which are defined as inorganic surface-active bioglass. In fact, the ability of release ions from glass can generate a hydroxycarbonate apatite layer, imparting the ability to strongly integrate with live bone, and ultimately degrade in the body [14]. As glass degradation, continuously release of these ions makes a glass of interest as controlled release devices. In this regard, mesoporous bioactive glasses (MGs) with excellent structural and textural properties have been suggested as promising scaffolds for bone repair and drug loading. In the ternary SiO2–CaO–P2O5 system, their higher surface/volume ratios related to chemical synergistic effect provoke the most accelerated bioactive kinetics shown up to date. Furthermore, MGs are effective in loading a series of therapeutic molecules, including small antibiotic drugs, proteins, and genetic molecules, demonstrating their usefulness for nano delivery systems [15]. Nowadays, the design of “nanocomposite systems” where the amorphous MG and nanocrystalline HA combination is dispersed will broaden the functionality beyond that of either in their pure state

Corresponding author at: College of Materials and Textiles, Zhejiang Sci-Tech University, Hangzhou 310018, China. E-mail address: [email protected] (T. Liu).

https://doi.org/10.1016/j.msec.2018.09.063 Received 5 January 2018; Received in revised form 8 August 2018; Accepted 27 September 2018 Available online 02 October 2018 0928-4931/ © 2018 Elsevier B.V. All rights reserved.

Materials Science & Engineering C 94 (2019) 547–557

T. Liu et al.

JIDA Co., China. Tetraethyl orthsilicate (TEO, 98%), triethyl phosphate (TEP), calcium nitrate (CaNT), calcium chloride(CaCl2), hexafluoro-2propanol (HFIP), ethanol, and other reagents were purchased from Sinopharm Reagents Co., Shanghai. B. mori silkworm cocoons were kindly supplied by Huzhou Academy of Agricultural Science (Zhejiang, China). All other chemicals were of reagent grade. Human Mesenchymal stem cells (hMSCs) were obtained from Stem Cell bank, Chinese Academy of Sciences.

[16–19]. Cicuéndez et al. reported a rapid prototyping technique to prepare hierarchical meso-macroporous three-dimensional (3D) MGHA scaffolds. Though the amine chemical modification, the MGHA scaffolds significantly improve the cell adhesion, scaffold colonization and preosteoblast differentiation [20]. Based on our previous studies [21,22], our group reported such composite scaffolds based on silk fibroin (SF) with a bioceramic additive to mimic bone ECM. SF derived from the silkworm Bombyx mori may contribute to bone regeneration due to its excellent mechanical properties, slow degradability, low inflammatory response, and low osteoconductivity [23,24]. The combination of bioceramic-polymer materials is generally used to provide an improved osteoconductive environment for bone healing. With this objective, it is necessary to obtain such SF-based biocomposite system with the proper performance required for cell colonization, preserving the intrinsic characteristics of both components during the scaffold manufacturing process. However, there have been limited reports on the osteogenic effects of such biocomposite with the additive of MGHA material, and evidence addressing these characteristic about MGHA scaffolds is still a matter for further research. This study attempts to assess bone formation from hMSCs grown on such biocomposites in vitro with the inclusion of MGHA nanoparticle for potential enhanced bone outcomes. Based on the preparation of MBHA material, these SF/MGHA composite scaffolds were first fabricated by tailoring the optimized electrospinning parameters, where the MGHA content was varied from 1 (w/w)% to 7(w/w)%. Furthermore, their physicochemical properties and biological performances were studied in vitro to confirm the performance of the scaffolds design, in terms of bioactivity, biocompatibility, and promotion of hMSCs proliferation and differentiation.

2.1.1. Preparation of MGHA (see Scheme 1(step A)) The MGHA nanocomposite was prepared via hydrothermal synthesis under glucose-assisted conditions as described previously [25]. Briefly, 1.5 g of P123 and 60 mL of 2 M HCl were dissolved in 15 mL of distilled water at 40 °C until the mixture became clear. Then, 6.02 g TEOS, 0.49 g TEP, 0.91 g CaNT, and 7.5 g glucose were added to the solution. After stirring for 12 h, the mixture was transferred to the hydrothermal synthesis by added the mixture to a teflon-lined autoclave and was placed at 160 °C for 16 h. Without any filtering and washing, the resultant precipitate was directly dried at 100 °C for 10 h in air. The nanocomposite was first carbonized at 350 °C for 3 h under a nitrogen atmosphere, and then calcined at 650 °C for 8 h in air. The morphology and microstructure of the nanoparticles are shown in Fig. S1.

2.1.2. Preparation of regenerated SF (see Scheme 1(step B)) B. mori silkworm cocoons were degummed twice in 2 wt% neutral soap at 100 °C for 3 h and then rinsed thoroughly with distilled water to extract the glue-like sericin proteins. After drying, degummed silk was dissolved in a ternary-solvent system of CaCl2/H2O/C2H5OH solution (1:8:2 in molar ratio) at 70 °C for 2 h. The silk solution was dialyzed against distilled water using cellulose tube (D44 mm, interception scope > 8000) at room temperature for 3 d. After centrifugation, the obtained concentration of aqueous SF solution was about 3.0 wt% though weighing the remaining solid after drying.

2. Materials and methods 2.1. Preparation of materials Surfactant pluronic P123 (EO20–PO70–EO20) was purchased from

Scheme 1. Schematic procedure for the preparation of composite fibers. 548

Materials Science & Engineering C 94 (2019) 547–557

T. Liu et al.

2.1.3. Preparation of composite fibers (see Scheme 1(step C)) To form a uniform mixture, the MGHA nanoparticles were dispersed in SF solution endured ultra sonification and magnetic stirring to break up nanoparticles agglomerates. Then, the above mixture was cast into polystyrene dishes and dried at 25 °C for 12 h to obtain the blend films. After that, the blend films were dissolved in HFIP under stirring to yield spinning SF/MGHA solution with a concentration of 8 wt%. Pure SF spinning solution with the same concentration was also prepared for comparison. The viscous solutions with a SF/MGHA weight ratio of 100:1, 100:3, 100:5, and 100:7 were poured into a 10 mL syringe with a needle, which was then placed on the injection pump (KDS 220; KD Scientific) to modulate the pump rate at 0.5 mL h−1. The needle was connected to a high-voltage supply (FC60P2; Glassman High Voltage). The device was placed in a chamber that provided flowing warm air. A 13 kV voltage was used, and the grounded Al collector was placed at 13 cm from the needle tip. The mats were electrospun onto the collector and formed the SF/MGHAx (x = 1, 3, 5, 7%; x is denoted as the MGHA percent ratio in the SF solutions) fibrous membranes. The electrospun SF and SF/MGHA composite scaffolds were treated with 75% (v/v) ethanol/water solution for 30 min to induce β-sheet secondary structures.

