- Email: [email protected]
Bisphenol F exposure impairs neurodevelopment in zebrafish larvae (Danio rerio)
Ecotoxicology and Environmental Safety 188 (2020) 109870
Contents lists available at ScienceDirect
Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv
Bisphenol F exposure impairs neurodevelopment in zebrafish larvae (Danio rerio)
T
Jie Gua,b,c,1, Jiang Wub,c,1, Shuqin Xub,c, Liye Zhangb,c, Deling Fana, Lili Shia, Jun Wangb,c, Guixiang Jia,∗ a
Nanjing Institute of Environmental Sciences, Ministry of Ecology and Environment of the People's Republic of China, Nanjing, 210042, China State Key Laboratory of Reproductive Medicine, Institute of Toxicology, Nanjing Medical University, Nanjing, 211166, China c Key Laboratory of Modern Toxicology, Ministry of Education, School of Public Health, Nanjing Medical University, Nanjing, 211166, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: BPF Neurodevelopment Oxidative stress
BPF, a substitute of BPA, has been widely detected in environment and human bodies. Although the genotoxicity, endocrine disrupting effects, reproductive toxicity of BPF has been well documented, its neurodevelopmental toxicity still remains nebulous. In our study, zebrafish embryos were exposed to BPF treatment (0, 7, 70 and 700 μg/L) for 3 or 6 days. Our results showed that BPF exposure markedly decreased zebrafish locomotor behavior, increased oxidative stress, promoted apoptosis and altered brain structure in zebrafish. In addition, the expressions of neurodevelopment related genes were also downregulated upon BPF treatment. In conclusion, our results systematically demonstrated the developmental neurotoxicity of BPF in zebrafish.
1. Introduction The developmental toxicity of Bisphenol A (BPA; 2,2-bis(4-hydroxyphenyl) propane), an endocrine-disrupting chemical (EDC), has been well documented. More and more countries and organizations ban the use of bisphenol A. As a result, some bisphenol A substitutes such as bisphenol F (BPF), bisphenol S (BPS), bisphenol AF (BPAF) have been gradually developed. However, whether these new substitutes are safe is not adequately studied. It is usually considered to be more safer if the estrogenic-like activities is lower and activity of bisphenol A. Currently, Bisphenol F (BPF; 4,4′-methylenediphenol), a homolog of BPA, serves as BPA alternative and is widely used in industrial applications, such as the paper products, personal care products, and food containers (Qiu et al., 2018). BPF is widely distributed in environment. It has been reported that the concentrations of BPF were markedly higher than those of BPA in river and sea waters (Yamazaki et al., 2015). For example, Eriko Yamazaki et al. reported the concentrations of BPF were one to two orders of magnitude higher than those of BPA. In river and sea waters collected from Japan, Korea and China, BPF concentration was as high as 2850 ng/L in the Tamagawa River in Tokyo (Yamazaki et al., 2015). In addition, BPF was found in soft drinks at a mean concentration of
0.180 μg/L (Gallart-Ayala et al., 2011) and dust samples (the entire sample set) (Liao et al., 2012). Notability, in human urine, BPF was also detected, with concentration between 0.15 μg/L and 0.54 μg/L (Ye et al., 2015). Thus, identifying the toxicity of BPF is urgent. Several studies have shown that BPF exhibits genotoxicity, endocrine disrupting effects, reproductive toxicity effects due to its structural similarity to BPA (Yamasaki et al., 2002) (Chen et al., 2016). Audebert et al. reported similar ranges of cytotoxicity for BPA and BPF, whereas the genotoxicity was only observed for BPF (Audebert et al., 2011). BPF impaired the hypothalamic-pituitary-thyroid axis and abnormally increased thyroid hormones and thyroid-stimulating hormone in zebrafish (Huang et al., 2016). Similarly results were also found in xenopus laevis with BPF treatment (Zhu et al., 2018). However, the effect of BPF on brain development still remains unknown. In this study, zebrafish embryos were exposed to different concentration of BPF. The locomotion, oxidative and apoptotic status of zebrafish embryos as well as the expression of neural development genes were determined. Our results demonstrate the developmental neurotoxicity of BPF in zebrafish relatively systematically.
