- Email: [email protected]
Biotechnological Analysis of Caffeic Acid Metabolites Possessing Potent Antinephritic Activity
CHINESE JOURNAL OF BIOTECHNOLOGY Volume 24, Issue 12, December 2008 Online English edition of the Chinese language journal RESEARCH PAPER
Cite this article as: Chin J Biotech, 2008, 24(12), 2140í2141.
Biotechnological Analysis of Caffeic Acid Metabolites Possessing Potent Antinephritic Activity Yulia V. Inyushkina, Konstantin V. Kiselev, and Victor P. Bulgakov Biotechnology department, Institute of Biology and Soil Science Far East Branch of Russian Academy of Sciences, Vladivostok 690022, Russia
Abstract: During an investigation of plant cell cultures, which may be useful for the treatment of renal disorders, we established a well-growing E-4 callus culture of Eritrichium sericeum that produced high amounts of caffeic acid metabolites (CAM), (–)-rabdosiin (1.8% dry wt), and rosmarinic acid (RA) (4.6% dry wt). Elicitation of the calli induced an increase in (–)-rabdosiin production by as much as 4.1% dry wt. Oral administration of E-4 callus biomass to rats with induced Masugi-nephritis caused an increased diuresis, lowered creatinine excretion and proteinuria levels, compared with Masugi-nephritis untreated rats. Although all the Masugi-nephritis untreated rats began to suffer, near a quarter of the E-4-treated rats remained in good health. This result indicates that the E-4 culture has a potential to alleviate symptoms associated with nephritis. A mechanism by which production of CAM could be activated in the calli was studied using a high polyphenol-producing cell cultures transformed with rolC gene. We established that the increase of CAM production in rolC-transgenic E. sericeum calli positively correlated with high expression of the CYP98A3 gene, a key gene for RA biosynthesis. Keywords: caffeic acid metabolites; cell culture; experimental glomerulonephritis; CYP98
Introduction Caffeic acid metabolites (CAM), such as rosmarinic acid (RA) and its derivatives rabdosiin and lithospermic acid B, show a variety of pharmacological activities, including anti-HIV activity, and rabdosiin was shown to be the most active substance[1,2]. There is a need to develop new, improved, and effective drugs and food additives for prophylaxis and for the treatment of renal disorders associated with nephritis. It is known that RA has a suppressive effect on the progression of glomerulonephritis in an animal model of spontaneous IgA nephropathy[3]. Lithospermic acid B has a stronger protective effect on rats with induced diabetic nephropathy. Lithospermic acid B was proposed to be involved in a mechanism leading to the reduction of urinary protein levels both in laboratory
animals and in humans (diabetic patients)[4]. Such treatment was especially effective in cases where clinical management strategies were difficult to implement[4]. Considering these data, we established Eritrichium sericeum (Boraginaceae) callus and root cultures, which possessed an increased ability to synthesize (–)-rabdosiin and RA[5]. However, E. sericeum callus cultures synthesized much less quantities of CAM than E. sericeum root cultures[6], which restricted their practical usage. Because callus (suspension) cultures have several practical advantages over root cultures (besides hairy roots), it is of considerable interest to obtain a high-producing E. sericeum callus culture. In this study, we report the establishment of a high-rabdosiin-producing E. sericeum callus culture and the data showing the correlation between levels of CAM and expression of a key gene for CAM biosynthesis (CYP98A3).
Received: October 17, 2008; Accepted: November 25, 2008 Corresponding author: Yulia V. Inyushkina. Tel: +7-4232-375279; Fax: +7-4232-310193; E-mail: [email protected] Copyright © 2008, Institute of Microbiology, Chinese Academy of Sciences and Chinese Society for Microbiology. Published by Elsevier BV. All rights reserved.
Yulia V. Inyushkina et al. / Chinese Journal of Biotechnology, 2008, 24(12): 2140–2141
We show that this culture has a potential to alleviate symptoms associated with nephritis.