2.4.1. Cell seeding and culture on the samples These electrospun scaffolds used with cell cultures were sterilized with 75% EtOH and ultraviolet (UV) light and then were immersed in a culture medium overnight. The cells were then seeded onto the mats at a density of 1 × 105 cells per sample and incubated in an atmosphere of 5% CO2 at 37 °C. The wells were then flooded with culture medium and cultured for a different number of days, where the medium was changed every second day. 2.4.2. Cell morphology To assess the morphology of cells on the scaffolds, the cells were examined by FESEM after 1 d and 5 d. The cell/scaffold constructs were fixed in 2.5% glutaraldehyde and dehydrated through a graded ethanol series (30%, 50%, 70%, 80%, 90%, 95%, and 100%). Dried scaffolds were coated with gold and examined under FESEM. 2.4.3. Cell proliferation assay The hMSCs were plated at a density of 1 × 104 cells per cm2 and cultured in the conditioned cell culture media. MTT (3‑(4,5‑dimethiazol‑2‑yl)‑2,5‑diphenyltetrazolium bromide) assay was used to quantitatively assess the number of viable cells attached and grown on the mats. Briefly, at the end of specified time point, the culture medium was removed, and then 1 mL serum-free medium and 100 mL MTT (Sigma) solution (5 mg mL−1 in PBS) were added into each well, followed by incubation at 37 °C for 4 h for MTT formazan formation. The upper solvent was then discarded and the blue formazan reaction product was dissolved by adding 200 mL DMSO. The dissolvable solution was transferred to a 96-well plate. During the dissolving process, the mats were squeezed to ensure the complete extraction of the formazan. The optical density at 570 nm (OD570) was determined against the sodium dodecyl sulfate solution blank using a spectrophotometric microplate reader (SpectraMax M5). The data were reported as the mean of five examinations.

2.2. Characterization The conductivity of SF/MGHA blend solutions in HFIP was measured on a conductometer (DDP-220, Shanghai Precision & Scientific Instrument Co., Ltd., China) for three times tests at 25 °C. The fiber morphologies of the scaffolds were observed using an optical microscope (BX51; Olympus), field-emission scanning electron microscopy (FESEM: Ultra–55; Carl Zeiss), and transmission electron microscopy (TEM: JEM2100; JEOL). The FESEM images were analyzed with the Image-Pro plus (IPP) software to acquire the average fiber diameters from 100 fibers random measurements. Surface wettabilities of the electrospun mats were characterized by the water contact angle goniometer (DSA100; Krüss Gmbh, Germany). A droplet of 5 μL water was placed on the surface of the samples through a stainless steel needle at a rate of 2 mL s−1. Under the ambient condition of constant temperature and humidity, the water contact angles for three independent mats were achieved and presented as the mean ± SD. Fourier transform infrared spectroscopy (FTIR) data were gathered with a Nicolet 5700 (Thermo Fisher, USA). The measurements were taken in the range of 4000–600 cm−1 at a resolution of 4 cm−1.

2.4.4. ALP activity assay For hMSCs cells seeded in the mats for 7 d, and 14 d, ALP as a marker of osteoblast activity was assayed by measuring the release of pnitrophenol from p-nitrophenyl phosphate (p-NPP). The mats seeded with hMSCs cells were rinsed gently with PBS (phosphate-buffered saline) and incubated in Tris buffer (10 mM, pH 7.5) containing 0.1% Triton X-100 for 10 min. Next, 100 μL of the lysate was added to a 96well plate containing 100 μL of p-NPP solution, which was prepared using an ALP kit (Beyotime Institute of Biotechnology). The ALP activity was determined by measuring the absorbance at 405 nm, using a microplate reader.

2.3. Bioactivity in vitro The SBF was prepared according to the method proposed by Kokubo and Takadama [26]. For in vitro bioactivity, the electrospun fibrous matrices were soaked in SBF at 37.5 °C for 7 d. The SBF was refreshed every other day. At the present time interval, the samples were gently rinsed with DI water several times to remove the soluble inorganic ions completely and then dried at room temperature for FESEM observation and energy dispersive spectrometry (EDS).

2.4.5. Gene expression using real-time reverse transcriptase PCR (RT-PCR) analysis After osteogenic differentiation, total RNA was extracted from cells using the Trizol extraction method. Purified RNA was then used for cDNA synthesis using a PrimeScript™ RT reagent kit (Takara, Dalian) according to the manufacturer's instructions. The expression of various transcripts was analyzed using SYBR Premix Ex Taq (Takara). Primer sets used in this study were as follows, GAPDH: sense 5′‑AGGTCGGT GTGAACGGATTTG‑3′ and antisense 5′‑TGTAGACCATGTAGTTGAGG TCA‑3′, collagen type I (Col I): sense 5′‑TACCCCACTCAGCCCAGTGT‑3′ and antisense 5′‑ACCAGACATGCCTCTTGTCCTT‑3′, runt-related transcription factor 2 (Runx 2): sense 5′‑ATGGCGGGTAACGATGAAAAT‑3′ and antisense 5′‑ACGGCGGGGAAGACTGTGC‑3′, osteocalcin (OCN): sense 5′‑ATGAGAGCCCTCACACTCCTC‑3′ and antisense 5′‑GCCGTAG AAGCGCCGATAGGC‑3′. All PCRs were carried out in triplicate.

