- Email: [email protected]
Biophysical and molecular docking studies of naphthoquinone derivatives on the ATPase domain of human Topoisomerase II
Biomedicine & Pharmacotherapy 67 (2013) 122–128
Available online at
www.sciencedirect.com
Original article
Biophysical and molecular docking studies of naphthoquinone derivatives on the ATPase domain of human Topoisomerase II Nonlawat Boonyalai a,*,c, Pichamon Sittikul a,c, Narathip Pradidphol b,c, Ngampong Kongkathip b,c a
Department of Biochemistry, Faculty of Science, Kasetsart University, 50, Phahon Yothin road, Chatuchak, 10900 Bangkok, Thailand Natural Products and Organic Synthesis Research Unit (NPOS), Department of Chemistry, Faculty of Science, Kasetsart University, Chatuchak, 10900 Bangkok, Thailand c Center of Excellence for Innovation in Chemistry, Faculty of Science, Kasetsart University, Chatuchak, 10900 Bangkok, Thailand b
A R T I C L E I N F O
A B S T R A C T
Article history: Received 2 August 2012 Accepted 26 August 2012
Numerous naphthoquinone derivatives, such as rhinacanthins function as anticancer drugs, which target hTopoII. The structure of hTopoII contains both an ATPase domain and a DNA binding domain. Several drugs bind to either one or both of these domains, thus modifying the activity of hTopoII. The naphthoquinone esters and amides used in this study showed that their hTopoIIa inhibitory activity was inversely proportional to ATP concentration. In order to better characterize the inhibitory action of these compounds, sufficient quantities of soluble functional hTopoII-ATPase domain were required. Therefore, both the alpha and beta isoforms of the hTopoII-ATPase domain were over-expressed in Escherichia coli. The hTopoIIa-ATPase activity was reduced in the presence of naphthoquinone derivatives. Additionally, a molecular docking study revealed that the selected naphthoquinone ester and amide bind to the ATPbinding domain of hTopoIIa. Collectively, the results here provide for the first time a novel insight into the interaction between naphthoquinone esters and amides, and the ATP-binding domain of hTopoIIa. The further elucidation of the mechanism of action of the naphthoquinone esters and amides inhibitory activity is essential. ß 2012 Elsevier Masson SAS. All rights reserved.
Keywords: Naphthoquinones Rhinacanthins Topoisomerase II
1. Introduction DNA topoisomerases are necessary and ubiquitous enzymes involved in chromosome condensation and segregation, and in regulating intracellular DNA supercoiling [1,2]. DNA topoisomerases can be classified into two types, Type I and Type II topoisomerases. Type I topoisomerases (TopoI) act by generating a transient single-stranded break in the DNA double helix, followed by either a single-stranded DNA passage event or the controlled rotation about the break, whilst Type II topoisomerases (TopoII) catalyze DNA topological changes by breaking both strands of the double helix and transporting another double-stranded DNA segment through the break and then reannealing the break. TopoI enzymes are involved in all DNA processes and play an important role in maintaining genomic integrity [3,4]. TopoII enzymes on the other hand play essential roles in DNA transaction in vivo, Abbreviations: ATP, adenosine 50 -triphosphate; EDTA, Ethylenediaminetetraacetic acid; ICRF-187, (S)-4,40 -(1-methyl-1,2, ethanediyl)bis-2,6-piperazinedione; IPTG, isopropyl-b-D-thiogalactopyranoside; NADH, b-nicotinamide adenine dinucleotide; PK/LDH couple assay, pyruvate kinase/lactate dehydrogenase couple assay; hTopoII, human topoisomerase II; SDS-PAGE, sodium dodecyl sulphate-polyacrylamide gel electrophoresis; Tris-Cl, Tris (hydroxymethyl) amino methane. * Corresponding author. Tel.: +66 2 5625555 ext 2048; fax: +66 2 561 4627. E-mail address: [email protected] (N. Boonyalai). 0753-3322/$ – see front matter ß 2012 Elsevier Masson SAS. All rights reserved. http://dx.doi.org/10.1016/j.biopha.2012.08.005
including chromosome condensation and segregation, and the removal of the supercoils generated during replication and transcription [5]. In addition to such essential functions in the cell, TopoII enzymes have become important targets of many widely used antibiotics and antitumor drugs [6–8]. For instance, eukaryotic Type II topoisomerases are targets of anticancer drugs [9]. These enzymes are homodimers with some variability in molecular weights. For example, the enzyme from Saccharomyces cerevisiae has a monomer molecular mass of 164 kDa [5] while the two isoforms of the human enzyme, a and b, are 170 and 180 kDa, respectively [10]. Topoisomerase-targeting anticancer drugs can be divided into two broad classes that vary widely in their mechanisms of action [9]. Within Class I drugs or ‘‘TopoII poisons’’ two main types exist: the first increases levels of enzyme – DNA cleavage complexes by interacting with TopoII at the protein – DNA interface in a non-covalent manner and the second acts by covalently modifying the enzyme. These drugs act by stabilizing covalent topoisomerase-DNA complexes, which are the intermediates during the catalytic cycle of the enzyme. Although this type of inhibitor has been used in cancer therapy for many years, it is very toxic to normally dividing cells and shows a narrow therapeutic window [11]. Unlike Class I inhibitors, Class II drugs or ‘‘catalytic topoisomerase inhibitors’’ interfere with the catalytic function of the enzyme without trapping the covalent complex. Catalytic TopoII inhibitors are a heterogeneous group of
N. Boonyalai et al. / Biomedicine & Pharmacotherapy 67 (2013) 122–128
compounds that might interfere with the binding between DNA and TopoII, stabilize non-covalent DNA TopoII complexes or inhibit ATP-binding. Rhinacanthins are naphthoquinone ester derivatives isolated from the methanolic extract of the roots of the medicinal plant Rhinacanthus nasutus (Acanthaceae) [12–14]. In Thailand, the roots and leaves of the plant have been incorporated in Thai traditional medicine for treatment of several diseases including cancer and inflammation [15]. Some of the naphthoquinone derivatives showed potent antiallergic activity against antigeninduced b-hexosaminidase release [16,17]. Additionally, these compounds exhibited cytotoxicities against the human carcinoma cell lines, KB, HeLa and HepG2 [18]. Based on the cytotoxicity results, all naphthoquinone esters containing an –OH group at C-3 of the naphthoquinone ring (Fig. 1) showed high toxicity against the said cancer cell lines, while those with a methoxy group or without the –OH group displayed no activity or were much less cytotoxic [18]. Naphthoquinone naphthoate esters with an–OH group at 2position of the naphthalene moiety (e.g., Rhinacanthin-N [Rhi-N]) were significantly more cytotoxic than those with –OMe (e.g., Rhinacanthin-Q, [Rhi-Q]) or without –OH group (e.g., NKPSL4 [18]). Additionally, naphthoquinone naphthoate esters exhibited greater cytotoxicity than naphthoquinone benzoate esters. This structureactivity relationship demonstrates that the scaffold of Rhi-N can be used to develop novel anticancer agents as also confirmed by Sharma et al. (2008) [19]. Some of the naphthoquinones such as 1, 2-naphthoquinone and 1, 4-naphthoquinone are potent inducers of the TopoII-DNA ‘‘cleavable complex’’, which leads to the inhibition of TopoII activity [20–23], whereas Rhi-N and Rhi-Q interfere with DNA relaxation of yeast TopoII [18]. Other naphthoquinones such as b-lapachone have been reported to inhibit against various cancers cell lines in vitro and also inhibit the activity of TopoI and induce TopoIIa-mediated DNA strand breaks [23]. Recently, novel naphthoquinone esters containing cyclopentyl and cyclohexyl substituents at C-2´of the propyl chain exhibited relatively good cytotoxicities towards cancer cells but much less cytotoxicities towards Vero cells compared to the naphthoquinone esters with 20 ,20 -dimethyl group (such as Rhi M, RhiN, RhiQ and NKPSL4) [24]. In addition to naphthoquinone esters, the biological activity of novel naphthoquinone amides has been evaluated [25]. Even though, most of naphthoquinone amides showed moderate cytotoxicity towards tested cancer cell lines, they exhibited weak toxicity against normal Vero cell lines and much less toxic than the previous naphthoquinone esters. In this study, we report a biophysical approach to investigate the effect of naphthoquinone derivatives on the ATPase domain of hTopoII. The presence of the compounds moderately inhibits the ATPase activity of the protein. Using the molecular docking approach, the structures of the ligands-protein-complex were examined. The results reported here can lead to the development
123
of further novel naphthoquinone derivatives which act as hTopoIIa ATPase inhibitors. 2. Materials and methods 2.1. Materials Buffer A contained 50 mM Tris-Cl pH 8, 0.5 M NaCl, 5 mM imidazole. Buffer B contained 20 mM Tris-Cl, pH 8, 50 mM NaCl. The plasmid miniprep kit was purchased from Fermentas (EU). The primers were synthesized by Bio Basic INC. The HiTrap Chelating HP column was purchased from GE Healthcare (Thailand). ATP, NADH, phosphoenolpyruvate, pyruvate kinase and lactate dehydrogenase were purchased from Sigma (USA). The other chemicals are analytical reagent grade. Naphthoquinone compounds were synthesized according to Kongkathip, et al. [18] and Pradidphol, et al. [25]. 2.2. Plasmid construction The gene encoding ATPase region of hTopoIIa (residues 29-428) and hTopoIIb (residues 45-444) was amplified from plasmids pCM1 and YEPTOP2, respectively (gifts from Prof. Osheroff, N, Vanderbilt University School of Medicine, USA) in a polymerase chain reaction using synthetic primers: F_hTopoIIA_29, 50 GAGCAGCTAGCTCTGTTGAAAGAATCTATCAAAAG 30 ; R_hTopoIIA_428, 50 GTCGGCCTCGAGTTATGAACACTTCTTGTTTAACTG 30 , F_hTopoIIB_45, 50 GAGCAGCTAGCTCTGTTGAGAGAGTGTATCAG 30 and R_hTopoIIB_444, 50 GTCGGCCTCGAGTTATGAACACTTCTTATTC 30 . The resulting NheI/XhoI fragment was subcloned into NheI/XhoI sites of the pET28b-expression vector (Novagen) yielding a fusion protein of 400 amino acids with N-terminal His-tags (6x His). The sequence of a positive clone containing the hTopoII-ATPase insert was determined in its entirety to ensure that no mutations had been introduced during the polymerase chain reaction. 2.3. Expression and purification of ATPase domain Plasmids pET28b-hTIIa-ATPase and pET28b- hTIIb-ATPaseconstructed as described above were used to express the recombinant ATPase domain of hTopoII. Expression and purification of the enzymes was adapted from [26]. In brief, the expression of hTopoII-ATPase was carried out in Escherichia coli BL21 (DE3) cells. Cells were grown at 37 8C to an optical density of 0.6 at 600 nm in LB broth containing 50 mg/ml kanamycin and then induced with 1 mM IPTG overnight at 30 8C. After expression, the cells were harvested by centrifugation, resuspended in buffer A and lysed by sonication. The fusion protein was purified by HiTrap Chelating HP column attached to HPLC. The protein was eluted by increasing concentration of imidazole and analyzed by 12% SDS-PAGE. Fractions containing the ATPase protein were dialyzed in buffer B. Protein concentration was determined by the BCA protein assay (PIERCE) using BSA as a standard protein.