1
Materials and methods
1.1 Cell cultures and effector and inhibitor treatments Callus cultures Es-vector and Es-rolC of E. sericeum were established as described in the previous study[6]. Transgenicity of the Es-rolC culture was confirmed by real-time polymerase chain reaction (RT-PCR) with primers 5'-CGACGATGATGCTCTGCTTCTAT-3', 5'-GATGCTTG CCTGAGCCCTCTATT-3', and TaqMan probe 5'-ACAAT TGGATGCAAGGCGCACTCCTCACCA -3' according to the study of Giulietti et al[7] The E-4 high-producing line was established from Es-vector primary calli by selection. The callus lines were cultivated in the dark at 25oC with 30-day intervals, using 40 mL of WB/NAA medium[5,8]. Sterile solutions of methyl jasmonate (MeJA) and piroxicam were added to the autoclaved media aseptically in desired concentrations as described in the previous studies[6,9], and cuprum-glycerate complex was added as described in the previous study[10]. 1.2 Analysis of CAM Rabdosiin and RA were isolated from callus cultures and analyzed by 1H, 13C NMR, FAB-MS, UV, IR, and CD methods[5]. Quantitative high performance liquid chromatography determinations of rabdosiin and RA were performed as previously described in the previous study[5]. 1.3 CYP expression RNA was isolated[11] from the high-producing (Es-rolC) and low-producing (Es-vector) cells cultures. RT-PCR analysis was performed as described in the previous study[6]. RNA expression profiles were normalized using the expression of the E. sericeum actin gene (GenBank Accession No. EU293968). The actin gene was amplified with primers 5'-TAYAAYGAGCTTCGTGTTGC-3' and 5'-ACACCATCWCCAGARTCCA-3'. The analysis of CYP expression was performed by using degenerative primers 5'-GARTGGGCWATGGCNGA-3' and 5'-RCACRTTMAC ATRMAC-3' which yielded a 256 bp CYP fragments. Quantitative mRNA analysis was performed by using a DNA 1000 LabChip® Kit and Agilent 2100 Bioanalyzer (Germany). The data are presented as relative fluorescent units normalized to expression of the E. sericeum actin gene. RT-PCR products were sequenced as described in the previous study[6] using an ABI 310 Genetic Analyzer (Applied Biosystems, USA). For sequence analysis, we used BLAST search program, and multiple sequence alignments were performed by ClustalX. Resulting CYP transcripts were subcloned into a pTZ57R/T plasmid using the InsT/Aclone PCR Product Cloning Kit (Fermentas, Lithuania) followed by amplification with M13 primers and sequence analysis.
The amino acid sequences of the fragments of CYP were deduced from the nucleotide sequences with the Gene runner 3.05 program and compared with other CYP proteins known for different plant species. For each cell culture, 30–45 clones of CYP were sequenced. All sequences were numbered in the order of sequencing. These clone sequencing data and data on the total CYP expression assayed with the degenerate primers were used to estimate the expression (in relative units) for each gene. The relative expression was estimated as the total expression normalized to the actin gene expression u percentage of clones of each gene/100[12]. RT-PCR was performed using the following sets of primers and TaqMan probes: 5'-CCCGAAGGCTAATCGTG AGA-3', 5'-GGTAGTCCGTCCACTTGCA-3', and 5'-CAT TTAACACCCCTGCTATGTATGTTGCCATTCAAGCT-3' for actin gene and 5'-TGGYAAGGAACCCAAGAG-3', 5'AAGGCAATTTGGRGAMATCAG-3', and 5'-ATCCAAYCAC ACGATCTAGTTCTTCTTGAGCTTTCTGTT-3' for CYP98A3 gene according to the study of Giulietti et al[7]. 1.4 Induction of Masugi-nephritis and E-4 biomass administration The experiment was performed as described in the previous study[10]. Rats were randomly assigned to three experimental groups: Group I, intact rats (n = 10); Group II, untreated Masugi-nephritis rats (n = 14); and Group III, E-4-treated Masugi-nephritis rats (n = 13). Following the induction of nephritis, animals were treated with E-4 callus suspension by a stomach pump once daily (100 mg fine-powdered E-4 calli in 2% starch suspension/kg body weight) for 30 days. One-way analysis of variance (ANOVA) followed by a multiple comparison procedure according to Fisher’s protected least significant difference post-hoc test was used for the inter-group comparison, and Dunnett's post-hoc test was used for data analysis within each group.
2
Results
2.1 Establishment and analysis of a highly productive cell line The selection strategy was aimed at selecting vigorously-growing light-brown cell aggregates isolated from the Es-vector primary callus culture. More than 20 subcultures were necessary to obtain actively-growing homogenous calli (E-4 line) with an increased ability to produce polyphenols. The polyphenol content increased from 2.7% to 6.3% and was stable during prolonged periods (more than 2 years) of the E-4 calli cultivation. Other commonly used methods, such as the manipulation of sucrose content and ammonium/nitrogen ratio and precursor feeding as well as the use of piroxicam, an inductor of shikimate-derived secondary metabolism[9], were either inefficient or decreased the growth of the calli. We found that MeJA, in concentrations of 1.0 PM and 5.0 PM,
Yulia V. Inyushkina et al. / Chinese Journal of Biotechnology, 2008, 24(12): 2140–2141
stimulated both rabdosiin and RA biosynthesis, thus causing a 20%–38% increase in total polyphenol production. The contents of RA and rabdosiin in the elicited calli were 5.39% and 2.56%, respectively. Addition of Cu2+-glycerate into the nutrient medium at a relatively high dose, 0.25 mg/L, resulted in increased rabdosiin production, up to 4.1%, without alterations in total content of polyphenols. 2.2 CYP expression We investigated CYP expression in the low-producing (Es-vector) and high-producing (Es-rolC) calli. At the time of this study, the Es-vector calli produced 2.8%± 0.3% DW CAM and the rolC-transgenic culture produced 5.06% ± 0.6% DW. RT-PCR was carried out with degenerate primers using total RNA from the control and rolC-transformed E. sericeum callus cultures as templates, and cDNA fragments of the predicted lengths (256 bp) were amplified (Fig. 1A). Quantitative investigation of CYP expression showed that the total levels of expression in high- and low-CAM containing calli were not altered (Fig. 1B). The sequence analyses yielded three CYP genes from E. sericeum: CYP98A1, CYP98A2, and CYP98A3 (GenBank Accession Nos. EU494971, EU494972, and EU494973, respectively). Amino acid sequences of E. sericeum CYP fragments were deduced from the nucleotide sequences. Alignment of these sequences with other CYP proteins from different plant species allowed us to attribute all these sequences to CYP98 family of cytochrome P450 (Fig. 2) which are known to encode 3'-hydroxylases of coumaroyl esters involving in polyphenolic production in plant cells[13]. However, the ratio between different genes was not similar in the cultures. We found a 94% sequence identity between E. sericeum CYP98A3 and CYP98A6 from Lithospermum erythrorhizon (Boraginaceae), suggesting a similarity in functions, specifically, in biosynthesis of RA.