2.4. Cell test in vitro (see Scheme 1(step D)) The hMSCs were cultured in cell culture medium completed Dulbecco's Modified Eagles Medium (DMEM, Gibco, USA) containing 10% fetal bovine serum (FBS, Gibco, USA) and 1% penicillin–streptomycin at 37 °C, 5%CO2 and 95% saturated humidity. The culture media was changed every 2–3 d and the non-adherent cells were washed away by PBS. After culture for 4 weeks, the hMSCs were harvested using trypsin–EDTA. When the hMSCs were cultured until 80% confluence, the confluent cells were detached by trypsin and used for the seeding, attachment, proliferation and differentiation assays. Confluent cells were detached and frozen. All the procedures were approved by the Ethics Committee of Zhejiang Sci-Tech University.

2.5. Statistical analysis The results were expressed as the mean ± standard deviation (mean ± SD). Statistical analysis was carried out using one-way 549

Materials Science & Engineering C 94 (2019) 547–557

T. Liu et al.

Fig. 1. TEM images of electropsun (a) SF, (b) SF/MGHA1, (c) SF/MGHA3, (d) SF/MGHA5 and (e) SF/MGHA7 fibers. The MGHA nanoparticles being indicated by the box.

the SF/MGHA composites. Especially, the addition of 7% MGHA formed a structure with nanoparticles protuberances on the fiber surfaces, in a good agreement with TEM results (Fig. 1). These nanoparticles in the inner structure of these electrospun fibers were attached to the fiber surfaces in the composite matrix. Moreover, the fiber diameter distributions of SF and SF/MGHAs were all in the 600–1800 nm range. Before ethanol treatment, the average diameters of SF, SF/MGHA1, SF/MGHA3, SF/MGHA5, and SF/ MGHA7 were 0.80 ± 0.21 μm, 1.16 ± 0.31 μm, 1.29 ± 0.57 μm, 1.32 ± 0.47 μm, and 1.33 ± 0.20 μm, respectively. The SF/MGHA fibers possessed a larger fiber diameter compared with pure SF because of the incorporation of MGHA powders. When the weight ratio of MGHA nanoparticles reached 7%, the beads could be seen on the fiber surface and were prone to aggregation. After ethanol treatment, the fiber diameters for SF, SF/MGHA1, SF/MGHA3, SF/MGHA5, and SF/ MGHA7 were 0.94 ± 0.23 μm, 1.18 ± 0.20 μm, 1.31 ± 0.30 μm, 1.39 ± 0.41 μm, and 1.40 ± 0.32 μm, respectively. Fig. S2 represents the variation in average fiber diameter and solution conductivity as a function of the MGHA content in blends, respectively. The average fiber diameters of the blended fiber gradually became broad along with increasing the MGHA ratio from 1% to 7%. On the contrary, the conductivity of blend solution steadily decreased with the content of MGHA from 8.4 ± 0.8 to 7.6 ± 0.6 μS/cm (Fig. S2(b)). FTIR spectroscopy is a universally used method for detecting the secondary structure of SF. According to the characteristic absorption bands for protein materials, the broad peak from 1655 to 1660 cm−1 for amide I is assigned to be either the random coil or the helical conformation, or both [27]; the bands observed at 1628 and 1698 cm−1 for amide I correspond to the β-sheet and β-turn conformations, respectively. For amide II, the peaks centered at 1540 and 1520 cm−1 are classified as the random coil and β-sheet conformations, respectively. For amide III, the bands at 1233 and 1264 cm−1 are considered to the random coil/α-helix and β-sheet conformations. Fig. 3 shows the FTIR spectra of SF and SF/MGHA fibrous scaffolds with various MGHA contents. It was found that untreated SF scaffolds were predominantly in a random coil conformation. After ethanol treatment, these pure SF and SF/MGHA samples showed the characteristic absorption bands from the amide group, indicating that the coexistence of random coil/αhelix and β-sheet structures in the mats. Moreover, the addition of MGHA into the SF matrix resulted in the appearance of the new bands at 1090 and 1070 cm−1 in FTIR spectra, which were associated with SieOeSi asymmetric stretching mode and PeO stretching vibration from MGHA, respectively. Here the tensile strength of these SF/MGHA scaffolds in the dry

ANOVA, and differences of p < 0.05 were considered to be statistically significant. 3. Results In this study, we reported an electrospun fibrous scaffold to improve in vitro biological performances by a biomimetic approach. The composite was based on conjugating HA to MG, combining them with SF matrix and then fabricating composite fibers by electrospinning. A series of preliminary experiments were conducted to establish the optimal scaffolds fabrication process for the incorporation of MGHA nanoparticles into SF polymer. 3.1. Morphological and structural analysis According to the TEM observation in Fig. 1, the SF fibrous fibers with and without adding MGHA produced aggregates of different morphologies. It can be clearly observed that the SF samples had the homogeneous internal structure (Fig. 1a). The addition of MGHA in the electrospinning solution greatly influenced the morphology of the composite fibers. It is seen that in the high-magnification TEM images (Fig. 1(c–e)): the higher MGHA content is in the composite, the darker zone is. With the gradual increase of the MGHA content in the matrix, the nanoparticles tended to agglomerate at the outer surface layers of the composite fibers in some regions. The obtained composite mats exhibited a coarse polymer surface with nanoparticle protuberance (Fig. 1(b–e)), indicating that the MGHA were successfully introduced into SF polymer. Based on the high-resolution TEM observation, the MGHA nanoparticles in Fig. 1(c2–e2) illustrated the domains of typically stripe-like patterns, further confirming the one-dimensional cylindrical channels of hexagonal mesostructure. The result confirmed the presence of MGHA in the SF matrix, yielding a rough surface with nanoparticle protuberances. The FESEM observation in Fig. 2 shows that the different morphologies and structures of these electrospun mats with diameter sizes distributions before and after ethanol treatment. All the fibers overlapped to form a three-dimensional interconnected void between these fibers. These dimensions were similar to that of the native fibrous protein within ECM. The morphology of electrospun fibers from all concentrations exhibited ribbon-shaped with randomly oriented structure. The electrospun SF fibers showed the smooth morphology, while the surface became rougher after ethanol treatment. Besides, the surface structure of these composite fibers appeared to vary by the addition of the MGHA. Unlike SF fibers, rough surfaces were observed for 550

Fig. 2. FESEM images of electropsun SF, SF/MGHA1, SF/MGHA3, SF/MGHA5, and SF/MGHA7 before (a1–e1) and after (a3–e3) ethanol treatment and their relative fiber diameter distribution (a2–e2; a4–e4).

