- Email: [email protected]
Biosynthesis of the fatty acid isopropyl esters by engineered Escherichia coli
Accepted Manuscript Title: Biosynthesis of the fatty acid isopropyl esters by engineered Escherichia coli Authors: Hong Pan, Lihua Zhang, Xun Li, Daoyi Guo PII: DOI: Reference:
S0141-0229(17)30056-X http://dx.doi.org/doi:10.1016/j.enzmictec.2017.03.012 EMT 9062
To appear in:
Enzyme and Microbial Technology
Received date: Revised date: Accepted date:
4-10-2016 23-3-2017 26-3-2017
Please cite this article as: Pan Hong, Zhang Lihua, Li Xun, Guo Daoyi.Biosynthesis of the fatty acid isopropyl esters by engineered Escherichia coli.Enzyme and Microbial Technology http://dx.doi.org/10.1016/j.enzmictec.2017.03.012 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Biosynthesis of the fatty acid isopropyl esters by engineered Escherichia coli
Hong Pan1,2, Lihua Zhang1,2, Xun Li2 , Daoyi Guo1,2*
1. National Navel Orange Engineering Research Center, College of Life and
Environmental Sciences, Gannan Normal University.
2. Key Laboratory of Organo-Pharmaceutical Chemistry, Jiangxi Province, Gannan
Normal University, Ganzhou 341000, People’s Republic of China.
Corresponding author: Tel: +86-797-8353936; E-mail address: [email protected]
1
Highlights
Design and assembly of an artificial the fatty acid isopropyl esters biosynthetic pathway in E. coli
Improvement of the fatty acid isopropyl esters production in E. coli by increasing the fatty acyl-CoA availability
Abstract: The fatty acid methyl esters and fatty acid ethyl esters are known as biodiesels which are considered to be renewable, nontoxic and biodegradable biofuels. However, the conventional biodiesels show a high crystallization temperature which is one of the most critical obstacles against the widespread biodiesel usage. The high crystallization temperature of biodiesel can be reduced by replacing the methyl or ethyl ester with an isopropyl moiety. Here we report on a strategy to establish biosynthesis of the fatty acid isopropyl esters(FAIPEs) from the simple substrate glucose in Escherichia coli with heterologous coexpression of atoB encoded acetyl-CoA acetyltransferase and atoAD encode acetoacetyl-CoA transferase from E. coli, ADC encode acetoacetate decarboxylase from Clostridium acetobutylicum, ADH encoded NADP-dependent alcohol dehydrogenase from Clostridium beijerinckii, ‘TesA encoded a truncated fatty acyl-ACP thioesterase and FadD encoded fatty acyl-CoA synthetase from E. coli, and the WS/DGAT encoded acyltransferase from Acinetobacter baylyi strain ADP1. It was found that the yield of FAIPEs was up to 2
203.4 mg/L and accounted for around 6.4 % (wt/wt) of the dry cell weight. Our results indicates that it is a feasible strategy to improve the yield of FAIPEs by increasing fatty acyl-CoA availability in biosynthetic pathway and exhibit a promising method for production of biodiesels with good low-temperature flow properties.
Keywords: fatty acid isopropyl esters; isopropanol; biodiesel; WS/DGAT.
1. Introduction Biodiesel, a kind of environmentally friendly biofuels, has been receiving more attention because of the increasing energy demand and environmental consciousness [1]. Recently, the biosynthesis of fatty acid methyl esters (FAMEs) or fatty acid ethyl esters (FAEEs) in engineered Escherichia coli or Saccharomyces cerevisiae was reported[2-9]. However, FAMEs and FAEEs show a high crystallization temperature than diesel fuel, so they crystallize at temperatures below -0°C. These formed crystals can cause operation problems because they can plug the fuel lines and filters, which impedes the widespread biodiesel usage[10, 11]. Crystallization involves the arrangement of molecules in an orderly pattern. Crystallization temperatures reduced, when branches are introduced into linear, long-chain esters. Thus, the high crystallization temperature of biodiesel can be reduced by replacing the methyl or ethyl ester with a branched moiety. Lee et al prepared the fatty acid isopropyl esters (FAIPEs) by chemical method and examined their crystallization temperature, and
3
showed that the FAIPEs can greatly reduce the crystallization temperature, compared with the common fatty acid methyl esters [12]. Clostridium acetobutylicum naturally produces acetone which can be converted into isopropanol by introducing a secondary alcohol dehydrogenase[13, 14]. So these corresponding FAIPEs can be biosynthesized in the isopropanol-producing microorganism by the esterification of isopropanol and fatty acyl-CoA. Here, we showed the biosynthesis of FAIPEs from glucose in engineered E. coli for the first time by co-expressing the atoB (acetyl-CoA acetyltransferase from E. coli), atoAD (acetoacetyl-CoA transferase from E. coli), ADC (acetoacetate decarboxylase from Clostridium
acetobutylicum
DSM1713),
ADH
(NADP-dependent
alcohol
dehydrogenase from Clostridium beijerinckii DSM1739) genes for the production of isopropanol, and the WS/DGAT (acyltransferase from Acinetobacter baylyi strain ADP1) gene for catalytic esterification of isopropanol and fatty acyl-coenzyme A (Fig.1). In addition, we further showed overexpression of ′tesA (encoding a truncated fatty acyl-ACP thioesterase) and FadD (fatty acyl-CoA synthetase) gene results in a greater FAIPEs production by increasing the fatty acyl-CoA availability. 2. Material and Methods 2.1 Enzymes, DNA kits, and bacterial strains PCR polymerase and T4 ligase were purchased from New England Biolabs. Plasmid mini kits, PCR purification kits, and gel extraction kits were provided by Takara (China, Dalian), and used according to manufacturer’s instructions. E. coli DH5a (Stratagene; La Jolla, CA, USA) was used to propagate all plasmids. E. coli
4
strain DG001was constructed to block fatty acyl-CoA degradation by deleting the fadE gene in strain MG1655 as previously described[15]. 2.2 Plasmid construction for FAIPEs production The WS/DGAT (GenBank WP_004922247.1) gene was amplified by PCR from A.