The number of CYP98A3 transcripts was 5-fold higher in cells with increased levels of polyphenols (Fig. 3). These data were confirmed by RT-PCR that showed a similar 3.6-fold higher level of CYP98A3 transcripts in the Es-rolC calli compared with the Es-vector culture. Thus, the increase of CAM in E. sericeum calli could be due to high expression of the CYP98A3 gene.
Fig. 1 Analysis of CYP gene expression in callus cultures of E. sericeum RT-PCR followed by quantification with the microchip DNA technology Total RNA was isolated from 35-day calli. (A) Electrophoretic separation of E. sericeum RT-PCR products amplified with degenerate primers. 1,2: Es-vector culture, dilution of templates 1:3 and 1:1, respectively; 3, 4, Es-rolC culture, dilution of templates 1:3 and 1:1; Nc: negative control (PCR mixture without plant cDNA); M: synthetic marker. (B) Quantification of E. sericeum CYP transcripts by microchip technology. The data are based on three separate experiments and are presented as relative fluorescent units (r.u.) (Mean ± SE) normalized to expression of the E. sericeum actin gene
Fig. 2 A phylogenetic tree showing relationship between deduced amino acid sequences of E. sericeum CYP and some other plant P450s The amino acid sequences were aligned using ClustalX. CS3’H, p-coumaroyl shikimate 3'-hydroxylase; HCE3H, hydroxycinnamoyl ester-3-hydroxylase; F3’H, flavonoid -3'-hydroxylase; C4H, cinnamic acid 4-hydroxylase; ABA 8'H, abscisic acid 8'-hydroxylase
Yulia V. Inyushkina et al. / Chinese Journal of Biotechnology, 2008, 24(12): 2140–2141
Fig. 3 Relative CYP genes expression levels in low-producing (Es-vector) and high-producing (Es-rolC) calli of E. sericeum calculated as total CYP expression x percentage of clones of each gene/100 The data are presented as relative units normalized to expression of the E. sericeum actin genes
Our data agree with previously reported results[14], which showed a strong correlation between activation of RA production and enhanced CYP98A6 expression in suspension cultures of L. erythrorhizon. 2.3 Effect of dry E-4 callus biomass on diuresis, creatinine, and protein excretion in Masugi-nephritis rats The oral administration of E-4 calli (100 mg/kg animal body wt) for 30 days increased diuresis with a mean value of 38% (4.5 mL/d in Group II vs. 6.2 mL/d in Group III), lowered creatinine excretion to 29% (27.3 ȝmol/d in Group II vs. 21.2 ȝmol/d in Group III), and decreased protein excretion to 36% (53.4 mg/d in Group II vs. 39.2 mg/d in Group III). All these changes are statistically significant (ANOVA followed by Fisher's test). In Group II, a persistent increase in the protein level was observed during the experiment, whereas in Group III, a decrease in the protein level was observed on days 30 and 35, in spite of the E-4 administration was stopped on day 30. The most promising effect of the E-4 calli is that near a quarter of rats (23% of total number of experimental animals) in Group III (E-4-treated rats) did not show symptoms of glomerulonephritis, and at the end of the experiment, they did not significantly differ from the rats of Group I (intact rats) in behavior and body mass. However, all rats (100%) began to suffer in untreated Group II. The number of animals with profound nephrogenic symptoms was about 2-fold less in Group III (23%) compared with Group II (43%). Thus, the administration of E-4 callus biomass alleviates and in some cases prevents symptoms associated with glomerulonephritis.
rabdosiin during long-term cultivation. In the E-4 calli, content of rabdosiin was increased up to 4.1% dry wt that represents, to our knowledge, the highest yield of rabdosiin reported for natural and biotechnological sources. The study of E. sericeum CYP98A3 gene expression showed a positive correlation between high level of CAM and increased CYP98A3 expression in rolC-transformed calli of E. sericeum. This result indicates the possibility of improving CAM content by engineering plant metabolic pathways. The biomass of the E-4 calli, administrated orally to Masugi-nephritis rats, alleviated symptoms associated with glomerulonephritis[15]. A detailed study of phenolic compounds in the E. sericeum callus and root cultures showed that RA and rabdosiin are predominant CAM synthesized by these cultures[5], and the daily dose of CAM used was as low as 6.0 mg (1.5 mg of rabdosiin and 4.5 mg of RA in 100 mg of dry biomass). This value is less than that used for the treatment of rats with the rabdosiin analog, a salt of lithospermic acid B (20 mg/kg/d, administrated by intramuscular injections for 8 weeks), during induced diabetic nephropathy[4]. Similarly, a higher dose of RA (100 mg/kg/d for 8 days, orally administrated) was used for the treatment of mesangioproliferative glomerulonephritis in rats[3]. It seems that rabdosiin and RA would have a profound effect on nephritis, and an adequate proportion between these substances ensures high effect of the E-4 callus biomass.