Fig. 1. Chemical structures of naphthoquinone compounds used in this study.
124
N. Boonyalai et al. / Biomedicine & Pharmacotherapy 67 (2013) 122–128
2.4. Topoisomerase assay Human Topoisomerase IIa activity was determined using Topisomerase II assay kit (TopGEN Inc.). The reaction mixture containing 60 ng of kintoplast DNA (kDNA) and two units of hTopoIIa was incubated with and without naphthoquinone aromatic amide, compound 43 at 37 8C for 1 h in complete assay buffer (50 mM Tris-Cl pH 8.0, 150 mM NaCl, 10 mM MgCl2, 0.5 mM dithiothreitol, and various concentrations of ATP). Doxorubicin was used as a positive control while decatenated and linearized kDNA were used as markers. The reaction in a final volume of 20 ml was stopped by adding stop buffer/gel loading dye (1% Sarkosyl, 0.025% bromophenol blue and 5% glycerol). Reaction products were run on 1% agarose gel in 0.5x TBE buffer with 0.5 mg/ml ethidium bromide included in the gel. Electrophoresis was performed at 50 V for 1.30 h. After electrophoresis, the gel was destained with distilled water for 30 min and photographed over a UV transilluminator using DNr Bio-Imaging system. One unit of Topoisomerase II is defined as the amount of enzyme that decatenates 0.2 mg of kDNA in 30 min at 37 8C. 2.5. Fluorescence binding study Interaction studies between the ATPase proteins and ligands were carried out by monitoring the intrinsic fluorescent intensity of tryptophan residues. A fluorescence titration method was performed by adding microliter amounts of the ligands to 400 ml of 5 mM ATPase protein in buffer B containing 5 mM ATP. The excitation wavelength of 295 nm was used and the fluorescence emission spectra were recorded between 315–400 nm and the maximal emission peak at 340 nm was determined. Titration results were corrected to account for ligand dilution. Data were plotted as DFmax (the maximum attainable change in fluorescence intensity) at 340 nm versus the concentration of cofactors. Fitting of the direct plot by non-linear regression with single binding site equation allowed the estimation of Kd values [27] using the Microcal Origin 6.0 program. 2.6. ATPase assay To ascertain the ATPase activity, ATPase measurement was carried out by the PK/LDH couple assay described previously with some modifications [28]. The reaction mixture of 200 ml contained 10 mM Tris-Cl pH 7.5, 50 mM NaCl, 50 mM KCl, 5 MgCl2, 0.1 mM NADH, 2 mM phosphoenolpyruvate, 3 units of pyruvate kinase, four units of lactate dehydrogenase and various concentrations of ATP. Both ATP and the reaction mixture were pre-equilibrated at 30 8C for 5 min before the measurement. Finally, 0.1 mM of the enzyme was added into the reaction mixture. The decrease in NADH, which was directly proportional to the rate of ATP hydrolysis, was monitored by measuring the absorbance at 340 nm in a microplate reader spectrophotometer (Sunrise-basic TECAN). In order to determine the inhibition of ATPase activity by the naphthoquinone compounds, 50 mM of the compounds were added to each reaction mixture and pre-equilibrated at 30 8C for 5 min before the measurement. All assays were performed in triplicate. 2.7. Molecular docking analysis To better understand how the ligands bind to the enzyme, molecular docking analysis was performed. The crystal structure of ATPase domain of human TopoIIa was obtained from the protein data bank (pdb code 1ZXM) [29]. The structures of rhinacanthin-N and compound 43 were built using Sybyl 7.3 program (Tripos Associates, St. Louis, MO. USA). Docking analysis was performed
with Autodock 4.0 program [30]. The grid was chosen to be sufficiently large to include the ATP-binding site as a whole with spacing of 0.375 A˚ and a grid size of 60 60 60 points along the x, y and z axes. The center of the ligands was positioned at the grid center. The search parameter used was Lamarckian Genetic Algorithm (LGA) with 100 runs. The population size was set at 150 and the number of energy evaluations was 2.5 million. Three dimensional structures and molecular surfaces of hTopoIIaATPase-naphthoquinone compounds with the best-docked conformation were visualized and analyzed by PyMOL (Delano, W.L. The PyMOL Molecular Graphic System, Delano Scientific, San Carlos, CA, USA; 2002 http://www.pymol.org).
3. Results 3.1. Human Topoisomerase IIa inhibitory activity Naphthoquinone ester derivatives have been reported to be able to inhibit the DNA relaxation activity of TopoII [18]. Despite rhinacanthins being suggested to be able to interact with the DNA binding domain, it cannot be ruled out that they also interact with the ATPase domain. Expoxide ring-opened xanthone derivatives, for instance, have shown ATPase inhibitory activity inversely proportionally to ATP concentration [31]. Therefore, it would be of interest to determine if the inhibitory action of naphthoquinone compounds on DNA relaxation is also proportional to ATP concentration. In Topoisomerase II assay, compound 43 (a napthoquione amide analog to Rhi-N) was chosen (Fig. 1). Recently, naphthoquinone aromatic amides also attract our interests due to their stability towards the hydrolysis. Therefore, a series of naphthoquinone aromatic amide were synthesized and their cytotoxicities against cancer cell lines and Vero cells were tested [25]. The decatenation assay was used to determine the inhibitory activity of compound 43 and hTopoIIa. The enzyme catalyzes the ATP-dependent decatenation of long-chained, catenated DNA molecules into free relaxed and supercoiled forms [32]. As seen on Fig. 2, compound 43 exhibited strong hTopoIIa inhibitory activity in the presence of 2 mM ATP. However, when ATP concentrations increased, hTopoIIa inhibitory activity of compound 43 reduced. It is likely that the tested compound compete with ATP. To further explore the role of naphthoquinone derivatives as inhibitors of the ATP hydrolysis needed for the complete catalytic cycle of hTopoII, attempts were made to recombinantly express and purify to homogeneity the ATPase domains of both hTopoIIa and hTopoIIb. The recombinant domains were subsequently used in ligand-binding and ATPase assays. 3.2. Expression and characterization of hTopoII-ATPase To further examine the inhibition of ATPase activity by naphthoquinone derivatives, the ATPase domains of both hTopoIIa and hTopoII b were cloned into a pET28b-expression vector. Both recombinant ATPase proteins were expressed in E. coli BL21 (DE3) cells and purified from the soluble protein fraction by His-tag affinity chromatography. Only small amounts of the recombinant hTopoIIb-ATPase protein were expressed in soluble form, while sufficient amounts of purified recombinant hTopoIIa-ATPase protein were obtained (Fig. 3A) which were further used for enzymatic activity assays. To investigate the biochemical properties of hTopoIIa-ATPase protein, the ATPase activity of the ATPase protein was quantified by a PK/LDH coupled assay. As a function of the ATP concentration, the rate of ATP hydrolysis by the ATPase protein shows a hyperbolic dependence (Fig. 3B), indicative of Michaelis-Menten kinetics. The Km and kcat (0.5 0.1 mM and 0.8 s1) were determined from this data. These results were comparable
N. Boonyalai et al. / Biomedicine & Pharmacotherapy 67 (2013) 122–128
125
Fig. 2. Topoisomerase IIa inhibitory activity of naphthoquinone aromatic amide 43. The compound was examined in final concentration of 50 mM. Lanes K: kDNA only, Lane D: decatenated kDNA only, Lane T: kDNA + hTopoIIa, Lanes 43: kDNA + hTopoIIa + compound 43. The concentrations of ATP used in each reaction are indicated above each lane. Catenated kDNA does not migrate out of the loading wells.