T. Liu et al.

Materials Science & Engineering C 94 (2019) 547–557

551

Materials Science & Engineering C 94 (2019) 547–557

T. Liu et al.

20% and 45%. Accordingly, the hydrophilicity of the electrospun fiber mats was investigated by measuring the water contact angle (WCA). The WCA and the water drops for pure SF and SF/MGHA are shown in Fig. 5. For pure SF mats, the initial WCA was 64.7° ± 0.3°, and then decreased to 38.1° ± 0.3° after 3 s. The SF/MGHA1 composites mats had an initial WCA of 62.7° ± 0.8°, which decreased to 31.7° ± 0.4° after 3 s. Also, the WCAs of the SF/MGHA3 and SF/MGHA5 mats were initially 61.8° ± 0.3° and 59.2° ± 1.7°, and after 3 s were 19.1° ± 0.7° and 9.2° ± 0.4°, respectively. And the WCAs of the SF/MGHA7 mats were decreased from 56.8° ± 1.8° initially to 10.8° ± 0.9° after 3 s. 3.2. Formation of apatite on the surfaces of the samples The bone-forming activity of these fibers in vitro was tested by observing the HA formation on the surface. Fig. 6 shows the representative FESEM images of SF and SF/MGHA scaffolds after soaking in SBF for 7 d. The micrographs revealed that the surface of the biocomposites exhibited ribbon-shaped with randomly oriented structure and the morphological changes upon SBF reaction. For SF samples, a few cauliflower granules were randomly scattered on the surface (Fig. 6a). With an increase in MGHA content, the number and size of such granules increased, and the evolution of the crystallites toward flower-shaped morphology became faster and denser. For SF/MGHA5 and SF/MGHA7 samples, these fibers on the surfaces were covered by the apatite layer with numerous sphere-like granules (Fig. 6(d, e)). The corresponding EDS analysis (Fig. 6(a5–e5)) also showed the Ca/P molar ratios of the as-immersed samples were gradually increasing and ranging from 1.41 to 1.65. And the Ca/P ratio for SF/MGHA7 samples was close to the value of hydroxyapatite (1.67). Meanwhile, the Ca/P ratio for the samples increased with the incorporation of MGHA content in the composite scaffolds. Combined with the changes in surface SEM observation and EDS analysis, it could be assumed that the deposition of apatite on the surface of the composite.

Fig. 3. FTIR spectra of electrospun composite fibers containing varying MGHA contents compared with ethanol-treated and untreated SF fibers.

3.3. Cell morphology and proliferation To reveal the cell adhesion to the surfaces of the scaffolds, the hMSCs were cultured on these scaffolds and then observed by FESEM for 1 d and 5 d after seeding (Fig. 7). After 1 d, the hMSCs were found to be attached and distributed on the surface of scaffolds. It was obvious that the cells exhibited round and spindle morphology on the surface of SF and SF/MGHA1 fibrous matrix, while most of the cells were distributed evenly to the inner of scaffolds with a spread out morphology on the SF/MGHA3, SF/MGHA5 and SF/MGHA7 matrices (Fig. 7(a2–e2)). There was plenty of hMSCs on SF/MGHA7 (Fig. 7(e1)), whereas only a few numbers of cells were observed on the pure SF scaffolds (Fig. 7(a1)). After 5 d, an increasing trend of cell growth in a time-dependent manner was observed in each group. The number and area of cells had increased significantly in all five types of scaffolds. The cells on the surfaces of these scaffolds spread well and exhibited a flattened appearance through filopodia attached to the underlying scaffolds. The attachment and proliferation rates of the hMSCs cells on the SF and SF/MGHA fibrous matrices were quantified using MTT assays. Based on the MTT assay (Fig. 8a), the significantly higher viability of hMSCs was observed in the SF/MGHA5 and SF/MGHA7 samples at each time point. However, no obvious difference between the SF/ MGHA5 and SF/MGHA7 scaffolds. In addition, significant differences were found at SF/MGHA3 sample at 1 d and 3 d (p < 0.05). Nonetheless, no significant differences were found in other samples.

Fig. 4. The representative stress−strain curves of SF and SF/MGHA mats before (a) and after (b) ethanol treatment.

state was measured to examine their mechanical properties. Before strength measurements, these electrospun fiber mats were cut and glued in tensile mode at a speed of 1 mm s−1 at constant room temperature. The typical tensile stress-strain curves of these scaffolds are shown in Fig. 4. All the scaffolds initially exhibited a linear increase in stress and then were significantly stretched with increasing strain, followed by a sudden stress drop. Regardless of MGHA additive, the tensile stress of the untreated SF and SF/MGHA scaffolds was below 2.5 MPa and their breaking strain was in the range of 20%–50%, while the tensile strength of the ethanol-treated scaffolds was obviously increased in the range from 2.9 to 4.0 MPa and the breaking strain was between

3.4. Cell differentiation Cell osteogenic differentiation was assessed by determining the ALP activity of hMSCs cultured on the above fibrous matrices respectively at 7 d and 14 d. As shown in Fig. 8b, all the scaffolds supported hMSCs 552

Materials Science & Engineering C 94 (2019) 547–557

T. Liu et al.

Fig. 5. Water contact angle and water droplets of pure SF and SF/MGHA mats.

Fig. 6. FESEM micrographs and EDS spectra of SF and SF/MGHA scaffolds after soaking in SBF for 7 d. Insets showing the Ca/P molar ratio of EDS spectra.