4
Conclusions
Thus, the combination of RA and rabdosiin may have a favorable effect for the treatment of nephropathy. This proposition should be investigated in future experiments to test not only the impact of each individual substance on the observed pharmacological effects but also to determine the most efficient combination of RA and rabdosiin for treatment of renal disorders. Such possibility exists because we can now manipulate the proportion of RA and rabdosiin in callus cultures by addition of elicitors.
REFERENCES [1]
Tewtrakul S, Miyashiro H, Nakamura N, et al. HIV-1 integrase inhibitory substances from Coleus parvifolius. Phytother Res, 2003, 17: 232239.
[2]
Kashiwada Y, Nishizawa M, Yamagishi T, et al. Anti-AIDS agents, 18. Sodium and potassium salts of caffeic acid
3
Discussion
tetramers from Arnebia euchroma as anti-HIV agents. J Nat Prod, 1995, 58: 392400.
In this study, we report the establishment of the highly productive and well-growing E-4 callus culture of E. sericeum, which produces high amounts of RA and
[3]
Makino T, Ito M, Kiuchiu F, et al. Inhibitory effect of decoction of Perilla frutescens on cultured murine mesangial cell proliferation and quantative analysis of its active
Yulia V. Inyushkina et al. / Chinese Journal of Biotechnology, 2008, 24(12): 2140–2141
constituents. Planta Med, 2001, 67: 2428. [4]
[5]
Li HR, Lee HC, Jung M, et al. Treatment of diabetic
rabdosiin and rosmarinic acid production in Eritrichium
nephropathy and microalbuminuria. United States Patent,
sericeum callus cultures and the effect of the calli on
A61K 035/78; A61K 031/36. 2001-7-31.
Masugi-nephritis in rats. Biosci Biotechnol Biochem, 2007,
Fedoreyev SA, Veselova MV, Krivoschekova OE, et al.
71: 12861293.
Caffeic acid metabolites from Eritrichium sericeum cell cultures. Planta Med, 2005, 71: 446451. [6]
rotundifolia. Plant Mol Biol Reprt, 1999, 17: 269277. [12] Kiselev KV, Gorpenchenko TY, Tchernoded GK, et al.
on rabdosiin and rosmarinic acid production in Eritrichium
Calcium-dependent mechanism of somatic embryogenesis in
sericeum and Lithospermum erythrorhizon transformed cell
Panax ginseng cell cultures expressing the rolC oncogene. Mol Biol (Moscow), 2008, 42: 243252.
Giulietti A, Overbergh L, Valckx D, et al. An overview of
[13] Morant M, Hehn A, Werck-Reichhart D. Conservation and
real-time quantitative PCR: applications to quantify cytokine
diversity of gene families explored using the CODEHOP
Bulgakov VP, Tchernoded GK, Mischenko NP, et al. Effect
strategy in higher plants. BMC Plant Biol, 2002. 2: 7. [14] Matsuno M, Nagatsu A, Ogihara Y, et al. CYP98A6 from
of salicylic acid, methyl jasmonate, ethephon and cantharidin
Lithospermum
on anthraquinone production by Rubia cordifolia callus
hydroxyphenyllactic
cultures transformed with the rolB and rolC genes. J
rosmarinic acid biosynthesis. FEBS Lett, 2002, 13:
Biotechnol, 2002, 97: 213221. [9]
DNA and RNA from leaves of the carnivorous plant Drosera
Inhibitory effect of the Agrobacterium rhizogenes rolC gene
gene expression. Methods, 2001, 25: 386401. [8]
[11] Bekesiova I, Nap JP, Mlynarova L. Isolation of high quality
Bulgakov VP, Veselova MV, Tchernoded GK, et al.
cultures. Planta, 2005, 221: 471478. [7]
[10] Inyushkina YV, Bulgakov VP, Veselova MV, et al. High
erythrorizon acid
encodes
4-coumaroy-4ƍ-
3-hydroxylase
involved
in
219224.
Bulgakov VP, Tchernoded GK, Mischenko NP, et al. The
[15] Matsuo Y, Takagawa I, Koshida H, et al. Antiproteinuric
rolB and rolC genes activate synthesis of anthraquinones in
effect of a thromboxane receptor antagonist, S-1452, on rat
Rubia cordifolia cells by mechanism independent of octadecanoid
diabetic
signaling pathway. Plant Sci, 2004, 166: 10691075.