with the previous reports (Km and kcat of 0.47 mM and 0.018 s1 [33] and of 0.35 mM and 0.02 s1 [34] in the absence of DNA). 3.3. Binding of naphthoquinone compounds on the ATPase domain of hTopoIIa A binding assay based on changes in the intrinsic tryptophan fluorescence of the hTopoIIa-ATPase domain upon titration of the naphthoquinone compound ligands was used to determine the affinity of the protein and ligand. Excitation of the protein at 295 nm resulted in a single emission peak at about 340 nm indicating the characteristic of a class II tryptophan residue in which a tryptophan residue is partially exposed at the surface of the protein [35]. The crystal structure of the protein [29] shows that there are clusters of tryptophan residues around the ATPbinding site (W62, W119, W194, W297 and W361); hence, these tryptophan residues may be used as probes to monitor any structural change upon the ligand-binding event. In this experiment eight naphthoquinone compounds (four esters and four amides) were used. Addition of the ligand to a 5 mM ATP protein solution resulted in fluorescence quenching, with 70 micromolar ligand producing a 70% reduction in the emission spectra. This quenching may be accounted for either by ring stacking of the indole ring of a tryptophan with the aromatic rings of the ligand or Fo¨rster energy transfer from the tryptophan residues to the bound ligand [36]. Table 1 summarizes the dissociation constant (Kd) values between hTopoIIa-ATPase protein and the ligands. It can be seen that Kd values of naphthoquinone amides are slight higher than those of naphthoquinone esters. Compound 23 binds to the protein with 2-fold less affinity compared to napthoquinone ester analog. This correlated with the previous cytotoxicity study that napthoquinone esters are slightly more active than naphthoquinone amides [25]. It should be noted that the binding affinity between these compounds and hTopoIIa-ATPase protein can still be observed in the presence of 5 mM ATP, indicating that the naphthoquinone compounds may function as competitive inhibitors. 3.4. Effect of naphthoquinone compounds on hTopoIIa-ATPase Etoposide has been proposed to bind both to the N-terminal domain and the core domain of TopoII without eliminating ATPbinding [37]. STD-NMR experiment has also revealed that the
binding of etoposide to human TopoIIa is driven by the interactions with the A-ring and the B-ring and by stacking interactions with the E-ring of the etoposide [38]. Etoposide can inhibit the rate of either the first ADP release or the hydrolysis of the second ATP [39]. Unlike etoposide, bisdioxopiperazines such as ICRF-187 have been found to bridge and stabilize a transient dimer interface between two ATPase domains but does not compete with the ATP-binding [26]. The multiple mutations both in the Nterminal domain and the core domain can cause resistance to bisdioxopiperazines [26]. Bisdioxopiperazine derivatives such as ICRF-193 do not significantly inhibit ATPase hydrolysis of the 52 kDa of human TopoII. Based on our fluorescence binding study, the inhibition activity of naphthoquinone compounds towards ATPase protein was next examined by ATPase assay in the absence of DNA. Fig. 3C shows the ATPase activity of hTopoIIa-ATPase protein in the absence and presence of naphthoquinone compounds. At 2 mM ATP, the tested naphthoquinone compounds can interfere at varying degree with ATPase activity of ATPase domain of hTopoIIa but the naphthoquinone aromatic esters seemed to inhibit ATPase activity slightly more than the naphthoquinone aromatic amides. 3.5. Molecular docking of naphthoquinone derivatives and hTopoIIaATPase To visualize how the ligands position in hTopoIIa-ATPase and to examine the binding mode of the naphthoquinone compounds, molecular docking studies were carried out for Rhi-N and compound 43 with ATP-binding domain of hTopoIIa using the Autodock 4.0 program. The docking analysis showed that the compounds fit into the ATP-binding site. The position of the naphthoquinone ring in both compounds aligns with the phosphate backbone of ATP but only the naphthalene moiety of rhinacanthin-N overlaps well with the purine ring of ATP (Fig. 4A and B). Fig. 4C and D represent the arrangement of the naphthoquinone compounds in the binding pocket. Both Rhi-N and compound 43 are surrounded by hydrophobic amino acid residues such as I125, F142 and L140 for naphthalene moiety, and small polar uncharged amino acid residues such as S148, S149 and N150 for naphthoquinone ring. In Rhi-N-ATPase complex, the NH side chain of N150 forms a bifurcated-hydrogen bond with the C1-carbonyl of the naphthoquinone ring, whereas in the Compound 43-ATPase
126
N. Boonyalai et al. / Biomedicine & Pharmacotherapy 67 (2013) 122–128
Fig. 3. Protein characterization. (A) Purification of hTopoIIa-ATPase protein on 12% SDS-PAGE. Lane M, molecular mass standard (Fermentas); Lane 1, 45 kDa protein purified through a Ni2+-NTA column. The gel was stained by coomassie blue. (B) Dependence of hydrolysis rate of the hTopoIIa-ATPase protein on ATP concentration at constant enzyme concentration (0.1 mM). The Km was calculated by the Michaelis-Menten plot using the Microcal Origin 6.0 program. (C) ATPase activity of hTopoIIa-ATPase in the presence of naphthoquinone compounds. The ATPase activity was measured at 2 mM ATP, 50 mM naphthoquinone compounds with 0.1 mM of hTopoIIa-ATPase in the absence of DNA. The data shown are means S.D. for three independent experiments.
complex, two types of hydrogen bonds are observed: a typical hydrogen bond between the NH side chain of N150 and C4carbonyl of the naphthoquinone ring and a bifurcated hydrogen bond between C3-OH of the naphthoquinone ring and OH side chain S149 and main chain O of S148. It is important to note that compound 43 shows the existence of close contact with shorter hydrogen bonds to the naphthoquinone moiety than Rhi-N. These observed hydrogen bond networks have been seen in the Table 1 Dissociation constants (Kds). The Kd values were obtained from the fluorescence binding studies in the presence of 5 mM ATP. Naphthoquinone esters
Kd (mM)
Naphthoquinone amides
Kd (mM)
Rhi-N Rhi-Q Rhi-M NKPSL4
23 2 22 1 37 4 23 2
Compound Compound Compound Compound
30 3 26 4 50 7 45 4
43 45 21 23
interaction between xanthone analogs and ATP-binding domain of hTopoIIa [31]. Interestingly, the arrangement of Rhi-N in the ATP-binding site is similar to that of xanthone analogs [31]. The hydrogen bond interaction with S149 is also observed in the purine scaffold derivative [40]. According to the structure of hTopoIIa-ATPase–AMPPNP complex, the adenine ring is held through hydrogen bonding to a side chain carbonyl of N120 and S148 donates a hydrogen bond to the b-phosphate [29]. However, the key catalytic general base, D87, is not observed as a part of the interaction between naphthoquinone compounds and the protein. Since the ATP hydrolysis assay showed neither naphthoquinone compounds dramatically inhibit the ATPase activity, other mechanisms in addition to binding to the ATPase domain may exist. The molecular docking here can provide an insight for a new design of the novel naphthoquinone compounds in order to improve the binding affinity of the compounds and to compete effectively with ATP.
N. Boonyalai et al. / Biomedicine & Pharmacotherapy 67 (2013) 122–128
127
Fig. 4. Overlay structure of AMP-PNP and Rhi-N (A) and compound 43 (B) in ATPase domain of hTopoIIa. The molecules are shown in stick and colored by elements (carbon: light pink for Rhi-N, violet for compound 43 and yellow for AMP-PNP; oxygen: red; hydrogen: white, nitrogen: blue and phosphate: orange). (C) and (D) are view of Rhi-N and compound 43 in ATPase domain of hTopoII(, respectively. The amino acids involved in the interaction of rhinacanthins are depicted in stick representation and colored by elements (carbon: blue slate; oxygen: red; hydrogen: white and nitrogen: blue). The dotted red lines represent the hydrogen bonding interaction.
4. Discussion This paper reports the effect of naphthoquinone derivatives as potential Topoisomerase II inhibitors. Naphthoquinone aromatic esters and amides have been tested against cancer cell lines showing potent cytotoxicities. In this report, a selected compound 43 exhibited hTopoIIa inhibition when 2 mM ATP was present. The ATP competition assay revealed that the inhibition of hTopoIIa by compound 43 was inversely proportional to the ATP concentration. This has led to the further study on hTopoII-ATPase domain. Attempts were made for protein expression of both hTopoIIaATPase and hTopoIIb-ATPase but only hTopoIIa-ATPase domain was obtained in sufficient amount. The inhibition of ATPase activity of hTopoIIa-ATPase by naphthoquinone compounds was evaluated. The naphthoquinone aromatic esters exhibited slightly higher ATPase activity inhibition than the naphthoquinone aromatic amides. Since the rate of enzyme-catalyzed ATP hydrolysis in the presence of the naphthoquinone compounds was slightly inhibited compared with that in the absence of the compounds, other mechanisms in addition to binding to the ATPase domain may exist for the inhibition of hTopoIIa activity. In order to identify where naphthoquinone compounds bind to the ATPase domain, molecular docking analysis of ATPase domain
of hTopoIIa was employed. The docking indicated that the compounds position in the same manner of AMP-PMP but only a few hydrogen bond interactions were detected. In addition to the positions of the naphthoquione compound, the docking experiment revealed different spatial arrangement between naphthoquinone esters and amides as well as some important amino acid residues involved in the binding of the naphthoquinone compounds. 5. Conclusion In summary, our results provide the first information about the interaction of the ATPase domain with naphthoquinone compounds. We have shown that the compounds can interfere with TopoII activity in the ATP-dependent manner. Biological experiments confirmed that the compounds bind to hTopoIIa-ATPase in the presence of ATP. Additionally, naphthoquinone esters can slightly reduce the ATPase activity further than naphthoquinone amides. Given the importance of hTopoII inhibitors as potential anticancer drugs, the further elucidation of the mechanism of action of the naphthoquinone esters and amides inhibitory activity described here and the development of further novel naphthoquinone derivatives which act as hTopoIIa inhibitors is essential.