Abbreviations: BPF, 2,2-bis-4-hydroxyphenyl; LC50, Lethal Concentration 50%; CPF, Chlorpyrifos ∗ Corresponding author. Nanjing Institute of Environmental Sciences (NIES), Ministry of Environmental Protection (MEP), 8 Jiangwangmiao street, Nanjing, China. E-mail address: [email protected] (G. Ji). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.ecoenv.2019.109870 Received 15 July 2019; Received in revised form 27 September 2019; Accepted 24 October 2019 0147-6513/ © 2019 Elsevier Inc. All rights reserved.
Ecotoxicology and Environmental Safety 188 (2020) 109870
J. Gu, et al.
2. Materials and methods
transparent membrane treatment with PBSTX were operated in 5 min × 3 times with PBSTX. After that, embryos were digested by protease K (10μg/mL) at 37 °C for 30–45 min, 500μL/tube. Then washed in 1 × PBST in 5 min × 3 times. Refixed in 4%PFA for 10–15 min. And after that, rewashed the embryos in 1 × PBST for 5 min × 6 times. Extract the PBS and add TdT Buffer working fluid. To keep out of the sun and embryos were incubated on ice for an hour, followed by 1 h incubation at 37 °C. Finally, the inverted fluorescence microscope was used for photo analysis and counting. Observe and count the number of green fluorescence points in the head, that is, the number of apoptosis in the brain.
2.1. Zebrafish husbandry AB strain zebrafish (Danio rerio), obtained from the Institute of Hydrobiology of the Chinese Academy of Science (Wuhan, China), were kept in a recirculating system at 28 ± 0.5 °C, with a photoperiod of 14 h light/10 h dark. Fish were fed with freshly hatched brine shrimp (Artemia nauplii) twice a day. Male and female adult fish with a preferable ratio of 2:1 were transferred into mating tanks 1 h prior the light cycle. After spawning, eggs were collected and cleaned with fresh water. All the animal experiments were conducted following the guiding principles for the care and use of animals approved by the animal ethics committee of Nanjing Medical University (Permit number: 2014092).
2.7. Determination of SOD, CAT activities and MDA content The fertilized eggs were treated with BPF for 6 days. A total of 20 living larvae from each treatment were homogenized to for SOD, CAT and MDA analysis. The activities of SOD and CAT were measured as described by Song et al. (2009) and Xu et al. (1997), respectively. The MDA content was detected as described by Han et al. (2016).
2.2. Chemicals and reagents BPF (CAS 620-92-8; purity 99%) was purchased from Tokyo Chemical Industry (Tokyo, Japan). Chlorpyrifos (CAS: 2921-88-2; purity 99%), acridine orange (AO) staining reagent were obtained from Sigma-Aldrich (St. Louis, MO, USA).
2.8. Hematoxylin-eosin (HE) staining The HE staining was conducted as reported previously (Liu et al., 2018). Briefly, fertilized eggs were treated with BPF for 6 days. Then, the zebrafish larvaes were fixed in paraformaldehyde, dehydrated with ethanol, cleared in xylene, embedded in paraffin, and cut into 5 μm sections for HE staining. The stained sections were observed under a microscope (Leica, Germany).
2.3. Calculation of lethal concentration (LC50) value The acute toxicology of BPF to zebrafish embryos were conducted according to the OECD test guidance (OECD, 1998). In brief, twenty zebrafish embryos were cultured in a 6-well plate and exposed to BPF (0, 0.05, 0.25, 1.25, 2, 4, 6, 8, 10, 12 and 14 mg/L) treatment for 96 h. The BPF solutions were renewed daily. The embryos were observed three times a day, and dead ones were recorded and removed. Each treatment was performed in triplicate.