baylyi
ADP1
genomic
DNA
using
primers
WS/DGAT-XbaI
and
WS/DGAT-SpeI-BamHI, and inserted into pET28a(+) to give pDG50. ADH (GenBank AF157307.2) and ADC (GenBank NC_001988.2) gene from C. beijerinckii and C. acetobutylicum were synthesized and provided by GenScript. The ADH and ADC
gene
were
individually
amplified
by
PCR
using
primers
ADH-XbaI/ADH-SpeI-BamHI and ADC-XbaI/ADC-SpeI-BamHI separately, and individually inserted into pET28a(+). Subsequently, the XbaI-XhoI fragments of ADH and ADC were inserted into pDG50 one by one to give pDG51. The atoB (GenBank CUU94423.1) and atoAD (GenBank EFI19791.1) gene were individually amplified by PCR from E. coli genomic DNA using primers atoB-XbaI/atoB-SpeI-BamHI and atoAD-XbaI/atoAD-SpeI-BamHI separately, and individually inserted into pET28a(+). Subsequently, the XbaI-XhoI fragments of atoB and atoAD were inserted into pBBRMCS1 one by one to give pDG52. The FadD gene (GenBank WP_001764937.1) was amplified by PCR from E. coli genomic DNA using primers FadD-XbaI and FadD-NheI-BamHI, and inserted into pET28a(+) to give pDG53. The XbaI-XhoI fragments of FadD was inserted into SpeI and XhoI sites of pDG51 to give pDG54. The ′tesA gene (a truncated fatty acyl-ACP thioesterase, GenBank ACT42344.1) was amplified by PCR from E. coli genomic DNA using primers ′TesA-SacI
5
and ′TesA-SpeI, and inserted into pDG52 to give pDG55. 2.3 Shake flask cultures A single colony from a freshly transformed E. coli strain from a Luria–Bertani (LB) plate was grown for 10 h in 5 mL of LB medium supplemented with 36 mg/L chloromycetin and/or 50 mg/L kanamycin in a flasks at 37 °C. Cells were collected by centrifugation at 5000 g for 2 min, resuspended in 100 mL modified M9 medium as previously described by Guo[15] and shaken at 30 °C. When the OD600 reached 0.8, isopropyl-β-D-thiogalactopyranoside was added to a final concentration of 0.1 mM. Samples were taken at regular intervals for FAIPEs analysis. 2.4 GC/MS analysis of FAIPEs FAIPEs were extracted using a previously published method[16]. GC/MS analysis of FAIPEs dissolved in hexane phase was done on a Series 7890A GC system equipped with a Series 5975C EI MSD dete, ctor (Aglilent technologies). A 1 μl portion of the hexane phase was analysed after a split 20:1 injection on a DB-5ms capillary column (30 m x 0.25 mm x 0.25μm). Helium was used as carrier gas. The temperatures of the injector and detector were 300°C and 250°C, respectively. The following temperature programme was applied: 100 °C for 10 min, increase of 6°C min to 240°C, 240 °C for 20 min. Quantification was done by using methyl pentadecanoate as internal standard. 3. Results 3.1 Design and assembly of an artificial FAIPEs biosynthetic pathway in E. coli Fatty acid branched-chain esters can reduce the high crystallization temperature
6
[17]. Here, to attempt to produce the FAIPEs with low-temperature operability as aim product through engineered E. coli , we generated and expressed in E. coli an artificial metabolic pathway for the production of FAIPEs. This pathway comprised five gene products: atoB, atoAD, ADC and ADH for the production of isopropanol, and the WS/DGAT gene for catalytic esterification of isopropanol and fatty acyl-coenzyme A. The resulting recombinant E. coli was DG001/pDG51/pDG52. This recombinant E. coli cell was grown in a modified M9 medium, and treated with IPTG to induce expression of the heterologous genes atoB, atoAD, ADC, ADH and WS/DGAT. FAIPEs were extracted from the recombinant E. coli and the control strains, and analyzed by GC-MS (Figure 2). No FAIPEs were detected in the negative control strain E. coli. In contrast, 51.3 mg/L of FAIPEs was formed in the recombinant strains and accounted for around 1.6 % (wt/wt) of the dry cell weight (Table 3, 4). The FAIPEs yield and productivity were calculated to be 2.6 mg/g glucose and 1.8 mg/L/h, respectively (Table 4) . 3.2 Improvement of FAIPEs production in E. coli by increasing the fatty acyl-CoA availability Fatty acyl-CoA is one of the substrates for the biosynthesis of FAIPEs. We therefore consider increasing the fatty acyl-CoA availability to improve the production of FAIPEs. Previous studies for the production of fatty acid derivatives showed that overexpression of ′TesA and FadD can increase the fatty acyl-CoA availability in E. coli[5, 16]. As an attempt to increase FAIPEs production in E. coli, we sought to overexpress
7