128
N. Boonyalai et al. / Biomedicine & Pharmacotherapy 67 (2013) 122–128
Disclosure of interest The authors declare that they have no conflicts of interest concerning this article. Acknowledgements We thank the Interdisciplinary Graduate Program in Genetic Engineering, Kasetsart University, National Electronics and Computer Technology Center (NECTEC) and National Nanotechnology Center (NANOTEC) for providing SYBYL 7.3 and computational resources. This work was supported by Kasetsart University Research and Development Institute (KURDI) (v-t(d)38.51 and vt(d)49.53), The Graduate School Kasetsart University and Faculty of Science, Kasetsart University. Financial support from the Center of Excellence for Innovation in Chemistry (PERCH-CIC), Commission on Higher Education, Ministry of Education is also gratefully acknowledged. References [1] Champoux JJ. DNA topoisomerases: structure, function, and mechanism. Ann Rev Biochem 2001;70:369–413. [2] Wang JC. Cellular roles of DNA topoisomerases: a molecular perspective. Nat Rev Mol Cell Biol 2002;3:430–40. [3] Tse YC, Wang JC. E. coli and M. luteus DNA topoisomerase I can catalyze catenation or decatenation of double-stranded DNA rings. Cell 1980;22: 269–76. [4] Kirkegaard K, Wang JC. Bacterial DNA topoisomerase I can relax positively supercoiled DNA containing a single-stranded loop. J Mol Biol 1985;185: 625–37. [5] Berger JM, Wang JC. Recent developments in DNA topoisomerase II structure and mechanism. Curr Opin Struct Biol 1996;6:84–90. [6] Beck WT, Danks MK, Wolverton JS, Kim R, Chen M. Drug resistance associated with altered DNA topoisomerase II. Adv Enzyme Regul 1993;33:113–6. [7] Burden DA, Osheroff N. Mechanism of action of eukaryotic topoisomerase II and drugs targeted to the enzyme. Biochim Biophys Acta 1998;1400:139–54. [8] Larsen AK, Skladanowski A. Cellular resistance to topoisomerase-targeted drugs: from drug uptake to cell death. Biochim Biophys Acta 1998;1400: 257–74. [9] Andoh T, Ishida R. Catalytic inhibitors of DNA topoisomerase II. Biochim Biophys Acta 1998;1400:155–71. [10] Lang AJ, Mirski SEL, Cummings HJ, Yu Q, Gerlach JH, Cole SPC. Structural organization of the human TOP2A and TOP2B genes. Gene 1998;221:255–66. [11] Hande KR. Etoposide: four decades of development of a Topoisomerase II inhibitor. Eur J Cancer 1998;34:1514–21. [12] Wu TS, Hsu HC, Wu PL, Leu YL, Chan YY, Chern CY, et al. Naphthoquinone esters from the root of Rhinacanthus nasutus. Chem Pharm Bull (Tokyo) 1998;46:413–8. [13] Wu T-S, Hsu H-C, Wu P-L, Teng C-M, Wu Y-C. Rhinacanthin-Q, a naphthoquinone from Rhinacanthus nasutus and its biological activity. Phytochemistry 1998;49:2001–3. [14] Kuwahara S, Awai N, Kodama O, Alan Howie R, Thomson RH. A revised structure for rhinacanthone. J Nat Prod 1995;58:1455–8. [15] Rojanapo W, Tepsuwan A, Siripong P. Mutagenicity and antimutagenicity of Thai medicinal plants. Basic Life Sci 1990;52:447–52. [16] Tewtrakul S, Tansakul P, Panichayupakaranant P. Effects of rhinacanthins from Rhinacanthus nasutus on nitric oxide, prostaglandin E2 and tumor necrosis factor-alpha releases using RAW264.7 macrophage cells. Phytomedicine 2009;16:581–5. [17] Tewtrakul S, Tansakul P, Panichayupakaranant P. Anti-allergic principles of Rhinacanthus nasutus leaves. Phytomedicine 2009;16:929–34.
[18] Kongkathip N, Luangkamin S, Kongkathip B, Sangma C, Grigg R, Kongsaeree P, et al. Synthesis of novel rhinacanthins and related anticancer naphthoquinone esters. J Med Chem 2004;47:4427–38. [19] Sharma BK, Singh P, Kumar R, Sharma SJ. Quantitative structure-activity relationship study of novel rhinacanthins and related naphthoquinone esters as anticancer agents. Enzyme Inhib Med Chem 2008;23:50–5. [20] Frydman B, Marton LJ, Sun JS, Neder K, Witiak DT, Liu AA, et al. Induction of DNA topoisomerase II-mediated DNA cleavage by b-lapacphone and related naphthoquinones. Cancer Research 1997;57:620–7. [21] Neder K, Marton LJ, Liu LF, Frydman B. Reaction of beta-lapachone and related naphthoquinones with 2-mercaptoethanol: a biomimetic model of topoisomerase II poisoning by quinones. Cell Mol Biol (Noisy-le-grand) 1998;44: 465–74. [22] Fujii N, Yamashita Y, Arima Y, Nagashima M, Nakano H. Induction of topoisomerase II-mediated DNA cleavage by the plant naphthoquinones plumbagin and shikonin. Antimicrob Agents Chemother 1992;36:2589–94. [23] Kongkathip N, Kongkathip B, Siripong P, Sangma C, Luangkamin S, Niyomdecha M, et al. Potent antitumor activity of synthetic 1,2-Naphthoquinones and 1,4-Naphthoquinones. Bioorg Med Chem 2003;11:3179–91. [24] Kongkathip N, Pradidphol N, Hasitapan K, Kongkathip B. Synthesis and anticancer evaluation of naphthoquinone esters with 2’-cyclopentyl and 2’-cyclohexyl substituents. Biosci Biotechnol Biochem 2010;74:1205–14. [25] Pradidphol P, Kongkathip N, Sittikul P, Boonyalai N, Kongkathip B. First synthesis and antiproliforative activity of novel naphthoquinone amides. Eur J Med Chem 2012;49:253–70. [26] Classen S, Olland S, Berger JM. Structure of the topoisomerase II ATPase region and its mechanism of inhibition by the chemotherapeutic agent ICRF-187. Proc Natl Acad Sci USA 2003;100:10629–34. [27] Saruwatari Y, Wada T, Takita T, Inouye K. Substrate-induced conformational changes of the truncated catalytic domain of Geobacillus stearothermophilus lysyl-tRNA synthetase as examined by fluorescence. Biochim Biophys Acta 2008;1784:1633–40. [28] Olland S, Wang JC. Catalysis of ATP hydrolysis by two NH2-terminal fragments of yeast DNA topoisomerase II. J Biol Chem 1999;274:21688–94. [29] Wei H, Ruthenburg AJ, Bechis SK, Verdine GL. Nucleotide-dependent domain movement in the ATPase domain of a human type IIA DNA topoisomerase. J Biol Chem 2005;280:37041–7. [30] Morris GM, Goodsell DS, Halliday RS, Huey R, Hary WE, Belew RK, et al. Automated docking using a Lamarckian genetic algorithm and an empirical binding free energy function. J Comp Chem 1998;19:1639–62. [31] Jun KY, Lee EY, Jung MJ, Lee OH, Lee ES, Park Choo HY, et al. Synthesis, biological evaluation, and molecular docking study of 3-(3’-heteroatom substituted-2’-hydroxy-1’-propyloxy) xanthone analogues as novel topoisomerase IIa catalytic inhibitor. Eur J Med Chem 2011;46:1964–71. [32] Muller MT, Helal K, Soisson S, Spitzner JR. A rapid and quantitative microtiter assay for eukaryotic topoisomerase II. Nucleic Acids Res 1989;17:9499. [33] Gardiner LP, Roper DI, Hammonds TR, Maxwell A. The N-terminal domain of human topoisomerase IIa is a DNA-dependent ATPase. Biochemistry 1998;37: 16997–7004. [34] Hu T, Sage H, Hsieh TS. ATPase domain of eukaryotic DNA topoisomerase II. Inhibition of ATPase activity by the anti-cancer drug bisdioxopiperazine and ATP/ADP-induced dimerization. J Biol Chem 2002;277:5944–51. [35] Burstein EA, Vedenkina NS, Ivkova MN. Fluorescence and the location of tryptophan residues in protein molecules. Photochem Photobiol 1973;18: 263–79. [36] Fo¨rster T. Intermolecular energy transference and fluorescence Ann Phys (Leipzig) 1948;2:55–75. [37] Leroy D, Kajava AV, Frei C, Gasser SM. Analysis of etoposide binding tosubdomains of human DNA Topoisomerase IIa in the absence of DNA. Biochemistry 2001;40:1624–34. [38] Bender RP, Jablonksy MJ, Shadid M, Romaine I, Dunlap N, Anklin C, et al. Substituents on etoposide that interact with human topoisomerase IIa in the binary enzyme-drug complex: contributions to etoposide binding and activity. Biochemistry 2008;47:4501–9. [39] Larsen AK, Escargueil AE, Skladanowski A. Catalytic Topoisomerase II inhibitors in cancer therapy. Pharmacol Therapeut 2003;99:167–81. [40] Furet P, Schoepfer J, Radimerski T, Chene P. Discovery of a new class of catalytic topoisomerase II inhibitors targeting the ATP-binding site by structure based design. Part. Bioorg Med Chem Lett 2009;19:4014–7.