553

Materials Science & Engineering C 94 (2019) 547–557

T. Liu et al.

Fig. 7. FESEM micrographs for hMSCs attached on pure SF and SF/MGHA scaffolds.

activity level after 7 d and 14 d compared to pure SF group. Especially, the SF/MGHA7 group exhibited higher ALP activity than other four samples at each defined time point, but SF/MGHA7 groups compared with the SF/MGHA5 group was not significantly different at 7 d and 14 d. Meanwhile, the osteogenic gene expression of Col I, OCN and Runx2 were detected by RT-PCR after the induction of different days (Fig. 9). In all group, the osteogenesis-related genes such as Col I and OCN increased in a time-dependent manner. The Col I and OCN expression in the SF/MGHA5 and SF/MGHA7 groups were significantly higher than that in the SF group (p < 0.05, Fig. 9(a, b)), but there was no significant difference between the SF/MGHA5 and SF/MGHA7 group. The Runx 2 expression in the SF/MGHA3, SF/MGHA5 and SF/ MGHA7 groups were significantly higher than that in the SF/MGHA1 and SF groups. Especially, Runx 2 peaked at 7 days and decreased afterward in all groups (Fig. 9c). 4. Discussion The present study is designed to introduce new bioceramics–MGHA into SF scaffolds that replicated the natural ECM and serves as an optimal scaffold for cell proliferation and ultimately tissue formation. Differ from the bulk substrate, electrospun fibrous matrix is relatively simple and well established for the fabrication of micro- and nanoscale scaffolds with controllable pore size and porosity. The engineered electrospun structures display a high surface area for cell attachment and high porosity for improved cell infiltration and nutrient diffusion. In this study, the surface of the untreated electrospun SF fibers was smooth, when treated with ethanol the surface of the electrospun SF fiber became groove. Herein the structure of SF conformation from random coil to β-sheet structure was responsible for the observed micromorphology change in the ethanol treatment process. It was surprising to find that SF and SF/MGHA scaffolds exhibited ribbon-like morphology, which is different from other round-like fibers. Wang et al. [28] and Chen et al. [29] also observed the presence of ribbon-like fibers in the electrospun mats from all-aqueous regenerated silk fibroin

Fig. 8. The proliferation (a) and ALP activity (b) of hMSCs cultured on SF and SF/MGHA scaffolds. (The composite groups were compared against pure SF group, * indicates significant difference compared to SF group, p < 0.05.)

differentiation and the ALP activity of hMSCs cultured on the SF and SF/MGHA1 groups expressed low levels at 3 d. The SF/MGHA3, SF/ MGHA5, and SF/MGHA7 groups showed a significantly higher ALP 554

Materials Science & Engineering C 94 (2019) 547–557

T. Liu et al.

Fig. 9. The proliferation (a) and ALP activity (b) of hMSCs cultured on SF and SF/MGHA scaffolds. (a) Col I, (b) OCN, and (c) Runx 2. (The composite groups were compared against pure SF group, * indicates significant difference compared to SF group, p < 0.05.)

MGHA7 samples. Such distributed MGHAs would destroy the original structure of composite fibers due to the poor interfacial adhesion between the MGHA and the SF matrix, thereby influencing the mechanical properties of the composite mats. On the other hand, as for the secondary structure of SF, the characteristic vibrational bands for amide I and amide III gradually became narrow and shifted to low wavenumber with the increase of MGHA contents. Herein the curve-fitting was done in the amide I and amide III region to compare the effect of MGHA on the secondary structure of SF (Fig. S3). Their characteristic vibrational bands were influenced after mixing different MGHA contents. The curve-fitting results in the amide I band (Fig. S4) showed that SF/ MGHA fibers had relatively lower β-sheet content and random coil content than pure SF. And the β-sheet and β-turn contents in the composite mats showed downward trends after adding nanoparticle content into the SF matrix. For amide III group (Fig. S4), the concomitant decrease in the β-sheet contents was observed with increasing nanoparticle content. According to the FTIR analysis mentioned above, the variation occurred in tensile strength further confirmed the βstructure in the SF can affect tensile properties of silk-based composites. The change of structural characteristics observed might induce the decrease in the β-sheet content, thus directing low tensile strength when mixing SF with MGHA powders. As we know, the hydrophilic–hydrophobic property of the composites is important in the performance of a biomaterial in a biological environment, especially in cell attachment and tissue growth. It is reasonable to consider that such SF-based composites exhibit the hydrophilicity owing to the presence of the hydrophilic amino groups and carboxylic groups in the SF matrix. However, the SF/MGHA scaffolds displayed a decrease with the addition of MGHA contents in the measured static contact angle, suggesting better hydrophilicity than with pure SF fibrous mats. In this regard, the hydrophilicity was related to the MGHA texture in the composites. On one hand, MGHA nanoparticles with plenty of SieOH groups possessed well hydrophilic ability, and the increase of the MGHA component can improve the wettability of these composites. On the other hand, the coordinated effects from the mesoporous channels of MGHA and capillarity within the pores enhanced the contact angle of the composites scaffolds [34], in which water drop could penetrate into these pores gradually and then absorbed by the composite membrane. Conducting the content of MGHA provided an effective and simple method of controlling the microstructural and surface properties of these composite scaffolds, or on their ability to convert to HA in SBF in vitro. Apatite mineralization on scaffolds in SBF is favorable to form a chemical bond between the bioactive implant material and living bone when implanted [26]. Meanwhile, the apatite that forms on the surface of bioactive materials possesses the capacity to enhance the osteoblastic activity, including proliferation and differentiation [35]. In this work, the composite scaffolds induced extensive apatite-formation even for the same periods, which showed the higher bioactivity in contrast to SF sample. In addition, the apatite layer didn't destroy the fiber framework structure of the scaffolds, which gradually increased along with the