a ′TesA to alleviate the feedback inhibition of β-ketoacyl-ACP synthase by the accumulated fatty acyl-ACPs and a FadD for conversion of fatty acids to fatty acyl-CoA. The overexpression of the TesA’ and FadD gene resulted in an approximately 4-fold increase in FAIPEs production up to 203.4 mg/L and accounted for around 6.4 % (wt/wt) of the dry cell weight (Table 3, 4). The FAIPEs yield and productivity were calculated to be 10.2 mg/g glucose and 7.3 mg/L/h, respectively (Table 4). Besides FAIPEs, the significant formation of fatty acid ethyl esters (FAEEs) were also observed with this recombinant E. coli, as revealed by GC-MS analysis (Figure 2). The biosynthesis of FAEEs was presumed from the esterification of ethanol and fatty acyl-CoA by the WS/DGAT and ethanol was presumed from the acetaldehyde after reduction by ADH. 4. Discussion and Conclusions Recently, Guo and Tao engineered E. coli to produce fatty acid isobutyl esters and fatty acid isoamyl esters through combination of the fatty acid biosynthetic pathway and the branched-chain amino acid biosynthetic pathway whose production were 209 mg/L and 273 mg/L, respectively[16, 18]. Teo et al further engineered S. cerevisiae to produce fatty acid isobutyl esters and fatty acid isoamyl esters with production over 230mg/L [19]. Nevertheless, as for the biosynthesis of FAIPEs as the main products, it is the first time that producing FAIPEs via engineered microorganism in this paper to date. Here we report on a strategy to establish biosynthesis of FAIPEs in engineered E. coli through combination of the fatty acid biosynthetic pathway and the acetone biosynthetic pathway. This FAIPEs production
8
system resulted in the yield of up to 203.4 mg/L and accounted for around 6.4 % (wt/wt) of the dry cell weight. This study shows a likely method for production of FAIPEs as aim product via engineered microorganism and provides some genetic engineering strategies developed to increase fatty acyl-CoA availability to improve the yield of FAIPEs. Furthermore, it is highly imperative that additional work (such as increase of intermediate supply, balance the two precursor substrates fatty acyl-CoAs and isopropanol or choose a more suitable host strain) should be done to reach commercial target levels of FAIPEs in the future. Acknowledgements This study was funded by National Natural Science Foundation of China (81460312), and Foundation of Jiangxi Educational Committee (GJJ150991).
References [1] Caspeta L, Nielsen J. Economic and environmental impacts of microbial biodiesel. Nature biotechnology. 2013;31:789-93. [2] Rabinovitch-Deere CA, Oliver JW, Rodriguez GM, Atsumi S. Synthetic Biology and Metabolic Engineering Approaches To Produce Biofuels. Chemical reviews. 2013. [3] Duan Y, Zhu Z, Cai K, Tan X, Lu X. De novo biosynthesis of biodiesel by Escherichia coli in optimized fed-batch cultivation. PLoS One. 2011;6:e20265. [4] Yu KO, Jung J, Kim SW, Park CH, Han SO. Synthesis of FAEEs from glycerol in engineered Saccharomyces cerevisiae using endogenously produced ethanol by heterologous expression of an
9
unspecific bacterial acyltransferase. Biotechnology and bioengineering. 2012;109:110-5. [5] Steen EJ, Kang Y, Bokinsky G, Hu Z, Schirmer A, McClure A, et al. Microbial production of fatty-acid-derived fuels and chemicals from plant biomass. Nature. 2010;463:559-62. [6] Valle-Rodríguez JO, Shi S, Siewers V, Nielsen J. Metabolic engineering of Saccharomyces cerevisiae for production of fatty acid ethyl esters, an advanced biofuel, by eliminating non-essential fatty acid utilization pathways. Applied Energy. 2014;115:226-32. [7] de Jong BW, Shi S, Siewers V, Nielsen J. Improved production of fatty acid ethyl esters in Saccharomyces cerevisiae through up-regulation of the ethanol degradation pathway and expression of the heterologous phosphoketolase pathway. Microbial cell factories. 2014;13:1. [8] Kalscheuer R, Stölting T, Steinbüchel A. Microdiesel: engineered for fuel production. 2006. [9] Nawabi P, Bauer S, Kyrpides N, Lykidis A. Engineering Escherichia coli for biodiesel production utilizing a bacterial fatty acid methyltransferase. Applied & Environmental Microbiology. 2011;77:8052-61. [10] Knothe G. Dependence of biodiesel fuel properties on the structure of fatty acid alkyl esters. Fuel processing technology. 2005;86:1059-70. [11] Knothe G, Matheaus AC, Ryan III TW. Cetane numbers of branched and straight-chain fatty esters determined in an ignition quality tester. Fuel. 2003;82:971-5. [12] Lee I, Johnson LA, Hammond EG. Use of branched-chain esters to reduce the crystallization temperature of biodiesel. Journal of the American Oil Chemists’ Society. 1995;72:1155-60. [13] Hanai T, Atsumi S, Liao J. Engineered synthetic pathway for isopropanol production in Escherichia coli. Appl Environ Microb. 2007;73:7814-8. [14] Lee J, Jang YS, Choi SJ, Im JA, Song H, Cho JH, et al. Metabolic engineering of Clostridium acetobutylicum ATCC 824 for isopropanol-butanol-ethanol fermentation. Appl Environ Microbiol. 2012;78:1416-23. [15] Guo D, Pan H, Li X. Metabolic engineering of Escherichia coli for production of biodiesel from fatty alcohols and acetyl-CoA. Applied microbiology and biotechnology. 2015;99:7805-12. [16] Guo D, Zhu J, Deng Z, Liu T. Metabolic engineering of Escherichia coli for production of fatty acid short-chain esters through combination of the fatty acid and 2-keto acid pathways. Metabolic engineering. 2014;22:69-75. [17] Garti N, Sato K. Crystallization and polymorphism of fats and fatty acids: M. Dekker; 1988. [18] Tao H, Guo D, Zhang Y, Deng Z, Liu T. Metabolic engineering of microbes for branched-chain biodiesel production with low-temperature property. Biotechnology for biofuels. 2015;8:1. [19] Teo WS, Ling H, Yu A-Q, Chang MW. Metabolic engineering of Saccharomyces cerevisiae for production of fatty acid short-and branched-chain alkyl esters biodiesel. Biotechnology for biofuels. 2015;8:1.