Available online at
www.sciencedirect.com
Original article
Biophysical and molecular docking studies of naphthoquinone derivatives on the ATPase domain of human Topoisomerase II Nonlawat Boonyalai a,*,c, Pichamon Sittikul a,c, Narathip Pradidphol b,c, Ngampong Kongkathip b,c a
Department of Biochemistry, Faculty of Science, Kasetsart University, 50, Phahon Yothin road, Chatuchak, 10900 Bangkok, Thailand Natural Products and Organic Synthesis Research Unit (NPOS), Department of Chemistry, Faculty of Science, Kasetsart University, Chatuchak, 10900 Bangkok, Thailand c Center of Excellence for Innovation in Chemistry, Faculty of Science, Kasetsart University, Chatuchak, 10900 Bangkok, Thailand b
A R T I C L E I N F O
A B S T R A C T
Article history: Received 2 August 2012 Accepted 26 August 2012
Numerous naphthoquinone derivatives, such as rhinacanthins function as anticancer drugs, which target hTopoII. The structure of hTopoII contains both an ATPase domain and a DNA binding domain. Several drugs bind to either one or both of these domains, thus modifying the activity of hTopoII. The naphthoquinone esters and amides used in this study showed that their hTopoIIa inhibitory activity was inversely proportional to ATP concentration. In order to better characterize the inhibitory action of these compounds, sufficient quantities of soluble functional hTopoII-ATPase domain were required. Therefore, both the alpha and beta isoforms of the hTopoII-ATPase domain were over-expressed in Escherichia coli. The hTopoIIa-ATPase activity was reduced in the presence of naphthoquinone derivatives. Additionally, a molecular docking study revealed that the selected naphthoquinone ester and amide bind to the ATPbinding domain of hTopoIIa. Collectively, the results here provide for the first time a novel insight into the interaction between naphthoquinone esters and amides, and the ATP-binding domain of hTopoIIa. The further elucidation of the mechanism of action of the naphthoquinone esters and amides inhibitory activity is essential. ß 2012 Elsevier Masson SAS. All rights reserved.
Keywords: Naphthoquinones Rhinacanthins Topoisomerase II
1. Introduction DNA topoisomerases are necessary and ubiquitous enzymes involved in chromosome condensation and segregation, and in regulating intracellular DNA supercoiling [1,2]. DNA topoisomerases can be classified into two types, Type I and Type II topoisomerases. Type I topoisomerases (TopoI) act by generating a transient single-stranded break in the DNA double helix, followed by either a single-stranded DNA passage event or the controlled rotation about the break, whilst Type II topoisomerases (TopoII) catalyze DNA topological changes by breaking both strands of the double helix and transporting another double-stranded DNA segment through the break and then reannealing the break. TopoI enzymes are involved in all DNA processes and play an important role in maintaining genomic integrity [3,4]. TopoII enzymes on the other hand play essential roles in DNA transaction in vivo, Abbreviations: ATP, adenosine 50 -triphosphate; EDTA, Ethylenediaminetetraacetic acid; ICRF-187, (S)-4,40 -(1-methyl-1,2, ethanediyl)bis-2,6-piperazinedione; IPTG, isopropyl-b-D-thiogalactopyranoside; NADH, b-nicotinamide adenine dinucleotide; PK/LDH couple assay, pyruvate kinase/lactate dehydrogenase couple assay; hTopoII, human topoisomerase II; SDS-PAGE, sodium dodecyl sulphate-polyacrylamide gel electrophoresis; Tris-Cl, Tris (hydroxymethyl) amino methane. * Corresponding author. Tel.: +66 2 5625555 ext 2048; fax: +66 2 561 4627. E-mail address: [email protected] (N. Boonyalai). 0753-3322/$ – see front matter ß 2012 Elsevier Masson SAS. All rights reserved. http://dx.doi.org/10.1016/j.biopha.2012.08.005
including chromosome condensation and segregation, and the removal of the supercoils generated during replication and transcription [5]. In addition to such essential functions in the cell, TopoII enzymes have become important targets of many widely used antibiotics and antitumor drugs [6–8]. For instance, eukaryotic Type II topoisomerases are targets of anticancer drugs [9]. These enzymes are homodimers with some variability in molecular weights. For example, the enzyme from Saccharomyces cerevisiae has a monomer molecular mass of 164 kDa [5] while the two isoforms of the human enzyme, a and b, are 170 and 180 kDa, respectively [10]. Topoisomerase-targeting anticancer drugs can be divided into two broad classes that vary widely in their mechanisms of action [9]. Within Class I drugs or ‘‘TopoII poisons’’ two main types exist: the first increases levels of enzyme – DNA cleavage complexes by interacting with TopoII at the protein – DNA interface in a non-covalent manner and the second acts by covalently modifying the enzyme. These drugs act by stabilizing covalent topoisomerase-DNA complexes, which are the intermediates during the catalytic cycle of the enzyme. Although this type of inhibitor has been used in cancer therapy for many years, it is very toxic to normally dividing cells and shows a narrow therapeutic window [11]. Unlike Class I inhibitors, Class II drugs or ‘‘catalytic topoisomerase inhibitors’’ interfere with the catalytic function of the enzyme without trapping the covalent complex. Catalytic TopoII inhibitors are a heterogeneous group of
N. Boonyalai et al. / Biomedicine & Pharmacotherapy 67 (2013) 122–128
compounds that might interfere with the binding between DNA and TopoII, stabilize non-covalent DNA TopoII complexes or inhibit ATP-binding. Rhinacanthins are naphthoquinone ester derivatives isolated from the methanolic extract of the roots of the medicinal plant Rhinacanthus nasutus (Acanthaceae) [12–14]. In Thailand, the roots and leaves of the plant have been incorporated in Thai traditional medicine for treatment of several diseases including cancer and inflammation [15]. Some of the naphthoquinone derivatives showed potent antiallergic activity against antigeninduced b-hexosaminidase release [16,17]. Additionally, these compounds exhibited cytotoxicities against the human carcinoma cell lines, KB, HeLa and HepG2 [18]. Based on the cytotoxicity results, all naphthoquinone esters containing an –OH group at C-3 of the naphthoquinone ring (Fig. 1) showed high toxicity against the said cancer cell lines, while those with a methoxy group or without the –OH group displayed no activity or were much less cytotoxic [18]. Naphthoquinone naphthoate esters with an–OH group at 2position of the naphthalene moiety (e.g., Rhinacanthin-N [Rhi-N]) were significantly more cytotoxic than those with –OMe (e.g., Rhinacanthin-Q, [Rhi-Q]) or without –OH group (e.g., NKPSL4 [18]). Additionally, naphthoquinone naphthoate esters exhibited greater cytotoxicity than naphthoquinone benzoate esters. This structureactivity relationship demonstrates that the scaffold of Rhi-N can be used to develop novel anticancer agents as also confirmed by Sharma et al. (2008) [19]. Some of the naphthoquinones such as 1, 2-naphthoquinone and 1, 4-naphthoquinone are potent inducers of the TopoII-DNA ‘‘cleavable complex’’, which leads to the inhibition of TopoII activity [20–23], whereas Rhi-N and Rhi-Q interfere with DNA relaxation of yeast TopoII [18]. Other naphthoquinones such as b-lapachone have been reported to inhibit against various cancers cell lines in vitro and also inhibit the activity of TopoI and induce TopoIIa-mediated DNA strand breaks [23]. Recently, novel naphthoquinone esters containing cyclopentyl and cyclohexyl substituents at C-2´of the propyl chain exhibited relatively good cytotoxicities towards cancer cells but much less cytotoxicities towards Vero cells compared to the naphthoquinone esters with 20 ,20 -dimethyl group (such as Rhi M, RhiN, RhiQ and NKPSL4) [24]. In addition to naphthoquinone esters, the biological activity of novel naphthoquinone amides has been evaluated [25]. Even though, most of naphthoquinone amides showed moderate cytotoxicity towards tested cancer cell lines, they exhibited weak toxicity against normal Vero cell lines and much less toxic than the previous naphthoquinone esters. In this study, we report a biophysical approach to investigate the effect of naphthoquinone derivatives on the ATPase domain of hTopoII. The presence of the compounds moderately inhibits the ATPase activity of the protein. Using the molecular docking approach, the structures of the ligands-protein-complex were examined. The results reported here can lead to the development
123
of further novel naphthoquinone derivatives which act as hTopoIIa ATPase inhibitors. 2. Materials and methods 2.1. Materials Buffer A contained 50 mM Tris-Cl pH 8, 0.5 M NaCl, 5 mM imidazole. Buffer B contained 20 mM Tris-Cl, pH 8, 50 mM NaCl. The plasmid miniprep kit was purchased from Fermentas (EU). The primers were synthesized by Bio Basic INC. The HiTrap Chelating HP column was purchased from GE Healthcare (Thailand). ATP, NADH, phosphoenolpyruvate, pyruvate kinase and lactate dehydrogenase were purchased from Sigma (USA). The other chemicals are analytical reagent grade. Naphthoquinone compounds were synthesized according to Kongkathip, et al. [18] and Pradidphol, et al. [25]. 2.2. Plasmid construction The gene encoding ATPase region of hTopoIIa (residues 29-428) and hTopoIIb (residues 45-444) was amplified from plasmids pCM1 and YEPTOP2, respectively (gifts from Prof. Osheroff, N, Vanderbilt University School of Medicine, USA) in a polymerase chain reaction using synthetic primers: F_hTopoIIA_29, 50 GAGCAGCTAGCTCTGTTGAAAGAATCTATCAAAAG 30 ; R_hTopoIIA_428, 50 GTCGGCCTCGAGTTATGAACACTTCTTGTTTAACTG 30 , F_hTopoIIB_45, 50 GAGCAGCTAGCTCTGTTGAGAGAGTGTATCAG 30 and R_hTopoIIB_444, 50 GTCGGCCTCGAGTTATGAACACTTCTTATTC 30 . The resulting NheI/XhoI fragment was subcloned into NheI/XhoI sites of the pET28b-expression vector (Novagen) yielding a fusion protein of 400 amino acids with N-terminal His-tags (6x His). The sequence of a positive clone containing the hTopoII-ATPase insert was determined in its entirety to ensure that no mutations had been introduced during the polymerase chain reaction. 2.3. Expression and purification of ATPase domain Plasmids pET28b-hTIIa-ATPase and pET28b- hTIIb-ATPaseconstructed as described above were used to express the recombinant ATPase domain of hTopoII. Expression and purification of the enzymes was adapted from [26]. In brief, the expression of hTopoII-ATPase was carried out in Escherichia coli BL21 (DE3) cells. Cells were grown at 37 8C to an optical density of 0.6 at 600 nm in LB broth containing 50 mg/ml kanamycin and then induced with 1 mM IPTG overnight at 30 8C. After expression, the cells were harvested by centrifugation, resuspended in buffer A and lysed by sonication. The fusion protein was purified by HiTrap Chelating HP column attached to HPLC. The protein was eluted by increasing concentration of imidazole and analyzed by 12% SDS-PAGE. Fractions containing the ATPase protein were dialyzed in buffer B. Protein concentration was determined by the BCA protein assay (PIERCE) using BSA as a standard protein.