(RSF). One reason they pointed out was that the high viscosity of the highly concentrated RSF made the solution unstable and inhomogeneous, and induced the formation of ribbon-like fibers. On the other hand, Koombhongse et al. [30] considered that these ribbon fibers resulted from the presence of a thin, mechanically distinct polymer skin. After the skin formed, atmospheric pressure tended to collapse the tube formed by the skin as the solvent evaporated. When compared with these circular cross-section fibers, these incomplete fibers drying became elliptical, thus leading to the formation of ribbon-like (or flattened) fibers. Therefore, this phenomenon was related to incomplete evaporation of the solvent on the fiber surfaces, thereby causing the solidification and flatness of the obtained fibers on the aluminum foil. The diameters of the as-spun composite fibers were found to increase with the addition and increasing amounts of the nanoparticles. Based on the results, the composite scaffolds after doping the MGHA content possessed a larger fiber diameter compared with pure SF. Wutticharoenmongkol [31] found that the diameters of the electrospun fibers increased with the addition of increasing amounts of hydroxyapatite nanoparticles. Under the same solution concentrations, solution conductivity played an important role in determining the fiber diameter and distribution. In the case, SF is a typical amphiprotic macromolecule electrolyte composed of hydrophobic and hydrophilic blocks. The solution conductivity decreased with increasing MGHA additive (Fig. S2(b)), thereby indirectly decreasing SF content in the blend matrix. Thus, the decreased solution conductivity may further yield the high blend fiber diameter. Consequently, these blend fibers showed a higher average fiber diameter than pure SF fibers. As for the secondary structure of SF, the characteristic vibrational bands for amide I and amide III gradually became narrow and shifted to low wavenumber with the increase of MGHA contents. Besides, curvefitting was done in the amide I and amide III region to compare the effect of MGHA on the secondary structure of SF (Fig. S3). Their characteristic vibrational bands were influenced after mixing different MGHA contents. The curve-fitting results in the amide I band (Fig. S4) showed that SF/MGHA fibers had relatively lower β-sheet content and random coil content than pure SF. And the β-sheet and β-turn contents in the composite mats showed downward trends after adding nanoparticle content into the SF matrix. For amide III group (Fig. S4), the concomitant decrease in the β-sheet contents was observed with increasing nanoparticle content. Due to the ethanol treatment, an increase appeared in the tensile strength of all scaffolds. This phenomenon was related to the SF structure, indicating that the random coil conformation converted to βsheet conformation. However, the tensile strength and Young's modulus of the SF/MGHA mat weakened after the MGHA particles were blended. These mechanical behaviors had generally been observed in the fibrous composites of flexible yet weak the polymer matrix with the addition of nanoparticles [32,33]. The decreases in stiffness and strength were associated with the particle dispersion in the polymer. According to the above FESEM and TEM images, the agglomeration of MGHA particles in the SF matrix was found in the composite fibers, especially for SF/ 555

Materials Science & Engineering C 94 (2019) 547–557

T. Liu et al.

fiber axis. Lin [36] found that the incorporation of MG into a PCL nanofibrous matrix significantly enhanced its apatite-formation ability in SBF compared with a PCL nanofibrous matrix. Just as the mentioned above, MGHA with a high surface area in the biocomposites also contributed to the formation of more SieOH groups on the surface, thus inducing more bone-like mineral deposition on the SF/MGHA surface, confirmed by FTIR analyses. Moreover, the lower contact angle facilitated the penetration of the SBF solution into scaffolds, which improved bioactivity. Besides, based on the mechanism of apatite formation on silicate bioactive glass, SF/MGHA scaffolds may have released more Si and Ca ions to the SBF solution than SF scaffolds, whereas the Si content of MGHA was approximately 85%. The released Ca ions could get into the solution gradually and increase the local supersaturation of the SBF with respect to apatite, leading to the precipitation of the apatite on the sample surfaces. Once apatite nuclei were formed, they grew spontaneously by assembling the calcium, phosphate, and hydrogen carbonate ions from the surrounding fluid [37]. Therefore, the incorporation of MGHA into SF matrix may be a useful method to enhance the apatite mineralization of these biomaterials, which improved integration with the host bone. Besides their fast apatite-forming ability, the ideal substitute should be biocompatible with surrounding cells to possessed satisfactory bone formation between the implant and bone tissue. The cytocompatibility of the samples are investigated by analyzing the cell adhesion, proliferation and differentiation behaviors of hMSCs. After culturing on the samples, the hMSCs exhibited a well spreading and fusiform-shaped morphology under the FESEM and MTT assay, suggesting that the good cell viability of the samples. For osteogenic differentiation, phosphatase activity is associated with fully mature differentiating osteoblasts, which plays a key role in bone formation and mineralization. During osteogenic differentiation process, the expression of Runx 2 increased gradually to reach a peak and declined afterward. Indeed, Runx2 is recognized as a master regulator crucial for development and maturation of osteoblasts, which plays a pivotal role in the early stage of bone calcification [38]. The SF/MGHA5 and SF/MGHA7 samples significantly increased the expression of Col I and OCN in comparison with other three samples. However, there is no significant difference of osteogenic gene expression observed in the presence of SF/MGHA5 and SF/MGHA7. Results showed the SF/MGHA7 samples with the best crucial cell functions appeared to provide a good environment for hMSCs growth and differentiation. This phenomenon is related to the following two aspects: (i) the fibrous morphology when combined with the mesoporous architecture from MGHA may direct an additional dimension in aiding guided cell growth and spreading; (ii) the introduction of MGHA nanoparticles in the matrix played an important role in the enhancement of the adhesion and proliferation of hMSCs. Cellular behavior can be also influenced by the characteristics of material surfaces in vitro, such as material surface property, the chemical composition. For example, material surface roughness is an important factor for cell adhesion, proliferation and differentiation [39]. The FESEM images (Fig. 2) revealed that the formation of the groove on the surface is conducive to cell attachment. With the MGHA growing, the nanoparticles protuberance gradually increased on the fiber surfaces, resulting in the surface roughness was even greater. Besides, the introduction of MGHA into SF matrix could improve the hydrophilicity of composite scaffolds, which will improve the interactions between the composites and cells for eliciting controlled cellular adhesion and maintaining differentiated phenotypic expression [40]. Considering material composition, the presence of MGHA particles is important in assisting the biological response of cells due to the surface wettability and the dissolution of ions from bioceramics. In vitro studies confirmed that silicon and calcium released from the materials resulted in a significant up-regulation of osteoblast proliferation and gene expression [41,42]. Thus, the released Ca and Si ions from the glass framework can stimulate the metabolic activity, proliferation and differentiation of osteoblasts. By understanding these structural evolution and cell