Pharmacology, 1995, 50: 18.
nephropathy
and
murine
lupus
nephritis.
Cite this article as: Chin J Biotech, 2008, 24(12), 2140í2141.
Biotechnological Analysis of Caffeic Acid Metabolites Possessing Potent Antinephritic Activity Yulia V. Inyushkina, Konstantin V. Kiselev, and Victor P. Bulgakov Biotechnology department, Institute of Biology and Soil Science Far East Branch of Russian Academy of Sciences, Vladivostok 690022, Russia
Abstract: During an investigation of plant cell cultures, which may be useful for the treatment of renal disorders, we established a well-growing E-4 callus culture of Eritrichium sericeum that produced high amounts of caffeic acid metabolites (CAM), (–)-rabdosiin (1.8% dry wt), and rosmarinic acid (RA) (4.6% dry wt). Elicitation of the calli induced an increase in (–)-rabdosiin production by as much as 4.1% dry wt. Oral administration of E-4 callus biomass to rats with induced Masugi-nephritis caused an increased diuresis, lowered creatinine excretion and proteinuria levels, compared with Masugi-nephritis untreated rats. Although all the Masugi-nephritis untreated rats began to suffer, near a quarter of the E-4-treated rats remained in good health. This result indicates that the E-4 culture has a potential to alleviate symptoms associated with nephritis. A mechanism by which production of CAM could be activated in the calli was studied using a high polyphenol-producing cell cultures transformed with rolC gene. We established that the increase of CAM production in rolC-transgenic E. sericeum calli positively correlated with high expression of the CYP98A3 gene, a key gene for RA biosynthesis. Keywords: caffeic acid metabolites; cell culture; experimental glomerulonephritis; CYP98
Introduction Caffeic acid metabolites (CAM), such as rosmarinic acid (RA) and its derivatives rabdosiin and lithospermic acid B, show a variety of pharmacological activities, including anti-HIV activity, and rabdosiin was shown to be the most active substance[1,2]. There is a need to develop new, improved, and effective drugs and food additives for prophylaxis and for the treatment of renal disorders associated with nephritis. It is known that RA has a suppressive effect on the progression of glomerulonephritis in an animal model of spontaneous IgA nephropathy[3]. Lithospermic acid B has a stronger protective effect on rats with induced diabetic nephropathy. Lithospermic acid B was proposed to be involved in a mechanism leading to the reduction of urinary protein levels both in laboratory
animals and in humans (diabetic patients)[4]. Such treatment was especially effective in cases where clinical management strategies were difficult to implement[4]. Considering these data, we established Eritrichium sericeum (Boraginaceae) callus and root cultures, which possessed an increased ability to synthesize (–)-rabdosiin and RA[5]. However, E. sericeum callus cultures synthesized much less quantities of CAM than E. sericeum root cultures[6], which restricted their practical usage. Because callus (suspension) cultures have several practical advantages over root cultures (besides hairy roots), it is of considerable interest to obtain a high-producing E. sericeum callus culture. In this study, we report the establishment of a high-rabdosiin-producing E. sericeum callus culture and the data showing the correlation between levels of CAM and expression of a key gene for CAM biosynthesis (CYP98A3).
Received: October 17, 2008; Accepted: November 25, 2008 Corresponding author: Yulia V. Inyushkina. Tel: +7-4232-375279; Fax: +7-4232-310193; E-mail: [email protected] Copyright © 2008, Institute of Microbiology, Chinese Academy of Sciences and Chinese Society for Microbiology. Published by Elsevier BV. All rights reserved.
Yulia V. Inyushkina et al. / Chinese Journal of Biotechnology, 2008, 24(12): 2140–2141
We show that this culture has a potential to alleviate symptoms associated with nephritis.