Fig. 1. Chemical structures of naphthoquinone compounds used in this study.
124
N. Boonyalai et al. / Biomedicine & Pharmacotherapy 67 (2013) 122–128
2.4. Topoisomerase assay Human Topoisomerase IIa activity was determined using Topisomerase II assay kit (TopGEN Inc.). The reaction mixture containing 60 ng of kintoplast DNA (kDNA) and two units of hTopoIIa was incubated with and without naphthoquinone aromatic amide, compound 43 at 37 8C for 1 h in complete assay buffer (50 mM Tris-Cl pH 8.0, 150 mM NaCl, 10 mM MgCl2, 0.5 mM dithiothreitol, and various concentrations of ATP). Doxorubicin was used as a positive control while decatenated and linearized kDNA were used as markers. The reaction in a final volume of 20 ml was stopped by adding stop buffer/gel loading dye (1% Sarkosyl, 0.025% bromophenol blue and 5% glycerol). Reaction products were run on 1% agarose gel in 0.5x TBE buffer with 0.5 mg/ml ethidium bromide included in the gel. Electrophoresis was performed at 50 V for 1.30 h. After electrophoresis, the gel was destained with distilled water for 30 min and photographed over a UV transilluminator using DNr Bio-Imaging system. One unit of Topoisomerase II is defined as the amount of enzyme that decatenates 0.2 mg of kDNA in 30 min at 37 8C. 2.5. Fluorescence binding study Interaction studies between the ATPase proteins and ligands were carried out by monitoring the intrinsic fluorescent intensity of tryptophan residues. A fluorescence titration method was performed by adding microliter amounts of the ligands to 400 ml of 5 mM ATPase protein in buffer B containing 5 mM ATP. The excitation wavelength of 295 nm was used and the fluorescence emission spectra were recorded between 315–400 nm and the maximal emission peak at 340 nm was determined. Titration results were corrected to account for ligand dilution. Data were plotted as DFmax (the maximum attainable change in fluorescence intensity) at 340 nm versus the concentration of cofactors. Fitting of the direct plot by non-linear regression with single binding site equation allowed the estimation of Kd values [27] using the Microcal Origin 6.0 program. 2.6. ATPase assay To ascertain the ATPase activity, ATPase measurement was carried out by the PK/LDH couple assay described previously with some modifications [28]. The reaction mixture of 200 ml contained 10 mM Tris-Cl pH 7.5, 50 mM NaCl, 50 mM KCl, 5 MgCl2, 0.1 mM NADH, 2 mM phosphoenolpyruvate, 3 units of pyruvate kinase, four units of lactate dehydrogenase and various concentrations of ATP. Both ATP and the reaction mixture were pre-equilibrated at 30 8C for 5 min before the measurement. Finally, 0.1 mM of the enzyme was added into the reaction mixture. The decrease in NADH, which was directly proportional to the rate of ATP hydrolysis, was monitored by measuring the absorbance at 340 nm in a microplate reader spectrophotometer (Sunrise-basic TECAN). In order to determine the inhibition of ATPase activity by the naphthoquinone compounds, 50 mM of the compounds were added to each reaction mixture and pre-equilibrated at 30 8C for 5 min before the measurement. All assays were performed in triplicate. 2.7. Molecular docking analysis To better understand how the ligands bind to the enzyme, molecular docking analysis was performed. The crystal structure of ATPase domain of human TopoIIa was obtained from the protein data bank (pdb code 1ZXM) [29]. The structures of rhinacanthin-N and compound 43 were built using Sybyl 7.3 program (Tripos Associates, St. Louis, MO. USA). Docking analysis was performed
with Autodock 4.0 program [30]. The grid was chosen to be sufficiently large to include the ATP-binding site as a whole with spacing of 0.375 A˚ and a grid size of 60 60 60 points along the x, y and z axes. The center of the ligands was positioned at the grid center. The search parameter used was Lamarckian Genetic Algorithm (LGA) with 100 runs. The population size was set at 150 and the number of energy evaluations was 2.5 million. Three dimensional structures and molecular surfaces of hTopoIIaATPase-naphthoquinone compounds with the best-docked conformation were visualized and analyzed by PyMOL (Delano, W.L. The PyMOL Molecular Graphic System, Delano Scientific, San Carlos, CA, USA; 2002 http://www.pymol.org).
3. Results 3.1. Human Topoisomerase IIa inhibitory activity Naphthoquinone ester derivatives have been reported to be able to inhibit the DNA relaxation activity of TopoII [18]. Despite rhinacanthins being suggested to be able to interact with the DNA binding domain, it cannot be ruled out that they also interact with the ATPase domain. Expoxide ring-opened xanthone derivatives, for instance, have shown ATPase inhibitory activity inversely proportionally to ATP concentration [31]. Therefore, it would be of interest to determine if the inhibitory action of naphthoquinone compounds on DNA relaxation is also proportional to ATP concentration. In Topoisomerase II assay, compound 43 (a napthoquione amide analog to Rhi-N) was chosen (Fig. 1). Recently, naphthoquinone aromatic amides also attract our interests due to their stability towards the hydrolysis. Therefore, a series of naphthoquinone aromatic amide were synthesized and their cytotoxicities against cancer cell lines and Vero cells were tested [25]. The decatenation assay was used to determine the inhibitory activity of compound 43 and hTopoIIa. The enzyme catalyzes the ATP-dependent decatenation of long-chained, catenated DNA molecules into free relaxed and supercoiled forms [32]. As seen on Fig. 2, compound 43 exhibited strong hTopoIIa inhibitory activity in the presence of 2 mM ATP. However, when ATP concentrations increased, hTopoIIa inhibitory activity of compound 43 reduced. It is likely that the tested compound compete with ATP. To further explore the role of naphthoquinone derivatives as inhibitors of the ATP hydrolysis needed for the complete catalytic cycle of hTopoII, attempts were made to recombinantly express and purify to homogeneity the ATPase domains of both hTopoIIa and hTopoIIb. The recombinant domains were subsequently used in ligand-binding and ATPase assays. 3.2. Expression and characterization of hTopoII-ATPase To further examine the inhibition of ATPase activity by naphthoquinone derivatives, the ATPase domains of both hTopoIIa and hTopoII b were cloned into a pET28b-expression vector. Both recombinant ATPase proteins were expressed in E. coli BL21 (DE3) cells and purified from the soluble protein fraction by His-tag affinity chromatography. Only small amounts of the recombinant hTopoIIb-ATPase protein were expressed in soluble form, while sufficient amounts of purified recombinant hTopoIIa-ATPase protein were obtained (Fig. 3A) which were further used for enzymatic activity assays. To investigate the biochemical properties of hTopoIIa-ATPase protein, the ATPase activity of the ATPase protein was quantified by a PK/LDH coupled assay. As a function of the ATP concentration, the rate of ATP hydrolysis by the ATPase protein shows a hyperbolic dependence (Fig. 3B), indicative of Michaelis-Menten kinetics. The Km and kcat (0.5 0.1 mM and 0.8 s1) were determined from this data. These results were comparable
N. Boonyalai et al. / Biomedicine & Pharmacotherapy 67 (2013) 122–128
125
Fig. 2. Topoisomerase IIa inhibitory activity of naphthoquinone aromatic amide 43. The compound was examined in final concentration of 50 mM. Lanes K: kDNA only, Lane D: decatenated kDNA only, Lane T: kDNA + hTopoIIa, Lanes 43: kDNA + hTopoIIa + compound 43. The concentrations of ATP used in each reaction are indicated above each lane. Catenated kDNA does not migrate out of the loading wells.