2.9. Immunofluorescence staining The dewaxing sections were blocked with PBS containing 5% goat serum for 1 h, and incubated with primary antibodies (α1-tubulin, Abcam, 1:100; GFAP, Abcam, 1:100) overnight. Then, sections were further incubated with immunofluorescent antibody (Jackson ImmunoResearch, 1:200) and stained with DAPI (Beyotime, China) before examination with a fluorescence microscope (Olympus BX43 Japan).
2.4. Detection of BPF exposure concentration Test samples were filtered using 0.22 μm nylon filters. BPF concentrations in the test samples were measured with an LC-HRMS system composed of an Ultimate 3000 UHPLC system (Thermo Fisher Scientific, CA, USA) equipped with a QExactive Focus Orbitrap mass spectrometer (Thermo Fisher Scientific, CA, USA) operating under selective ion monitoring (SIM) mode. An Infinitylab poroshell 120EC-C18 Column (150 mm × 2.1 m × 2.7 μm, Thermo Fisher, USA) was used to separated analytes under 40 °C, the mobile phase was composed of acetonitrile and 0.1% ammonia (20:80, V/V) at a flow rate of 0.3 mL/ min for 5 min. Meanwhile, the data of sheath pressure is 40arb, as well as 10arb auxiliary pressure and capillary temperature at 350 °C.
2.10. Real-time RT-PCR (qRT-PCR) Total RNA from the 10 living larvae was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. The RNA was reversely transcripted to cDNA using the MMLV RTase (TaKaRa, Tokyo, Japan). The primer sequences for the selected genes were listed in Table 1. The expressions of the indicated genes were normalized to β-actin by using 2−ΔΔCt method (Livak and Schmittgen, 2001). Each sample was performed in triplicate.
2.5. Locomotion analysis The locomotion analysis was conducted as reported previously (Nery et al., 2014). In brief, fertilized eggs were exposed to BPF treatment in a 24-well plate for 6 days. The BPF solutions were renewed daily. Before the locomotion analysis by the Danio vision (Noldus, Netherlands), the exposure solutions were changed to clean water. Free swimming activities during visible light (25 min) and dark (25 min) were recorded. Each treatment was performed in triplicate. The total swimming distance during moving time were calculated by EthoVision.
2.11. Whole mount in situ hybridization (WISH)
2.6. TUNEL staining
2.12. Statistical analysis
The TUNEL staining of zebrafish was conducted as reported previously (Barrallo-Gimeno et al., 2004). First, in order to remove melanin before 24hpf, we added PTU to zebrafish embryos which were exposed to BPF (0, 7, 70 and 700 μg/L) at 4hpf. After 24hpf, the embryos treated with chain ProE were collected in 1.5ml centrifuge tube. 4%PFA was used to fix the tissue overnight in a cold storage at 4 °C. The
All experiments were performed in triplicate and independently repeated at least twice. Statistically differences were analyzed by one way ANOVA or Student's t-test (mean ± SEM) using SPSS (version 20.0) or GraphPad Prism (version 5.0). P < 0.05 was designated as significance. Trimmed Spearman-Karber Method (Version 1.5, USEPA) was used to calculate the LC50 and 95% confidence interval (CI).
WISH was performed as described (Harland, 1991). In brief, embryos or larvae were grown in 0.003% 1-phenyl-2-thiourea (PTU; Sigma) until 3 dpf. Then, zebrafish were hybridized with indicated probes overnight at 55 °C. On the next day, the zebrafish were washed and incubated with an alkaline phosphatase-conjugated antibody (Roche Diagnostics) at a dilution of 1:1500.
2
Ecotoxicology and Environmental Safety 188 (2020) 109870
J. Gu, et al.
Table 1 Sequences of primers for the genes tested. Target Gene
GenBank Accession No.