1
Materials and methods
1.1 Cell cultures and effector and inhibitor treatments Callus cultures Es-vector and Es-rolC of E. sericeum were established as described in the previous study[6]. Transgenicity of the Es-rolC culture was confirmed by real-time polymerase chain reaction (RT-PCR) with primers 5'-CGACGATGATGCTCTGCTTCTAT-3', 5'-GATGCTTG CCTGAGCCCTCTATT-3', and TaqMan probe 5'-ACAAT TGGATGCAAGGCGCACTCCTCACCA -3' according to the study of Giulietti et al[7] The E-4 high-producing line was established from Es-vector primary calli by selection. The callus lines were cultivated in the dark at 25oC with 30-day intervals, using 40 mL of WB/NAA medium[5,8]. Sterile solutions of methyl jasmonate (MeJA) and piroxicam were added to the autoclaved media aseptically in desired concentrations as described in the previous studies[6,9], and cuprum-glycerate complex was added as described in the previous study[10]. 1.2 Analysis of CAM Rabdosiin and RA were isolated from callus cultures and analyzed by 1H, 13C NMR, FAB-MS, UV, IR, and CD methods[5]. Quantitative high performance liquid chromatography determinations of rabdosiin and RA were performed as previously described in the previous study[5]. 1.3 CYP expression RNA was isolated[11] from the high-producing (Es-rolC) and low-producing (Es-vector) cells cultures. RT-PCR analysis was performed as described in the previous study[6]. RNA expression profiles were normalized using the expression of the E. sericeum actin gene (GenBank Accession No. EU293968). The actin gene was amplified with primers 5'-TAYAAYGAGCTTCGTGTTGC-3' and 5'-ACACCATCWCCAGARTCCA-3'. The analysis of CYP expression was performed by using degenerative primers 5'-GARTGGGCWATGGCNGA-3' and 5'-RCACRTTMAC ATRMAC-3' which yielded a 256 bp CYP fragments. Quantitative mRNA analysis was performed by using a DNA 1000 LabChip® Kit and Agilent 2100 Bioanalyzer (Germany). The data are presented as relative fluorescent units normalized to expression of the E. sericeum actin gene. RT-PCR products were sequenced as described in the previous study[6] using an ABI 310 Genetic Analyzer (Applied Biosystems, USA). For sequence analysis, we used BLAST search program, and multiple sequence alignments were performed by ClustalX. Resulting CYP transcripts were subcloned into a pTZ57R/T plasmid using the InsT/Aclone PCR Product Cloning Kit (Fermentas, Lithuania) followed by amplification with M13 primers and sequence analysis.
The amino acid sequences of the fragments of CYP were deduced from the nucleotide sequences with the Gene runner 3.05 program and compared with other CYP proteins known for different plant species. For each cell culture, 30–45 clones of CYP were sequenced. All sequences were numbered in the order of sequencing. These clone sequencing data and data on the total CYP expression assayed with the degenerate primers were used to estimate the expression (in relative units) for each gene. The relative expression was estimated as the total expression normalized to the actin gene expression u percentage of clones of each gene/100[12]. RT-PCR was performed using the following sets of primers and TaqMan probes: 5'-CCCGAAGGCTAATCGTG AGA-3', 5'-GGTAGTCCGTCCACTTGCA-3', and 5'-CAT TTAACACCCCTGCTATGTATGTTGCCATTCAAGCT-3' for actin gene and 5'-TGGYAAGGAACCCAAGAG-3', 5'AAGGCAATTTGGRGAMATCAG-3', and 5'-ATCCAAYCAC ACGATCTAGTTCTTCTTGAGCTTTCTGTT-3' for CYP98A3 gene according to the study of Giulietti et al[7]. 1.4 Induction of Masugi-nephritis and E-4 biomass administration The experiment was performed as described in the previous study[10]. Rats were randomly assigned to three experimental groups: Group I, intact rats (n = 10); Group II, untreated Masugi-nephritis rats (n = 14); and Group III, E-4-treated Masugi-nephritis rats (n = 13). Following the induction of nephritis, animals were treated with E-4 callus suspension by a stomach pump once daily (100 mg fine-powdered E-4 calli in 2% starch suspension/kg body weight) for 30 days. One-way analysis of variance (ANOVA) followed by a multiple comparison procedure according to Fisher’s protected least significant difference post-hoc test was used for the inter-group comparison, and Dunnett's post-hoc test was used for data analysis within each group.
2
Results
2.1 Establishment and analysis of a highly productive cell line The selection strategy was aimed at selecting vigorously-growing light-brown cell aggregates isolated from the Es-vector primary callus culture. More than 20 subcultures were necessary to obtain actively-growing homogenous calli (E-4 line) with an increased ability to produce polyphenols. The polyphenol content increased from 2.7% to 6.3% and was stable during prolonged periods (more than 2 years) of the E-4 calli cultivation. Other commonly used methods, such as the manipulation of sucrose content and ammonium/nitrogen ratio and precursor feeding as well as the use of piroxicam, an inductor of shikimate-derived secondary metabolism[9], were either inefficient or decreased the growth of the calli. We found that MeJA, in concentrations of 1.0 PM and 5.0 PM,
Yulia V. Inyushkina et al. / Chinese Journal of Biotechnology, 2008, 24(12): 2140–2141
stimulated both rabdosiin and RA biosynthesis, thus causing a 20%–38% increase in total polyphenol production. The contents of RA and rabdosiin in the elicited calli were 5.39% and 2.56%, respectively. Addition of Cu2+-glycerate into the nutrient medium at a relatively high dose, 0.25 mg/L, resulted in increased rabdosiin production, up to 4.1%, without alterations in total content of polyphenols. 2.2 CYP expression We investigated CYP expression in the low-producing (Es-vector) and high-producing (Es-rolC) calli. At the time of this study, the Es-vector calli produced 2.8%± 0.3% DW CAM and the rolC-transgenic culture produced 5.06% ± 0.6% DW. RT-PCR was carried out with degenerate primers using total RNA from the control and rolC-transformed E. sericeum callus cultures as templates, and cDNA fragments of the predicted lengths (256 bp) were amplified (Fig. 1A). Quantitative investigation of CYP expression showed that the total levels of expression in high- and low-CAM containing calli were not altered (Fig. 1B). The sequence analyses yielded three CYP genes from E. sericeum: CYP98A1, CYP98A2, and CYP98A3 (GenBank Accession Nos. EU494971, EU494972, and EU494973, respectively). Amino acid sequences of E. sericeum CYP fragments were deduced from the nucleotide sequences. Alignment of these sequences with other CYP proteins from different plant species allowed us to attribute all these sequences to CYP98 family of cytochrome P450 (Fig. 2) which are known to encode 3'-hydroxylases of coumaroyl esters involving in polyphenolic production in plant cells[13]. However, the ratio between different genes was not similar in the cultures. We found a 94% sequence identity between E. sericeum CYP98A3 and CYP98A6 from Lithospermum erythrorhizon (Boraginaceae), suggesting a similarity in functions, specifically, in biosynthesis of RA.