with the previous reports (Km and kcat of 0.47 mM and 0.018 s1 [33] and of 0.35 mM and 0.02 s1 [34] in the absence of DNA). 3.3. Binding of naphthoquinone compounds on the ATPase domain of hTopoIIa A binding assay based on changes in the intrinsic tryptophan fluorescence of the hTopoIIa-ATPase domain upon titration of the naphthoquinone compound ligands was used to determine the affinity of the protein and ligand. Excitation of the protein at 295 nm resulted in a single emission peak at about 340 nm indicating the characteristic of a class II tryptophan residue in which a tryptophan residue is partially exposed at the surface of the protein [35]. The crystal structure of the protein [29] shows that there are clusters of tryptophan residues around the ATPbinding site (W62, W119, W194, W297 and W361); hence, these tryptophan residues may be used as probes to monitor any structural change upon the ligand-binding event. In this experiment eight naphthoquinone compounds (four esters and four amides) were used. Addition of the ligand to a 5 mM ATP protein solution resulted in fluorescence quenching, with 70 micromolar ligand producing a 70% reduction in the emission spectra. This quenching may be accounted for either by ring stacking of the indole ring of a tryptophan with the aromatic rings of the ligand or Fo¨rster energy transfer from the tryptophan residues to the bound ligand [36]. Table 1 summarizes the dissociation constant (Kd) values between hTopoIIa-ATPase protein and the ligands. It can be seen that Kd values of naphthoquinone amides are slight higher than those of naphthoquinone esters. Compound 23 binds to the protein with 2-fold less affinity compared to napthoquinone ester analog. This correlated with the previous cytotoxicity study that napthoquinone esters are slightly more active than naphthoquinone amides [25]. It should be noted that the binding affinity between these compounds and hTopoIIa-ATPase protein can still be observed in the presence of 5 mM ATP, indicating that the naphthoquinone compounds may function as competitive inhibitors. 3.4. Effect of naphthoquinone compounds on hTopoIIa-ATPase Etoposide has been proposed to bind both to the N-terminal domain and the core domain of TopoII without eliminating ATPbinding [37]. STD-NMR experiment has also revealed that the
binding of etoposide to human TopoIIa is driven by the interactions with the A-ring and the B-ring and by stacking interactions with the E-ring of the etoposide [38]. Etoposide can inhibit the rate of either the first ADP release or the hydrolysis of the second ATP [39]. Unlike etoposide, bisdioxopiperazines such as ICRF-187 have been found to bridge and stabilize a transient dimer interface between two ATPase domains but does not compete with the ATP-binding [26]. The multiple mutations both in the Nterminal domain and the core domain can cause resistance to bisdioxopiperazines [26]. Bisdioxopiperazine derivatives such as ICRF-193 do not significantly inhibit ATPase hydrolysis of the 52 kDa of human TopoII. Based on our fluorescence binding study, the inhibition activity of naphthoquinone compounds towards ATPase protein was next examined by ATPase assay in the absence of DNA. Fig. 3C shows the ATPase activity of hTopoIIa-ATPase protein in the absence and presence of naphthoquinone compounds. At 2 mM ATP, the tested naphthoquinone compounds can interfere at varying degree with ATPase activity of ATPase domain of hTopoIIa but the naphthoquinone aromatic esters seemed to inhibit ATPase activity slightly more than the naphthoquinone aromatic amides. 3.5. Molecular docking of naphthoquinone derivatives and hTopoIIaATPase To visualize how the ligands position in hTopoIIa-ATPase and to examine the binding mode of the naphthoquinone compounds, molecular docking studies were carried out for Rhi-N and compound 43 with ATP-binding domain of hTopoIIa using the Autodock 4.0 program. The docking analysis showed that the compounds fit into the ATP-binding site. The position of the naphthoquinone ring in both compounds aligns with the phosphate backbone of ATP but only the naphthalene moiety of rhinacanthin-N overlaps well with the purine ring of ATP (Fig. 4A and B). Fig. 4C and D represent the arrangement of the naphthoquinone compounds in the binding pocket. Both Rhi-N and compound 43 are surrounded by hydrophobic amino acid residues such as I125, F142 and L140 for naphthalene moiety, and small polar uncharged amino acid residues such as S148, S149 and N150 for naphthoquinone ring. In Rhi-N-ATPase complex, the NH side chain of N150 forms a bifurcated-hydrogen bond with the C1-carbonyl of the naphthoquinone ring, whereas in the Compound 43-ATPase
126
N. Boonyalai et al. / Biomedicine & Pharmacotherapy 67 (2013) 122–128
Fig. 3. Protein characterization. (A) Purification of hTopoIIa-ATPase protein on 12% SDS-PAGE. Lane M, molecular mass standard (Fermentas); Lane 1, 45 kDa protein purified through a Ni2+-NTA column. The gel was stained by coomassie blue. (B) Dependence of hydrolysis rate of the hTopoIIa-ATPase protein on ATP concentration at constant enzyme concentration (0.1 mM). The Km was calculated by the Michaelis-Menten plot using the Microcal Origin 6.0 program. (C) ATPase activity of hTopoIIa-ATPase in the presence of naphthoquinone compounds. The ATPase activity was measured at 2 mM ATP, 50 mM naphthoquinone compounds with 0.1 mM of hTopoIIa-ATPase in the absence of DNA. The data shown are means S.D. for three independent experiments.
complex, two types of hydrogen bonds are observed: a typical hydrogen bond between the NH side chain of N150 and C4carbonyl of the naphthoquinone ring and a bifurcated hydrogen bond between C3-OH of the naphthoquinone ring and OH side chain S149 and main chain O of S148. It is important to note that compound 43 shows the existence of close contact with shorter hydrogen bonds to the naphthoquinone moiety than Rhi-N. These observed hydrogen bond networks have been seen in the Table 1 Dissociation constants (Kds). The Kd values were obtained from the fluorescence binding studies in the presence of 5 mM ATP. Naphthoquinone esters
Kd (mM)
Naphthoquinone amides
Kd (mM)
Rhi-N Rhi-Q Rhi-M NKPSL4
23 2 22 1 37 4 23 2
Compound Compound Compound Compound
30 3 26 4 50 7 45 4
43 45 21 23
interaction between xanthone analogs and ATP-binding domain of hTopoIIa [31]. Interestingly, the arrangement of Rhi-N in the ATP-binding site is similar to that of xanthone analogs [31]. The hydrogen bond interaction with S149 is also observed in the purine scaffold derivative [40]. According to the structure of hTopoIIa-ATPase–AMPPNP complex, the adenine ring is held through hydrogen bonding to a side chain carbonyl of N120 and S148 donates a hydrogen bond to the b-phosphate [29]. However, the key catalytic general base, D87, is not observed as a part of the interaction between naphthoquinone compounds and the protein. Since the ATP hydrolysis assay showed neither naphthoquinone compounds dramatically inhibit the ATPase activity, other mechanisms in addition to binding to the ATPase domain may exist. The molecular docking here can provide an insight for a new design of the novel naphthoquinone compounds in order to improve the binding affinity of the compounds and to compete effectively with ATP.
N. Boonyalai et al. / Biomedicine & Pharmacotherapy 67 (2013) 122–128
127
Fig. 4. Overlay structure of AMP-PNP and Rhi-N (A) and compound 43 (B) in ATPase domain of hTopoIIa. The molecules are shown in stick and colored by elements (carbon: light pink for Rhi-N, violet for compound 43 and yellow for AMP-PNP; oxygen: red; hydrogen: white, nitrogen: blue and phosphate: orange). (C) and (D) are view of Rhi-N and compound 43 in ATPase domain of hTopoII(, respectively. The amino acids involved in the interaction of rhinacanthins are depicted in stick representation and colored by elements (carbon: blue slate; oxygen: red; hydrogen: white and nitrogen: blue). The dotted red lines represent the hydrogen bonding interaction.
4. Discussion This paper reports the effect of naphthoquinone derivatives as potential Topoisomerase II inhibitors. Naphthoquinone aromatic esters and amides have been tested against cancer cell lines showing potent cytotoxicities. In this report, a selected compound 43 exhibited hTopoIIa inhibition when 2 mM ATP was present. The ATP competition assay revealed that the inhibition of hTopoIIa by compound 43 was inversely proportional to the ATP concentration. This has led to the further study on hTopoII-ATPase domain. Attempts were made for protein expression of both hTopoIIaATPase and hTopoIIb-ATPase but only hTopoIIa-ATPase domain was obtained in sufficient amount. The inhibition of ATPase activity of hTopoIIa-ATPase by naphthoquinone compounds was evaluated. The naphthoquinone aromatic esters exhibited slightly higher ATPase activity inhibition than the naphthoquinone aromatic amides. Since the rate of enzyme-catalyzed ATP hydrolysis in the presence of the naphthoquinone compounds was slightly inhibited compared with that in the absence of the compounds, other mechanisms in addition to binding to the ATPase domain may exist for the inhibition of hTopoIIa activity. In order to identify where naphthoquinone compounds bind to the ATPase domain, molecular docking analysis of ATPase domain
of hTopoIIa was employed. The docking indicated that the compounds position in the same manner of AMP-PMP but only a few hydrogen bond interactions were detected. In addition to the positions of the naphthoquione compound, the docking experiment revealed different spatial arrangement between naphthoquinone esters and amides as well as some important amino acid residues involved in the binding of the naphthoquinone compounds. 5. Conclusion In summary, our results provide the first information about the interaction of the ATPase domain with naphthoquinone compounds. We have shown that the compounds can interfere with TopoII activity in the ATP-dependent manner. Biological experiments confirmed that the compounds bind to hTopoIIa-ATPase in the presence of ATP. Additionally, naphthoquinone esters can slightly reduce the ATPase activity further than naphthoquinone amides. Given the importance of hTopoII inhibitors as potential anticancer drugs, the further elucidation of the mechanism of action of the naphthoquinone esters and amides inhibitory activity described here and the development of further novel naphthoquinone derivatives which act as hTopoIIa inhibitors is essential.