Primer Sequences
β-actin
AF025305
α1-tubulin
NM_194388
elavl3
NM_131449
mbp
AY860977
Syn2a
NM_001002597
gfap
NM_131373
Cat
NM_130912.2
Sod1
NM_131294.1
Forward: 5′-ACAGGGAAAAGATGACACAGATCA-3′ Reverse: 5′-CAGCCTGGATGGCAACGTA-3′ Forward: 5′- AAT CAC CAA TGC TTG CTT CGA GCC-3′ Reverse: 5′- TTC ACG TCT TTG GGT ACC ACG TCA-3′ Forward: 5′- AGA CAA GAT CAC AGG CCA GAG CTT-3′ Reverse: 5′- TGG TCT GCA GTT TGA GAC CGT TGA-3′ Forward: 5′-AATCAGCAGGTTCTTCGGAGGAGA-3′ Reverse: 5′-AAGAAATGCACGACAGGGTTGACG-3′ Forward: 5′-GTGACCATGCCAGCATTTC-3′ Reverse: 5′-TGGTTCTCCACTTTCACCTT-3′ Forward: 5′- GGA TGC AGC CAA TCG TAA T-3′ Reverse: 5′- TTC CAG GTC ACA GGT CAG-3′ Forward: 5′- TGATCTTAGCAAATGCAACACTGA -3′ Reverse: 5′- TGCAAAGGCCCCCATTTT -3′ Forward: 5′- GGAAGAGCCGGTTGAAATATTG -3′ Reverse: 5′- AGCGGGCTAAGTGCTTTCAG -3′
3.2. Determination of lethal concentration (LC50) value of BPF on zebrafish
Table 2 Measured concentrations of BPF in the test solutions. Nominal concentrations (μg/L)
Measured concentration at 0 h (μg/L)
Measured concentration after 24 h (μg/L)
Average of measured concentration (μg/ L)
7.00
7.19 7.03 7.26 73.21 77.20 70.22 721.52 705.24 685.80
7.02 6.90 7.08 70.25 75.04 68.68 715.30 689.53 685.20
7.08 ± 0.19
70.0
700
Zebrafish were exposed to the indicated dose of BPF treatment, and the calculated LC50 values of BPF were 9.13 mg/L (24 h), 8.93 mg/L (48 h), 8.56 mg/L (72 h) and 7.40 mg/L (96 h). Based on the LC50, the concentrations of 0, 7 μg/L (1/1000 LC50), 70 μg/L (1/100 LC50), 700 μg/L (1/10 LC50) were selected for biochemical indicators analysis. According to the study of Sun et al. (2016), the concentration of positive control CPF was 300 μg/L.
72.43 ± 3.28
3.3. BPF impaired the locomotor behavior in zebrafish 700.43 ± 15.84
As shown in Fig. 1, the free-swimming total distance of the zebrafish larvae tended to decline in a dose-dependent manner (Fig. 1B), with a significant difference being observed at 70 μg/L and 700 μg/L compared with the controls. In the CPF group (positive control), the freeswimming total distance of the zebrafish larvae also decline compared with the control group, suggesting the experiment is effective.
3. Results 3.1. BPF exposure concentration
3.4. BPF triggered oxidative stress in zebrafish
The measured BPF concentrations in test solutions are shown in Table 2. The mean measured concentrations validated the nominal concentrations of BPS in test solutions with less than 20% deviation. Since, there was a good agreement between the nominal and measured concentrations.
In 3dpf and 6dpf larvae, the oxidative levels were determined. As shown in Fig. 2 A-F, BPF treatment markedly decreased the activities of SOD, and increased the activity of MDA in a dose-dependent manner. While the CAT activity significantly increased in 3dpf larvae and
Fig. 1. BPF treatment impaired the locomotion behavior of 6dpf zebrafish larvae. The Representative locomotion tracks (A) and total travelled distance (B) are shown. Each treatment was performed in triplicate. *p < 0.05, **p < 0.01, ***p < 0.001. 3
Ecotoxicology and Environmental Safety 188 (2020) 109870
J. Gu, et al.
Fig. 2. BPF treatment altered the levels of CAT, SOD and MDA. (A–F) Fertilized eggs were exposed to BPF for 3 or 6 days. The activity of CAT, SOD and MDA were detected. The values are presented as units per milligram of total protein. (G–H) qPCR analysis was subjected to determine cat and sod mRNA levels in the indicated zebrafish larvae. The expressions were normalized to β-actin. *p < 0.05, **p < 0.01, ***p < 0.001.