The number of CYP98A3 transcripts was 5-fold higher in cells with increased levels of polyphenols (Fig. 3). These data were confirmed by RT-PCR that showed a similar 3.6-fold higher level of CYP98A3 transcripts in the Es-rolC calli compared with the Es-vector culture. Thus, the increase of CAM in E. sericeum calli could be due to high expression of the CYP98A3 gene.
Fig. 1 Analysis of CYP gene expression in callus cultures of E. sericeum RT-PCR followed by quantification with the microchip DNA technology Total RNA was isolated from 35-day calli. (A) Electrophoretic separation of E. sericeum RT-PCR products amplified with degenerate primers. 1,2: Es-vector culture, dilution of templates 1:3 and 1:1, respectively; 3, 4, Es-rolC culture, dilution of templates 1:3 and 1:1; Nc: negative control (PCR mixture without plant cDNA); M: synthetic marker. (B) Quantification of E. sericeum CYP transcripts by microchip technology. The data are based on three separate experiments and are presented as relative fluorescent units (r.u.) (Mean ± SE) normalized to expression of the E. sericeum actin gene
Fig. 2 A phylogenetic tree showing relationship between deduced amino acid sequences of E. sericeum CYP and some other plant P450s The amino acid sequences were aligned using ClustalX. CS3’H, p-coumaroyl shikimate 3'-hydroxylase; HCE3H, hydroxycinnamoyl ester-3-hydroxylase; F3’H, flavonoid -3'-hydroxylase; C4H, cinnamic acid 4-hydroxylase; ABA 8'H, abscisic acid 8'-hydroxylase
Yulia V. Inyushkina et al. / Chinese Journal of Biotechnology, 2008, 24(12): 2140–2141
Fig. 3 Relative CYP genes expression levels in low-producing (Es-vector) and high-producing (Es-rolC) calli of E. sericeum calculated as total CYP expression x percentage of clones of each gene/100 The data are presented as relative units normalized to expression of the E. sericeum actin genes
Our data agree with previously reported results[14], which showed a strong correlation between activation of RA production and enhanced CYP98A6 expression in suspension cultures of L. erythrorhizon. 2.3 Effect of dry E-4 callus biomass on diuresis, creatinine, and protein excretion in Masugi-nephritis rats The oral administration of E-4 calli (100 mg/kg animal body wt) for 30 days increased diuresis with a mean value of 38% (4.5 mL/d in Group II vs. 6.2 mL/d in Group III), lowered creatinine excretion to 29% (27.3 ȝmol/d in Group II vs. 21.2 ȝmol/d in Group III), and decreased protein excretion to 36% (53.4 mg/d in Group II vs. 39.2 mg/d in Group III). All these changes are statistically significant (ANOVA followed by Fisher's test). In Group II, a persistent increase in the protein level was observed during the experiment, whereas in Group III, a decrease in the protein level was observed on days 30 and 35, in spite of the E-4 administration was stopped on day 30. The most promising effect of the E-4 calli is that near a quarter of rats (23% of total number of experimental animals) in Group III (E-4-treated rats) did not show symptoms of glomerulonephritis, and at the end of the experiment, they did not significantly differ from the rats of Group I (intact rats) in behavior and body mass. However, all rats (100%) began to suffer in untreated Group II. The number of animals with profound nephrogenic symptoms was about 2-fold less in Group III (23%) compared with Group II (43%). Thus, the administration of E-4 callus biomass alleviates and in some cases prevents symptoms associated with glomerulonephritis.
rabdosiin during long-term cultivation. In the E-4 calli, content of rabdosiin was increased up to 4.1% dry wt that represents, to our knowledge, the highest yield of rabdosiin reported for natural and biotechnological sources. The study of E. sericeum CYP98A3 gene expression showed a positive correlation between high level of CAM and increased CYP98A3 expression in rolC-transformed calli of E. sericeum. This result indicates the possibility of improving CAM content by engineering plant metabolic pathways. The biomass of the E-4 calli, administrated orally to Masugi-nephritis rats, alleviated symptoms associated with glomerulonephritis[15]. A detailed study of phenolic compounds in the E. sericeum callus and root cultures showed that RA and rabdosiin are predominant CAM synthesized by these cultures[5], and the daily dose of CAM used was as low as 6.0 mg (1.5 mg of rabdosiin and 4.5 mg of RA in 100 mg of dry biomass). This value is less than that used for the treatment of rats with the rabdosiin analog, a salt of lithospermic acid B (20 mg/kg/d, administrated by intramuscular injections for 8 weeks), during induced diabetic nephropathy[4]. Similarly, a higher dose of RA (100 mg/kg/d for 8 days, orally administrated) was used for the treatment of mesangioproliferative glomerulonephritis in rats[3]. It seems that rabdosiin and RA would have a profound effect on nephritis, and an adequate proportion between these substances ensures high effect of the E-4 callus biomass.