response, multifunctional these scaffolds with the ability for loading and sustained delivery of antimicrobial agent has the potential as new biomaterials for preventing bone infection and simultaneously promoting bone regeneration. 5. Conclusion In the case of inorganic-organic biocomposites, the fibrous scaffolds were prepared with incorporating MGHA nanocomposite into silk matrix. After ethanol treatment, their physicochemical properties such as fiber diameter, surface hydrophilicity were improved by the decorating MGHA nanoparticles, whereas a decrease in tensile strength was observed. The variation of their bioactivity from these samples was influenced by the local addition of MGHA content owing to the material characteristic, especially the released Si and Ca ions. The cell culture medium from the SF/MGHA7 samples could significantly enhance cell activity and osteogenic differentiation of hMSCs. The results indicated that such scaffolds combined with hMSCs may be potentially utilized as effective grafts in bone tissue repair in vivo. Acknowledgments The authors thank Dr. X. Chen for assistance with cell studies, and Dr. Somia for assistance with English language editing. We acknowledge financial support from Zhejiang Provincial Natural Science Foundation of China (LY16E020012), Zhejiang Top Priority Discipline of Textile Science and Engineering (2015YXQN02), the Research Foundation of Zhejiang Sci-Tech University (15012081-Y, 16012056Y), the graduate innovation foundation of Zhejiang Sci-Tech University (11110131201716), and the innovation from Keyi College (KY2017010). Appendix A. Supplementary data FESEM image of the MGHA nanocomposite, small-angle and wideangle XRD patterns of the MGHA nanocomposite; Variation in average fiber diameter and solution conductivity of SF/MGHA blends scaffolds according to the MGHA content; Curve-fitting results of the FTIR in the amide I and amide III region for pure SF and SF/MGHA mats; Comparison of β-sheet and random coil/α-helix conformation contents in the amide I region and amide III region corresponding to the curvefitting results of FTIR spectra. Supplementary data to this article can be found online at https://doi.org/10.1016/j.msec.2018.09.063. References [1] R. Dimitriou, E. Jones, D. McGonagle, P.V. Giannoudis, Bone regeneration: current concepts and future directions, BMC Med. 9 (2011) 66. [2] H.W. Kim, V. Salih, Stimulation of osteoblast responses to biomimetic nanocomposites of gelatin-hydroxyapatite for tissue engineering scaffolds, Biomaterials 26 (2005) 5221–5230. [3] C. Gao, Q. Gao, Y. Li, M.N. Rahaman, A. Teramoto, K. Abe, In vitro evaluation of electrospun gelatin-bioactive glass hybrid scaffolds for bone regeneration, J. Appl. Polym. Sci. 127 (2013) 2588–2599. [4] J.M. Holzwartha, P.X. Ma, Biomimetic nanofibrous scaffolds for bone tissue engineering, Biomaterials 32 (2011) 9622–9629. [5] W.E. Teo, W. He, S. Ramakrishna, Electrospun scaffold tailored for tissue specific extracellular matrix, Biotechnol. J. 1 (2006) 918–929. [6] M. Rodríguez-Évora, E. García-Pizarro, C. del Rosario, J. Pérez-López, R. Reyes, A. Delgado, J.C. Rodríguez-Rey, C. Évora, Smurf1 knocked-down, mesenchymal stem cells and BMP-2 in an electrospun system for bone regeneration, Biomacromolecules 15 (2014) 1311–1322. [7] D. Newton, R. Mahajan, C. Ayres, J.R. Bowman, G.L. Bowlin, D.G. Simpson, Regulation of material properties in electrospun scaffolds: role of cross-linking and fiber tertiary structure, Acta Biomater. 5 (2009) 518–529. [8] T. Sun, D. Norton, R.J. McKean, K.W. Haycock, A.J. Ryan, S. MacNeil, Development of a 3D cell culture system for investigating cell interactions with electrospun fibers, Biotechnol. Bioeng. 97 (2007) 1318–1328. [9] R. Ravichandran, J.R. Venugopal, S. Sundarrajan, S. Mukherjee, S. Ramakrishna, Precipitation of nanohydroxyapatite on PLLA/PBLG/collagen nanofibrous structures for the differentiation of adipose-derived stem cells to osteogenic lineage,

556

Materials Science & Engineering C 94 (2019) 547–557

T. Liu et al.

[26] T. Kokubo, H. Takadama, How useful is SBF in predicting in vivo bone bioactivity? Biomaterials 27 (2006) 2907–2915. [27] H. Pan, Y.P. Zhang, H.L. Shao, X.C. Hu, X.H. Li, F. Tian, J. Wang, Nanoconfined crystallites toughen artificial silk, J. Mater. Chem. B 2 (2014) 1408–1414. [28] H. Wang, Y.P. Zhang, H.L. Shao, X.C. Hu, Electrospun ultra-fine silk fibroin fibers from aqueous solutions, J. Mater. Sci. 40 (2005) 5359–5363. [29] C. Chen, C.B. Cao, X.L. Ma, Y. Tang, H.S. Zhu, Preparation of non-woven mats from all-aqueous silk fibroin solution with electrospinning method, Polymer 47 (2006) 6322–6327. [30] S. Koombhongse, W.X. Liu, D.H. Reneker, Flat polymer ribbons and other shapes by electrospinning, J. Polym. Sci. B Polym. Phys. 39 (2001) 2598–2606. [31] P. Wutticharoenmongkol, N. Sanchavanakit, P. Pavasant, P. Supaphol, Preparation and characterization of novel bone scaffolds based on electrospun polycaprolactone fibers filled with nanoparticles, Macromol. Biosci. 6 (2006) 70–77. [32] A. El-Figi, J.H. Kim, H.W. Kim, Osteoinductive fibrous scaffolds of biopolymer/ mesoporous bioactive glass nanocarriers with excellent bioactivity and long-term delivery of osteogenic drug, ACS Appl. Mater. Interfaces 7 (2015) 1140–1152. [33] K.X. Qiu, C.L. He, W. Feng, W.Z. Wang, X.J. Zhou, Z.Q. Yin, L. Chen, H.S. Wang, X.M. Mo, Doxorubicin-loaded electrospun poly(L-lactic acid)/mesoporous silica nanoparticles composite nanofibers for potential postsurgical cancer treatment, J. Mater. Chem. B 1 (2013) 4601–4611. [34] X. Li, J. Shi, X. Dong, L. Zhang, H. Zeng, A mesoporous bioactive glass/polycaprolactone composite scaffold and its bioactivity behavior, J. Biomed. Mater. Res. A 84 (2008) 84–91. [35] S.Y. Ni, X.H. Li, P.G. Yang, S.R. Ni, F. Hong, T.J. Webster, Enhanced apatite-forming ability and antibacterial activity of porous anodic alumina embedded with CaO–SiO2–Ag2O bioactive materials, Mater. Sci. Eng. C 58 (2016) 700–708. [36] H. Lin, Y. Lin, F. Hsu, Preparation and characterization of mesoporous bioactive glass/polycaprolactone nanofibrous matrix for bone tissues engineering, J. Mater. Sci. Mater. Med. 23 (2012) 2619–2630. [37] Y. Zhang, X. Wang, Y.L. Su, D.Y. Chen, W.X. Zhong, A doxorubicin delivery system: samarium/mesoporous bioactive glass/alginate composite microspheres, Mater. Sci. Eng. C 67 (2016) 205–213. [38] A. Rutkovskiy, K.O. Stensløkken, I.J. Vaage, Osteoblast differentiation at a glance, Med. Sci. Monit. Basic Res. 22 (2016) 95–106. [39] C. Choong, S. Yuan, E.S. Thian, A. Oyane, J. Triffitt, Optimization of poly(ε-caprolactone) surface properties for apatite formation and improved osteogenic stimulation, J. Biomed. Mater. Res. A 100 (2012) 353–361. [40] P.B. Wachem, T. Beugeling, J. Feijen, A. Bantjes, J.P. Detmers, W.G. van Aken, Interaction of cultured human endothelial cells with polymeric surfaces of different wettabilities, Biomaterials 6 (1985) 403–408. [41] P. Valerio, M.M. Pereira, A.M. Goes, M.F. Leite, The effect of ionic products from bioactive glass dissolution on osteoblast proliferation and collagen production, Biomaterials 25 (2004) 2941–2948. [42] C. Wu, Y. Ramaswamy, Y. Zhu, R. Zheng, R. Appleyard, A. Howard, H. Zreiqat, The effect of mesoporous bioactive glass on the physiochemical, biological and drugrelease properties of poly(DL-lactide-co-glycolide) films, Biomaterials 30 (2009) 2199–2208.