10
Figure legends Figure 1. Engineered pathways for production of FAIPEs. Isopropanol was produced from acetone biosynthetic pathways by overexpressing atoB, atoAD, ADC, ADH; FAIPEs were produced through the combination of acetone and fatty acid biosynthetic pathways. The enzymes encoded by the genes shown are: FadD, fatty acyl-CoA synthetase; WS/DGAT, acyltransferase; ′TesA, a truncated fatty acyl-ACP thioesterase; fadE, acyl-CoA dehydrogenase; atoB, acetyl-CoA acetyltransferase; atoAD, acetoacetyl-CoA transferase; ADC, acetoacetate decarboxylase; ADH, NADP-dependent alcohol dehydrogenase.
11
Figure 2. GC/MS analyses of FAIPEs and other fatty acid short-chain esters from the combination of acetone and fatty acid biosynthetic pathways in engineered E. coli strains in shake flasks for 28h. Identified substances: A, Isopropyl Dodecanoate; B, Isopropyl Tetradecenoate; C, Isopropyl Myristate; D, Isopropyl Palmitoleate; E, Isopropyl Palmitate; F, Isopropyl Oleate; 1, Methyl Pentadecanoate (internal standard); 2, Ethyl Tetradecenoate; 3, Ethyl Myristate; 4, Ethyl Palmitoleate; 5, Ethyl Palmitate; 6, Ethyl Oleate;
12
Table 1. Primers used in this study. Primer name
Sequence (5’-3’)
ATTTCTAGAAACTTTAAGAAGGAGATATAATGCG CCCATTACATCCGATT ACAGGATCCACTAGTTTAATTGGCTGTTTTAATAT WS/DGAT-SpeI-BamHI CTTCCTGC TATCTAGAAATAATTTTGTTTAACTTTAAGAGGAG ADC-XbaI ATATAATGCTGAAAGACGAGGTGATCAAA ACTGGATCCACTAGTTTACTTCAGGTAGTCGTAG ADC-SpeI-BamHI ATCACCTC GATCTAGAAATAATTTTGTTTAACTTTAAGAGGA ADH-XbaI GATATAATGAAGGGCTTCGCCATGCT ACTGGATCCACTAGTTTACAGGATCACCACTGCC ADH-SpeI-BamHI TTGAT GTATCTAGAAAGAGGAGATATAATGAAAAATTGT atoB-XbaI GTCATCGTCAGTGC ACTGGATCCACTAGTTTAATTCAACCGTTCAATCA atoB-SpeI-BamHI CCATCG GTATCTAGAAAGAGGAGATATAATGAAAACAAA atoAD-XbaI ATTGATGACATTACAAGAC ACTGGATCCACTAGTTCATAAATCACCCCGTTGCG atoAD-SpeI-BamHI TAT WS/DGAT-XbaI
′TesA-SacI
AGATGAGCTCATGGCGGACACGTTATTGATTCTGG
′TesA-SpeI
TGTACTAGTTTATGAGTCATGATTTACTAAAGGCTG C
13
Table 2. Plasmids used in this study. Replication Plasmids
Overexpressed genes
Resistance Source
origin pDG50
pBR322
PT7: ws/dgat
Kan
This study
Kan
This study
PT7: ws/dgat, adc and pDG51
pBR322 adh
pDG52
pBBR1
PT7: atoAD and atoB
Chl
This study
pDG53
pBR322
PT7: fadD
Kan
This study
Kan
This study
Chl
This study
PT7: pDG54
ws/dgat,
adc,
pBR322 adh and fadD PT7:
pDG55
atoAD,
pBBR1 and ′tesA
14
atoB
Table 3. FAIPEs productionin in engineered E. coil strainsthrough the combination of acetone and fatty acid biosynthetic pathways in shake flasks for 28h. All experiments were performed in triplicate and calculated the average. Strain mg/L a
DG001/ pDG51/pDG52
b
DG001/ pDG54/pDG55
Isopropyl Dodecanoate
9.5
Ethyl Tetradecenoate
14.7
Ethyl Myristate
42.3
Isopropyl Tetradecenoate
22.5
Isopropyl Myristate
115.6
Ethyl Palmitoleate
38.2
Ethyl Palmitate
9.8
Isopropyl Palmitoleate
16.9
32.7
Isopropyl Palmitate
28.5
12.3
Ethyl Oleate
7.2
Isopropyl Oleate
5.9
10.8
Total of FAIPEs
51.3
203.4
Total of fatty acid esters
51.3
306.1
a
expressing atoB, atoAD, ADC, ADH and WS/DGAT;
b
expressing atoB, atoAD, ADC, ADH, WS/DGAT, FadD and ‘TesA
15
Table 4. The dry cell weight (DCM), FAIPEs/DCM (wt%wt), yield and productivity calculations in engineered E. coli strains in shake flasks for 28h. All experiments were performed in triplicate and calculated the average. DCW
FAIPEs (%
Yield (mg/g
Productivity
(g/L)
DCM)
glucose)
(mg/L/h)
Strain
a
DG001/pDG51/pPG52
3.3
1.6
2.6
1.8
b
DG001/pDG54/pPG55
3.2
6.4
10.2
7.3
a
expressing atoB, atoAD, ADC, ADH and WS/DGAT;
b
expressing atoB, atoAD, ADC, ADH, WS/DGAT, FadD and ‘TesA
16
S0141-0229(17)30056-X http://dx.doi.org/doi:10.1016/j.enzmictec.2017.03.012 EMT 9062
To appear in:
Enzyme and Microbial Technology
Received date: Revised date: Accepted date:
4-10-2016 23-3-2017 26-3-2017
Please cite this article as: Pan Hong, Zhang Lihua, Li Xun, Guo Daoyi.Biosynthesis of the fatty acid isopropyl esters by engineered Escherichia coli.Enzyme and Microbial Technology http://dx.doi.org/10.1016/j.enzmictec.2017.03.012 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Biosynthesis of the fatty acid isopropyl esters by engineered Escherichia coli
Hong Pan1,2, Lihua Zhang1,2, Xun Li2 , Daoyi Guo1,2*
1. National Navel Orange Engineering Research Center, College of Life and
Environmental Sciences, Gannan Normal University.