Fig. 3. BPF treatment induced apoptosis in brains of zebrafish larvae. (A–D) The BPF treated zebrafish larvae were exposed to TUNEL staining. The reprehensive images are shown.
4
Ecotoxicology and Environmental Safety 188 (2020) 109870
J. Gu, et al.
Fig. 4. BPF delayed neurodevelopment in the zebrafish larvae. (A–B) qPCR analysis was subjected to determine α1-tubulin, elavl3, mbp, Syn2a, gfap levels in the indicated zebrafish larvae. The expressions were normalized to β-actin. *p < 0.05 (C–F) The zebrafish larvae were subjected to WISH assay. The reprehensive images are shown.
4. Discussion
decreased in 6dpf larvae after BPF exposure. The oxidative stress-related gene transcription (cat and sod1) were also detected in 3dpf and 6dpf larvae. As showed in Fig. 2 G-H, significant down-regulation of cat and sod1 mRNA expression was observed in a dose dependent manner after BPF exposure.
BPF, a homolog of BPA, has been widely detected in environment and human bodies. Although the genotoxicity, endocrine disrupting effects, reproductive toxicity of BPF has been well identified, its developmental neurotoxicity remains elusive. In this study, we found that BPF exposure led to the aberrant brain development in zebrafish by increasing oxidative stress and down regulating neurodevelopment related genes. Locomotion behavior, which represents the activities controlled by the nervous system, has been widely used to test neurotoxicity of environmental chemicals (Sano et al., 2016). In our study, we found that BPF treatment markedly reduced the total travelled distance and average speed of zebrafish larvae, which suggesting that BPF could mediate neurotoxicity in the early life stage. Oxidative stress is defined as the imbalance of prooxidants and antioxidants, which is subsequently responsible for oxidative damage. The antioxidant defense system, including the antioxidant enzymes, is essential in maintaining redox state and protecting against oxidative damage. SOD, which converts superoxide radicals to hydrogen peroxide, is the first defensive barrier in the antioxidant system. While, CAT catalyzes the conversion of hydrogen peroxide into water. In our study, we demonstrated that the activity and transcriptional levels of SOD and CAT were substantially decreased upon BPF treatment, which is similar to the findings in human red blood cells (Macczak et al., 2017). Aberrant SOD and CAT fails to scavenge ROS, thus generating byproducts of lipid peroxidation (such as MDA). Redundant MDA will ultimately severely damages cell membranes. In our assay, the MDA content was increased in zebrafish larvae under BPF, which is in accordance with the study of Weili Ge (Ge et al., 2015). Some studies have shown that exposure to exogenous chemicals can lead to apoptosis
3.5. BPF promoted apoptosis in zebrafish larvae brain TUNEL staining was performed to detect BPF induced apoptosis in 3dpf larvae. As shown in Fig. 3, the number of death cell (green fluorescence points) in larvae brain tissues increased with the BPF concentration, suggesting that the nervous system might impaired by BPF treatment.
3.6. BPF delayed neurodevelopment The transcriptional levels of genes regulating neurodevelopment (α1-tubulin, elavl3, mbp, syn2a and gfap) in BPF treated larvaes (3dpf and 6dpf) were determined by qRT-PCR. As shown in Fig. 4A–B, BPF decreased the expressions of the indicated genes in a dose dependent manner. In addition, WISH assay also revealed that 700 μg/L BPF treatment significantly alleviated mbp and syn2a expressions in situ (Fig. 4C–F). Furthermore, BPF treatment also lead to histopathological abnormalities in brains (Fig. 5A–D). As shown in Fig. 5B–C, no significant changes were observed compared with control group (Fig. 5A). However, zebrafish larvae exposed to 700 μg/L BPF showed morphological abnormalities of the brain with the characteristic of empty areas (Red arrow) (Fig. 5D). Decreased α1-tubulin and GFAP expressions in the BPF treated brain sections were also observed (Fig. 5E–L). 5