Biomaterials 33 (2012) 846–855. [10] C. Gandhimathi, J. Venugopal, R. Ravichandran, S. Sundarrajan, S. Suganya, Ramakrishna, Mimicking nanofibrous hybrid bone substitute for mesenchymal stem cells differentiation into osteogenesis, Macromol. Biosci. 13 (2013) 696–706. [11] F.J. O'Brien, Biomaterials & scaffolds for tissue engineering, Mater. Today 14 (2011) 88–95. [12] A. Hoppe, N.S. Guldal, A.R. Boccaccini, A review of the biological response to ionic dissolution products from bioactive glasses and glass-ceramics, Biomaterials 32 (2011) 2757–2774. [13] S. Maeno, Y. Niki, H. Matsumoto, H. Morioka, T. Yatabe, A. Funayama, Y. Toyama, T. Taguchi, J. Tanaka, The effect of calcium ion concentration on osteoblast viability, proliferation and differentiation in monolayer and 3D culture, Biomaterials 26 (2005) 4847–4855. [14] L.L. Hench, R.J. Splinter, W.C. Allen, T.K. Greenlee, Bonding mechanism at the interface of ceramic prosthetic materials, J. Biomed. Mater. Res. 5 (1971) 117–141. [15] A. El-Fiqi, T.H. Kim, M. Kim, M. Eltohamy, J.E. Won, E.J. Lee, H.W. Kim, Capacity of mesoporous bioactive glass nanoparticles to deliver therapeutic molecules, Nanoscale 4 (2012) 7475–7488. [16] D. Jagadeesan, C. Deepak, K. Siva, M. Eswara-Moorthy, Carbon spheres assisted synthesis of porous bioactive glass containing hydroxycarbonate apatite nanocrystals: a material with high in vitro bioactivity, J. Phys. Chem. C 112 (2008) 7379–7384. [17] M. Cicuéndez, M.T. Portolés, I. Izquierdo-Barba, M. Vallet-Regí, New nanocomposite system with nanocrystalline apatite embedded into mesoporous bioactive glass, Chem. Mater. 24 (2012) 1100–1106. [18] T. Liu, D. Lai, X. Feng, H. Zhu, J. Chen, Carbon sphere influence on textural properties and bioactivity of mesoporous bioactive glass/hydroxyapatite nanocomposite, Ceram. Int. 30 (2013) 3947–3956. [19] T. Liu, X. Ding, X. Yang, Z. Gou, J. Chen, X. Feng, Effect of carbonization treatment on the morphology and microstructure of mesoporous bioactive glass/nanocrystalline hydroxyapatite nanocomposite, J. Non-Cryst. Solids 389 (2014) 104–112. [20] M. Cicuéndez, M. Malmsten, J. Doadrio, M.T. Portolés, I. Izquierdo-Barba, M. Vallet-Regí, Tailoring hierarchical meso–macroporous 3D scaffolds: from nano to macro, J. Mater. Chem. B 2 (2014) 49–58. [21] H.L. Zhu, N. Liu, X.X. Feng, J.Y. Chen, Fabrication and characterization of silk fibroin/bioactive glass composite films, Mater. Sci. Eng. C 32 (2012) 822–829. [22] T. Liu, X.B. Ding, D.Z. Lai, Y. Chen, R. Zhang, J. Chen, X. Feng, X. Chen, X. Yang, R. Zhao, K. Chen, X. Kong, Enhancing in vitro bioactivity and in vivo osteogenesis of organic–inorganic nanofibrous biocomposites with novel bioceramics, J. Mater. Chem. B 2 (2014) 6293–6305. [23] R.L. Horan, K. Antle, A.L. Collette, Y.Z. Wang, J. Huang, J.E. Moreau, V. Volloch, D.L. Kaplan, G.H. Altman, In vitro degradation of silk fibroin, Biomaterials 26 (2005) 3385–3393. [24] C. Li, C. Vepari, H. Jin, H.J. Kim, D.L. Kaplan, Electrospun silk-BMP-2 scaffolds for bone tissue engineering, Biomaterials 27 (2006) 3115–3124. [25] T. Liu, D. Lai, X. Feng, H. Zhu, J. Chen, Synthesis and characterization of a novel mesoporous bioactive glass/hydroxyapatite nanocomposite, Mater. Lett. 92 (2013) 444–447.

557