2. Key Laboratory of Organo-Pharmaceutical Chemistry, Jiangxi Province, Gannan
Normal University, Ganzhou 341000, People’s Republic of China.
Corresponding author: Tel: +86-797-8353936; E-mail address: [email protected]
1
Highlights
Design and assembly of an artificial the fatty acid isopropyl esters biosynthetic pathway in E. coli
Improvement of the fatty acid isopropyl esters production in E. coli by increasing the fatty acyl-CoA availability
Abstract: The fatty acid methyl esters and fatty acid ethyl esters are known as biodiesels which are considered to be renewable, nontoxic and biodegradable biofuels. However, the conventional biodiesels show a high crystallization temperature which is one of the most critical obstacles against the widespread biodiesel usage. The high crystallization temperature of biodiesel can be reduced by replacing the methyl or ethyl ester with an isopropyl moiety. Here we report on a strategy to establish biosynthesis of the fatty acid isopropyl esters(FAIPEs) from the simple substrate glucose in Escherichia coli with heterologous coexpression of atoB encoded acetyl-CoA acetyltransferase and atoAD encode acetoacetyl-CoA transferase from E. coli, ADC encode acetoacetate decarboxylase from Clostridium acetobutylicum, ADH encoded NADP-dependent alcohol dehydrogenase from Clostridium beijerinckii, ‘TesA encoded a truncated fatty acyl-ACP thioesterase and FadD encoded fatty acyl-CoA synthetase from E. coli, and the WS/DGAT encoded acyltransferase from Acinetobacter baylyi strain ADP1. It was found that the yield of FAIPEs was up to 2
203.4 mg/L and accounted for around 6.4 % (wt/wt) of the dry cell weight. Our results indicates that it is a feasible strategy to improve the yield of FAIPEs by increasing fatty acyl-CoA availability in biosynthetic pathway and exhibit a promising method for production of biodiesels with good low-temperature flow properties.
Keywords: fatty acid isopropyl esters; isopropanol; biodiesel; WS/DGAT.
1. Introduction Biodiesel, a kind of environmentally friendly biofuels, has been receiving more attention because of the increasing energy demand and environmental consciousness [1]. Recently, the biosynthesis of fatty acid methyl esters (FAMEs) or fatty acid ethyl esters (FAEEs) in engineered Escherichia coli or Saccharomyces cerevisiae was reported[2-9]. However, FAMEs and FAEEs show a high crystallization temperature than diesel fuel, so they crystallize at temperatures below -0°C. These formed crystals can cause operation problems because they can plug the fuel lines and filters, which impedes the widespread biodiesel usage[10, 11]. Crystallization involves the arrangement of molecules in an orderly pattern. Crystallization temperatures reduced, when branches are introduced into linear, long-chain esters. Thus, the high crystallization temperature of biodiesel can be reduced by replacing the methyl or ethyl ester with a branched moiety. Lee et al prepared the fatty acid isopropyl esters (FAIPEs) by chemical method and examined their crystallization temperature, and
3
showed that the FAIPEs can greatly reduce the crystallization temperature, compared with the common fatty acid methyl esters [12]. Clostridium acetobutylicum naturally produces acetone which can be converted into isopropanol by introducing a secondary alcohol dehydrogenase[13, 14]. So these corresponding FAIPEs can be biosynthesized in the isopropanol-producing microorganism by the esterification of isopropanol and fatty acyl-CoA. Here, we showed the biosynthesis of FAIPEs from glucose in engineered E. coli for the first time by co-expressing the atoB (acetyl-CoA acetyltransferase from E. coli), atoAD (acetoacetyl-CoA transferase from E. coli), ADC (acetoacetate decarboxylase from Clostridium
acetobutylicum
DSM1713),
ADH
(NADP-dependent
alcohol
dehydrogenase from Clostridium beijerinckii DSM1739) genes for the production of isopropanol, and the WS/DGAT (acyltransferase from Acinetobacter baylyi strain ADP1) gene for catalytic esterification of isopropanol and fatty acyl-coenzyme A (Fig.1). In addition, we further showed overexpression of ′tesA (encoding a truncated fatty acyl-ACP thioesterase) and FadD (fatty acyl-CoA synthetase) gene results in a greater FAIPEs production by increasing the fatty acyl-CoA availability. 2. Material and Methods 2.1 Enzymes, DNA kits, and bacterial strains PCR polymerase and T4 ligase were purchased from New England Biolabs. Plasmid mini kits, PCR purification kits, and gel extraction kits were provided by Takara (China, Dalian), and used according to manufacturer’s instructions. E. coli DH5a (Stratagene; La Jolla, CA, USA) was used to propagate all plasmids. E. coli
4
strain DG001was constructed to block fatty acyl-CoA degradation by deleting the fadE gene in strain MG1655 as previously described[15]. 2.2 Plasmid construction for FAIPEs production The WS/DGAT (GenBank WP_004922247.1) gene was amplified by PCR from A.