4
Conclusions
Thus, the combination of RA and rabdosiin may have a favorable effect for the treatment of nephropathy. This proposition should be investigated in future experiments to test not only the impact of each individual substance on the observed pharmacological effects but also to determine the most efficient combination of RA and rabdosiin for treatment of renal disorders. Such possibility exists because we can now manipulate the proportion of RA and rabdosiin in callus cultures by addition of elicitors.
REFERENCES [1]
Tewtrakul S, Miyashiro H, Nakamura N, et al. HIV-1 integrase inhibitory substances from Coleus parvifolius. Phytother Res, 2003, 17: 232239.
[2]
Kashiwada Y, Nishizawa M, Yamagishi T, et al. Anti-AIDS agents, 18. Sodium and potassium salts of caffeic acid
3
Discussion
tetramers from Arnebia euchroma as anti-HIV agents. J Nat Prod, 1995, 58: 392400.
In this study, we report the establishment of the highly productive and well-growing E-4 callus culture of E. sericeum, which produces high amounts of RA and
[3]
Makino T, Ito M, Kiuchiu F, et al. Inhibitory effect of decoction of Perilla frutescens on cultured murine mesangial cell proliferation and quantative analysis of its active
Yulia V. Inyushkina et al. / Chinese Journal of Biotechnology, 2008, 24(12): 2140–2141
constituents. Planta Med, 2001, 67: 2428. [4]
[5]
Li HR, Lee HC, Jung M, et al. Treatment of diabetic
rabdosiin and rosmarinic acid production in Eritrichium
nephropathy and microalbuminuria. United States Patent,
sericeum callus cultures and the effect of the calli on
A61K 035/78; A61K 031/36. 2001-7-31.
Masugi-nephritis in rats. Biosci Biotechnol Biochem, 2007,
Fedoreyev SA, Veselova MV, Krivoschekova OE, et al.
71: 12861293.
Caffeic acid metabolites from Eritrichium sericeum cell cultures. Planta Med, 2005, 71: 446451. [6]
rotundifolia. Plant Mol Biol Reprt, 1999, 17: 269277. [12] Kiselev KV, Gorpenchenko TY, Tchernoded GK, et al.
on rabdosiin and rosmarinic acid production in Eritrichium
Calcium-dependent mechanism of somatic embryogenesis in
sericeum and Lithospermum erythrorhizon transformed cell
Panax ginseng cell cultures expressing the rolC oncogene. Mol Biol (Moscow), 2008, 42: 243252.
Giulietti A, Overbergh L, Valckx D, et al. An overview of
[13] Morant M, Hehn A, Werck-Reichhart D. Conservation and
real-time quantitative PCR: applications to quantify cytokine
diversity of gene families explored using the CODEHOP
Bulgakov VP, Tchernoded GK, Mischenko NP, et al. Effect
strategy in higher plants. BMC Plant Biol, 2002. 2: 7. [14] Matsuno M, Nagatsu A, Ogihara Y, et al. CYP98A6 from
of salicylic acid, methyl jasmonate, ethephon and cantharidin
Lithospermum
on anthraquinone production by Rubia cordifolia callus
hydroxyphenyllactic
cultures transformed with the rolB and rolC genes. J
rosmarinic acid biosynthesis. FEBS Lett, 2002, 13:
Biotechnol, 2002, 97: 213221. [9]
DNA and RNA from leaves of the carnivorous plant Drosera
Inhibitory effect of the Agrobacterium rhizogenes rolC gene
gene expression. Methods, 2001, 25: 386401. [8]
[11] Bekesiova I, Nap JP, Mlynarova L. Isolation of high quality
Bulgakov VP, Veselova MV, Tchernoded GK, et al.
cultures. Planta, 2005, 221: 471478. [7]
[10] Inyushkina YV, Bulgakov VP, Veselova MV, et al. High
erythrorizon acid
encodes
4-coumaroy-4ƍ-
3-hydroxylase
involved
in
219224.
Bulgakov VP, Tchernoded GK, Mischenko NP, et al. The
[15] Matsuo Y, Takagawa I, Koshida H, et al. Antiproteinuric
rolB and rolC genes activate synthesis of anthraquinones in
effect of a thromboxane receptor antagonist, S-1452, on rat
Rubia cordifolia cells by mechanism independent of octadecanoid
diabetic
signaling pathway. Plant Sci, 2004, 166: 10691075.
Pharmacology, 1995, 50: 18.
nephropathy
and
murine
lupus
nephritis.