128
N. Boonyalai et al. / Biomedicine & Pharmacotherapy 67 (2013) 122–128
Disclosure of interest The authors declare that they have no conflicts of interest concerning this article. Acknowledgements We thank the Interdisciplinary Graduate Program in Genetic Engineering, Kasetsart University, National Electronics and Computer Technology Center (NECTEC) and National Nanotechnology Center (NANOTEC) for providing SYBYL 7.3 and computational resources. This work was supported by Kasetsart University Research and Development Institute (KURDI) (v-t(d)38.51 and vt(d)49.53), The Graduate School Kasetsart University and Faculty of Science, Kasetsart University. Financial support from the Center of Excellence for Innovation in Chemistry (PERCH-CIC), Commission on Higher Education, Ministry of Education is also gratefully acknowledged. References [1] Champoux JJ. DNA topoisomerases: structure, function, and mechanism. Ann Rev Biochem 2001;70:369–413. [2] Wang JC. Cellular roles of DNA topoisomerases: a molecular perspective. Nat Rev Mol Cell Biol 2002;3:430–40. [3] Tse YC, Wang JC. E. coli and M. luteus DNA topoisomerase I can catalyze catenation or decatenation of double-stranded DNA rings. Cell 1980;22: 269–76. [4] Kirkegaard K, Wang JC. Bacterial DNA topoisomerase I can relax positively supercoiled DNA containing a single-stranded loop. J Mol Biol 1985;185: 625–37. [5] Berger JM, Wang JC. Recent developments in DNA topoisomerase II structure and mechanism. Curr Opin Struct Biol 1996;6:84–90. [6] Beck WT, Danks MK, Wolverton JS, Kim R, Chen M. Drug resistance associated with altered DNA topoisomerase II. Adv Enzyme Regul 1993;33:113–6. [7] Burden DA, Osheroff N. Mechanism of action of eukaryotic topoisomerase II and drugs targeted to the enzyme. Biochim Biophys Acta 1998;1400:139–54. [8] Larsen AK, Skladanowski A. Cellular resistance to topoisomerase-targeted drugs: from drug uptake to cell death. Biochim Biophys Acta 1998;1400: 257–74. [9] Andoh T, Ishida R. Catalytic inhibitors of DNA topoisomerase II. Biochim Biophys Acta 1998;1400:155–71. [10] Lang AJ, Mirski SEL, Cummings HJ, Yu Q, Gerlach JH, Cole SPC. Structural organization of the human TOP2A and TOP2B genes. Gene 1998;221:255–66. [11] Hande KR. Etoposide: four decades of development of a Topoisomerase II inhibitor. Eur J Cancer 1998;34:1514–21. [12] Wu TS, Hsu HC, Wu PL, Leu YL, Chan YY, Chern CY, et al. Naphthoquinone esters from the root of Rhinacanthus nasutus. Chem Pharm Bull (Tokyo) 1998;46:413–8. [13] Wu T-S, Hsu H-C, Wu P-L, Teng C-M, Wu Y-C. Rhinacanthin-Q, a naphthoquinone from Rhinacanthus nasutus and its biological activity. Phytochemistry 1998;49:2001–3. [14] Kuwahara S, Awai N, Kodama O, Alan Howie R, Thomson RH. A revised structure for rhinacanthone. J Nat Prod 1995;58:1455–8. [15] Rojanapo W, Tepsuwan A, Siripong P. Mutagenicity and antimutagenicity of Thai medicinal plants. Basic Life Sci 1990;52:447–52. [16] Tewtrakul S, Tansakul P, Panichayupakaranant P. Effects of rhinacanthins from Rhinacanthus nasutus on nitric oxide, prostaglandin E2 and tumor necrosis factor-alpha releases using RAW264.7 macrophage cells. Phytomedicine 2009;16:581–5. [17] Tewtrakul S, Tansakul P, Panichayupakaranant P. Anti-allergic principles of Rhinacanthus nasutus leaves. Phytomedicine 2009;16:929–34.
[18] Kongkathip N, Luangkamin S, Kongkathip B, Sangma C, Grigg R, Kongsaeree P, et al. Synthesis of novel rhinacanthins and related anticancer naphthoquinone esters. J Med Chem 2004;47:4427–38. [19] Sharma BK, Singh P, Kumar R, Sharma SJ. Quantitative structure-activity relationship study of novel rhinacanthins and related naphthoquinone esters as anticancer agents. Enzyme Inhib Med Chem 2008;23:50–5. [20] Frydman B, Marton LJ, Sun JS, Neder K, Witiak DT, Liu AA, et al. Induction of DNA topoisomerase II-mediated DNA cleavage by b-lapacphone and related naphthoquinones. Cancer Research 1997;57:620–7. [21] Neder K, Marton LJ, Liu LF, Frydman B. Reaction of beta-lapachone and related naphthoquinones with 2-mercaptoethanol: a biomimetic model of topoisomerase II poisoning by quinones. Cell Mol Biol (Noisy-le-grand) 1998;44: 465–74. [22] Fujii N, Yamashita Y, Arima Y, Nagashima M, Nakano H. Induction of topoisomerase II-mediated DNA cleavage by the plant naphthoquinones plumbagin and shikonin. Antimicrob Agents Chemother 1992;36:2589–94. [23] Kongkathip N, Kongkathip B, Siripong P, Sangma C, Luangkamin S, Niyomdecha M, et al. Potent antitumor activity of synthetic 1,2-Naphthoquinones and 1,4-Naphthoquinones. Bioorg Med Chem 2003;11:3179–91. [24] Kongkathip N, Pradidphol N, Hasitapan K, Kongkathip B. Synthesis and anticancer evaluation of naphthoquinone esters with 2’-cyclopentyl and 2’-cyclohexyl substituents. Biosci Biotechnol Biochem 2010;74:1205–14. [25] Pradidphol P, Kongkathip N, Sittikul P, Boonyalai N, Kongkathip B. First synthesis and antiproliforative activity of novel naphthoquinone amides. Eur J Med Chem 2012;49:253–70. [26] Classen S, Olland S, Berger JM. Structure of the topoisomerase II ATPase region and its mechanism of inhibition by the chemotherapeutic agent ICRF-187. Proc Natl Acad Sci USA 2003;100:10629–34. [27] Saruwatari Y, Wada T, Takita T, Inouye K. Substrate-induced conformational changes of the truncated catalytic domain of Geobacillus stearothermophilus lysyl-tRNA synthetase as examined by fluorescence. Biochim Biophys Acta 2008;1784:1633–40. [28] Olland S, Wang JC. Catalysis of ATP hydrolysis by two NH2-terminal fragments of yeast DNA topoisomerase II. J Biol Chem 1999;274:21688–94. [29] Wei H, Ruthenburg AJ, Bechis SK, Verdine GL. Nucleotide-dependent domain movement in the ATPase domain of a human type IIA DNA topoisomerase. J Biol Chem 2005;280:37041–7. [30] Morris GM, Goodsell DS, Halliday RS, Huey R, Hary WE, Belew RK, et al. Automated docking using a Lamarckian genetic algorithm and an empirical binding free energy function. J Comp Chem 1998;19:1639–62. [31] Jun KY, Lee EY, Jung MJ, Lee OH, Lee ES, Park Choo HY, et al. Synthesis, biological evaluation, and molecular docking study of 3-(3’-heteroatom substituted-2’-hydroxy-1’-propyloxy) xanthone analogues as novel topoisomerase IIa catalytic inhibitor. Eur J Med Chem 2011;46:1964–71. [32] Muller MT, Helal K, Soisson S, Spitzner JR. A rapid and quantitative microtiter assay for eukaryotic topoisomerase II. Nucleic Acids Res 1989;17:9499. [33] Gardiner LP, Roper DI, Hammonds TR, Maxwell A. The N-terminal domain of human topoisomerase IIa is a DNA-dependent ATPase. Biochemistry 1998;37: 16997–7004. [34] Hu T, Sage H, Hsieh TS. ATPase domain of eukaryotic DNA topoisomerase II. Inhibition of ATPase activity by the anti-cancer drug bisdioxopiperazine and ATP/ADP-induced dimerization. J Biol Chem 2002;277:5944–51. [35] Burstein EA, Vedenkina NS, Ivkova MN. Fluorescence and the location of tryptophan residues in protein molecules. Photochem Photobiol 1973;18: 263–79. [36] Fo¨rster T. Intermolecular energy transference and fluorescence Ann Phys (Leipzig) 1948;2:55–75. [37] Leroy D, Kajava AV, Frei C, Gasser SM. Analysis of etoposide binding tosubdomains of human DNA Topoisomerase IIa in the absence of DNA. Biochemistry 2001;40:1624–34. [38] Bender RP, Jablonksy MJ, Shadid M, Romaine I, Dunlap N, Anklin C, et al. Substituents on etoposide that interact with human topoisomerase IIa in the binary enzyme-drug complex: contributions to etoposide binding and activity. Biochemistry 2008;47:4501–9. [39] Larsen AK, Escargueil AE, Skladanowski A. Catalytic Topoisomerase II inhibitors in cancer therapy. Pharmacol Therapeut 2003;99:167–81. [40] Furet P, Schoepfer J, Radimerski T, Chene P. Discovery of a new class of catalytic topoisomerase II inhibitors targeting the ATP-binding site by structure based design. Part. Bioorg Med Chem Lett 2009;19:4014–7.