baylyi
ADP1
genomic
DNA
using
primers
WS/DGAT-XbaI
and
WS/DGAT-SpeI-BamHI, and inserted into pET28a(+) to give pDG50. ADH (GenBank AF157307.2) and ADC (GenBank NC_001988.2) gene from C. beijerinckii and C. acetobutylicum were synthesized and provided by GenScript. The ADH and ADC
gene
were
individually
amplified
by
PCR
using
primers
ADH-XbaI/ADH-SpeI-BamHI and ADC-XbaI/ADC-SpeI-BamHI separately, and individually inserted into pET28a(+). Subsequently, the XbaI-XhoI fragments of ADH and ADC were inserted into pDG50 one by one to give pDG51. The atoB (GenBank CUU94423.1) and atoAD (GenBank EFI19791.1) gene were individually amplified by PCR from E. coli genomic DNA using primers atoB-XbaI/atoB-SpeI-BamHI and atoAD-XbaI/atoAD-SpeI-BamHI separately, and individually inserted into pET28a(+). Subsequently, the XbaI-XhoI fragments of atoB and atoAD were inserted into pBBRMCS1 one by one to give pDG52. The FadD gene (GenBank WP_001764937.1) was amplified by PCR from E. coli genomic DNA using primers FadD-XbaI and FadD-NheI-BamHI, and inserted into pET28a(+) to give pDG53. The XbaI-XhoI fragments of FadD was inserted into SpeI and XhoI sites of pDG51 to give pDG54. The ′tesA gene (a truncated fatty acyl-ACP thioesterase, GenBank ACT42344.1) was amplified by PCR from E. coli genomic DNA using primers ′TesA-SacI
5
and ′TesA-SpeI, and inserted into pDG52 to give pDG55. 2.3 Shake flask cultures A single colony from a freshly transformed E. coli strain from a Luria–Bertani (LB) plate was grown for 10 h in 5 mL of LB medium supplemented with 36 mg/L chloromycetin and/or 50 mg/L kanamycin in a flasks at 37 °C. Cells were collected by centrifugation at 5000 g for 2 min, resuspended in 100 mL modified M9 medium as previously described by Guo[15] and shaken at 30 °C. When the OD600 reached 0.8, isopropyl-β-D-thiogalactopyranoside was added to a final concentration of 0.1 mM. Samples were taken at regular intervals for FAIPEs analysis. 2.4 GC/MS analysis of FAIPEs FAIPEs were extracted using a previously published method[16]. GC/MS analysis of FAIPEs dissolved in hexane phase was done on a Series 7890A GC system equipped with a Series 5975C EI MSD dete, ctor (Aglilent technologies). A 1 μl portion of the hexane phase was analysed after a split 20:1 injection on a DB-5ms capillary column (30 m x 0.25 mm x 0.25μm). Helium was used as carrier gas. The temperatures of the injector and detector were 300°C and 250°C, respectively. The following temperature programme was applied: 100 °C for 10 min, increase of 6°C min to 240°C, 240 °C for 20 min. Quantification was done by using methyl pentadecanoate as internal standard. 3. Results 3.1 Design and assembly of an artificial FAIPEs biosynthetic pathway in E. coli Fatty acid branched-chain esters can reduce the high crystallization temperature
6
[17]. Here, to attempt to produce the FAIPEs with low-temperature operability as aim product through engineered E. coli , we generated and expressed in E. coli an artificial metabolic pathway for the production of FAIPEs. This pathway comprised five gene products: atoB, atoAD, ADC and ADH for the production of isopropanol, and the WS/DGAT gene for catalytic esterification of isopropanol and fatty acyl-coenzyme A. The resulting recombinant E. coli was DG001/pDG51/pDG52. This recombinant E. coli cell was grown in a modified M9 medium, and treated with IPTG to induce expression of the heterologous genes atoB, atoAD, ADC, ADH and WS/DGAT. FAIPEs were extracted from the recombinant E. coli and the control strains, and analyzed by GC-MS (Figure 2). No FAIPEs were detected in the negative control strain E. coli. In contrast, 51.3 mg/L of FAIPEs was formed in the recombinant strains and accounted for around 1.6 % (wt/wt) of the dry cell weight (Table 3, 4). The FAIPEs yield and productivity were calculated to be 2.6 mg/g glucose and 1.8 mg/L/h, respectively (Table 4) . 3.2 Improvement of FAIPEs production in E. coli by increasing the fatty acyl-CoA availability Fatty acyl-CoA is one of the substrates for the biosynthesis of FAIPEs. We therefore consider increasing the fatty acyl-CoA availability to improve the production of FAIPEs. Previous studies for the production of fatty acid derivatives showed that overexpression of ′TesA and FadD can increase the fatty acyl-CoA availability in E. coli[5, 16]. As an attempt to increase FAIPEs production in E. coli, we sought to overexpress
7
a ′TesA to alleviate the feedback inhibition of β-ketoacyl-ACP synthase by the accumulated fatty acyl-ACPs and a FadD for conversion of fatty acids to fatty acyl-CoA. The overexpression of the TesA’ and FadD gene resulted in an approximately 4-fold increase in FAIPEs production up to 203.4 mg/L and accounted for around 6.4 % (wt/wt) of the dry cell weight (Table 3, 4). The FAIPEs yield and productivity were calculated to be 10.2 mg/g glucose and 7.3 mg/L/h, respectively (Table 4). Besides FAIPEs, the significant formation of fatty acid ethyl esters (FAEEs) were also observed with this recombinant E. coli, as revealed by GC-MS analysis (Figure 2). The biosynthesis of FAEEs was presumed from the esterification of ethanol and fatty acyl-CoA by the WS/DGAT and ethanol was presumed from the acetaldehyde after reduction by ADH. 4. Discussion and Conclusions Recently, Guo and Tao engineered E. coli to produce fatty acid isobutyl esters and fatty acid isoamyl esters through combination of the fatty acid biosynthetic pathway and the branched-chain amino acid biosynthetic pathway whose production were 209 mg/L and 273 mg/L, respectively[16, 18]. Teo et al further engineered S. cerevisiae to produce fatty acid isobutyl esters and fatty acid isoamyl esters with production over 230mg/L [19]. Nevertheless, as for the biosynthesis of FAIPEs as the main products, it is the first time that producing FAIPEs via engineered microorganism in this paper to date. Here we report on a strategy to establish biosynthesis of FAIPEs in engineered E. coli through combination of the fatty acid biosynthetic pathway and the acetone biosynthetic pathway. This FAIPEs production
8
system resulted in the yield of up to 203.4 mg/L and accounted for around 6.4 % (wt/wt) of the dry cell weight. This study shows a likely method for production of FAIPEs as aim product via engineered microorganism and provides some genetic engineering strategies developed to increase fatty acyl-CoA availability to improve the yield of FAIPEs. Furthermore, it is highly imperative that additional work (such as increase of intermediate supply, balance the two precursor substrates fatty acyl-CoAs and isopropanol or choose a more suitable host strain) should be done to reach commercial target levels of FAIPEs in the future. Acknowledgements This study was funded by National Natural Science Foundation of China (81460312), and Foundation of Jiangxi Educational Committee (GJJ150991).
References [1] Caspeta L, Nielsen J. Economic and environmental impacts of microbial biodiesel. Nature biotechnology. 2013;31:789-93. [2] Rabinovitch-Deere CA, Oliver JW, Rodriguez GM, Atsumi S. Synthetic Biology and Metabolic Engineering Approaches To Produce Biofuels. Chemical reviews. 2013. [3] Duan Y, Zhu Z, Cai K, Tan X, Lu X. De novo biosynthesis of biodiesel by Escherichia coli in optimized fed-batch cultivation. PLoS One. 2011;6:e20265. [4] Yu KO, Jung J, Kim SW, Park CH, Han SO. Synthesis of FAEEs from glycerol in engineered Saccharomyces cerevisiae using endogenously produced ethanol by heterologous expression of an
9
unspecific bacterial acyltransferase. Biotechnology and bioengineering. 2012;109:110-5. [5] Steen EJ, Kang Y, Bokinsky G, Hu Z, Schirmer A, McClure A, et al. Microbial production of fatty-acid-derived fuels and chemicals from plant biomass. Nature. 2010;463:559-62. [6] Valle-Rodríguez JO, Shi S, Siewers V, Nielsen J. Metabolic engineering of Saccharomyces cerevisiae for production of fatty acid ethyl esters, an advanced biofuel, by eliminating non-essential fatty acid utilization pathways. Applied Energy. 2014;115:226-32. [7] de Jong BW, Shi S, Siewers V, Nielsen J. Improved production of fatty acid ethyl esters in Saccharomyces cerevisiae through up-regulation of the ethanol degradation pathway and expression of the heterologous phosphoketolase pathway. Microbial cell factories. 2014;13:1. [8] Kalscheuer R, Stölting T, Steinbüchel A. Microdiesel: engineered for fuel production. 2006. [9] Nawabi P, Bauer S, Kyrpides N, Lykidis A. Engineering Escherichia coli for biodiesel production utilizing a bacterial fatty acid methyltransferase. Applied & Environmental Microbiology. 2011;77:8052-61. [10] Knothe G. Dependence of biodiesel fuel properties on the structure of fatty acid alkyl esters. Fuel processing technology. 2005;86:1059-70. [11] Knothe G, Matheaus AC, Ryan III TW. Cetane numbers of branched and straight-chain fatty esters determined in an ignition quality tester. Fuel. 2003;82:971-5. [12] Lee I, Johnson LA, Hammond EG. Use of branched-chain esters to reduce the crystallization temperature of biodiesel. Journal of the American Oil Chemists’ Society. 1995;72:1155-60. [13] Hanai T, Atsumi S, Liao J. Engineered synthetic pathway for isopropanol production in Escherichia coli. Appl Environ Microb. 2007;73:7814-8. [14] Lee J, Jang YS, Choi SJ, Im JA, Song H, Cho JH, et al. Metabolic engineering of Clostridium acetobutylicum ATCC 824 for isopropanol-butanol-ethanol fermentation. Appl Environ Microbiol. 2012;78:1416-23. [15] Guo D, Pan H, Li X. Metabolic engineering of Escherichia coli for production of biodiesel from fatty alcohols and acetyl-CoA. Applied microbiology and biotechnology. 2015;99:7805-12. [16] Guo D, Zhu J, Deng Z, Liu T. Metabolic engineering of Escherichia coli for production of fatty acid short-chain esters through combination of the fatty acid and 2-keto acid pathways. Metabolic engineering. 2014;22:69-75. [17] Garti N, Sato K. Crystallization and polymorphism of fats and fatty acids: M. Dekker; 1988. [18] Tao H, Guo D, Zhang Y, Deng Z, Liu T. Metabolic engineering of microbes for branched-chain biodiesel production with low-temperature property. Biotechnology for biofuels. 2015;8:1. [19] Teo WS, Ling H, Yu A-Q, Chang MW. Metabolic engineering of Saccharomyces cerevisiae for production of fatty acid short-and branched-chain alkyl esters biodiesel. Biotechnology for biofuels. 2015;8:1.
10
Figure legends Figure 1. Engineered pathways for production of FAIPEs. Isopropanol was produced from acetone biosynthetic pathways by overexpressing atoB, atoAD, ADC, ADH; FAIPEs were produced through the combination of acetone and fatty acid biosynthetic pathways. The enzymes encoded by the genes shown are: FadD, fatty acyl-CoA synthetase; WS/DGAT, acyltransferase; ′TesA, a truncated fatty acyl-ACP thioesterase; fadE, acyl-CoA dehydrogenase; atoB, acetyl-CoA acetyltransferase; atoAD, acetoacetyl-CoA transferase; ADC, acetoacetate decarboxylase; ADH, NADP-dependent alcohol dehydrogenase.
11
Figure 2. GC/MS analyses of FAIPEs and other fatty acid short-chain esters from the combination of acetone and fatty acid biosynthetic pathways in engineered E. coli strains in shake flasks for 28h. Identified substances: A, Isopropyl Dodecanoate; B, Isopropyl Tetradecenoate; C, Isopropyl Myristate; D, Isopropyl Palmitoleate; E, Isopropyl Palmitate; F, Isopropyl Oleate; 1, Methyl Pentadecanoate (internal standard); 2, Ethyl Tetradecenoate; 3, Ethyl Myristate; 4, Ethyl Palmitoleate; 5, Ethyl Palmitate; 6, Ethyl Oleate;
12
Table 1. Primers used in this study. Primer name
Sequence (5’-3’)
ATTTCTAGAAACTTTAAGAAGGAGATATAATGCG CCCATTACATCCGATT ACAGGATCCACTAGTTTAATTGGCTGTTTTAATAT WS/DGAT-SpeI-BamHI CTTCCTGC TATCTAGAAATAATTTTGTTTAACTTTAAGAGGAG ADC-XbaI ATATAATGCTGAAAGACGAGGTGATCAAA ACTGGATCCACTAGTTTACTTCAGGTAGTCGTAG ADC-SpeI-BamHI ATCACCTC GATCTAGAAATAATTTTGTTTAACTTTAAGAGGA ADH-XbaI GATATAATGAAGGGCTTCGCCATGCT ACTGGATCCACTAGTTTACAGGATCACCACTGCC ADH-SpeI-BamHI TTGAT GTATCTAGAAAGAGGAGATATAATGAAAAATTGT atoB-XbaI GTCATCGTCAGTGC ACTGGATCCACTAGTTTAATTCAACCGTTCAATCA atoB-SpeI-BamHI CCATCG GTATCTAGAAAGAGGAGATATAATGAAAACAAA atoAD-XbaI ATTGATGACATTACAAGAC ACTGGATCCACTAGTTCATAAATCACCCCGTTGCG atoAD-SpeI-BamHI TAT WS/DGAT-XbaI
′TesA-SacI
AGATGAGCTCATGGCGGACACGTTATTGATTCTGG
′TesA-SpeI
TGTACTAGTTTATGAGTCATGATTTACTAAAGGCTG C
13
Table 2. Plasmids used in this study. Replication Plasmids
Overexpressed genes
Resistance Source
origin pDG50
pBR322
PT7: ws/dgat
Kan
This study
Kan
This study
PT7: ws/dgat, adc and pDG51
pBR322 adh
pDG52
pBBR1
PT7: atoAD and atoB
Chl
This study
pDG53
pBR322
PT7: fadD
Kan
This study
Kan
This study
Chl
This study
PT7: pDG54
ws/dgat,
adc,
pBR322 adh and fadD PT7:
pDG55
atoAD,
pBBR1 and ′tesA
14
atoB
Table 3. FAIPEs productionin in engineered E. coil strainsthrough the combination of acetone and fatty acid biosynthetic pathways in shake flasks for 28h. All experiments were performed in triplicate and calculated the average. Strain mg/L a
DG001/ pDG51/pDG52
b
DG001/ pDG54/pDG55
Isopropyl Dodecanoate
9.5
Ethyl Tetradecenoate
14.7
Ethyl Myristate
42.3
Isopropyl Tetradecenoate
22.5
Isopropyl Myristate
115.6
Ethyl Palmitoleate
38.2
Ethyl Palmitate
9.8
Isopropyl Palmitoleate
16.9
32.7
Isopropyl Palmitate
28.5
12.3
Ethyl Oleate
7.2
Isopropyl Oleate
5.9
10.8
Total of FAIPEs
51.3
203.4
Total of fatty acid esters
51.3
306.1
a
expressing atoB, atoAD, ADC, ADH and WS/DGAT;
b
expressing atoB, atoAD, ADC, ADH, WS/DGAT, FadD and ‘TesA
15
Table 4. The dry cell weight (DCM), FAIPEs/DCM (wt%wt), yield and productivity calculations in engineered E. coli strains in shake flasks for 28h. All experiments were performed in triplicate and calculated the average. DCW
FAIPEs (%
Yield (mg/g
Productivity
(g/L)
DCM)
glucose)
(mg/L/h)
Strain
a
DG001/pDG51/pPG52
3.3
1.6
2.6
1.8
b
DG001/pDG54/pPG55
3.2
6.4
10.2
7.3
a
expressing atoB, atoAD, ADC, ADH and WS/DGAT;
b
expressing atoB, atoAD, ADC, ADH, WS/DGAT, FadD and ‘TesA
16