Ecotoxicology and Environmental Safety 188 (2020) 109870
J. Gu, et al.
Fig. 5. BPF treatment altered brain structure and protein expressions. (A–D) Zebrafish larvae were exposed to different dose of BPF. The reprehensive section images of brain HE staining are shown. (E–H) Expressions of α1-tubulin in the indicated brain sections were analyzed by immunofluorescence. The reprehensive images are shown. (I–L) Expressions of GFAP in the indicated brain sections were analyzed by immunofluorescence. The reprehensive images are shown.
Fig. 6. Mechanism diagram. The developing nervous system may be very susceptible to BPF due to the following mechanisms: 1. BPF causes oxidative stress and activates the nerve cell apoptosis. 2. The gene/protein expressions related with neurodevelopment and oxidative stress lead to the accumulation of genome damage, especially the expression of α1-tubulin and GFAP protein in the brain.
in vitro experiments, a previous study was to assess the harmful effects of AgNPs on human neuroblastoma SH-SY5Y cells and also to investigate the protective effect of HN from AgNPs-induced cell death, mitochondrial dysfunctions, DNA damage, and apoptosis (Gurunathan et al., 2019). These results suggest that oxidative stress is inextricably linked to neurotoxicity and is consistent with our results. Thus, BPF impaired neurodevelopment partially by increasing oxidative stress.
caused by oxidative stress and, ultimately, a neurotoxicity. For example, in vivo experiments, boscalid, bisphenol S, pyraclostrobin and so on induce apoptosis and eventually lead to neurotoxicity through oxidative stress (Gu et al., 2019; Li et al., 2019; Wang et al., 2019b). At the same time, isoliquiritigenin is used as an antioxidant phytochemical ameliorates, which has alleviated the neurotoxicity caused by oxidative stress in zebrafish induced by BDE47 (Wang et al., 2019a). Meanwhile, 6
Ecotoxicology and Environmental Safety 188 (2020) 109870
J. Gu, et al.
TUNEL staining is useful for detecting apoptosis in zebrafish larvae. In our study, significant and dose-dependent apoptosis signal intensity was detected in brains of BPF treated zebrafish larvae, which suggesting that BPF may lead to apoptosis during neurodevelopment. Furthermore, transcriptional profiles of neurodevelopment related genes were also characterized. The α1-tubulin gene, which expresses in the neuronal stem cells and the developing neurons, are responsible for cytoskeletal organization and brain architecture construction (Fan et al., 2010). The elavl3 gene, encoding the neural specific RNA-binding protein HuC, is considered as early neuronal biomarker (Kim et al., 1996). The mbp gene, which is found in oligodendrocytes of myelin sheath, is also considered as the biomarker for neurodevelopment (Brosamle and Halpern, 2002; Muller et al., 2013). The syn2a gene acts as a key modulator in the neurotransmitter release and involves in synaptogenesis (Kao et al., 1998). And the gfap gene, mainly expresses in astrocytes and ependymal cells, directs critical processes in nervous system (Nielsen and Jorgensen, 2003). In our study, we have revealed that BPF treatment could noticeably inhibit the expressions of the genes mentioned, which contributing to the impaired neurodevelopment. In addition, changes of brain structure were also found in BPF treated zebrafish. The histological analyses showed that BPF exposure led to disordered nuclei arrangement in brains, which may explain the aberrant locomotion behavior. However, further studies are still need to decipher the underlying mechanisms. In summary, our study demonstrated that exposure of BPF in early life could impair neurodevelopment via several mechanisms. The developing nervous system may be very susceptible to BPF due to the following mechanisms (Fig. 6): 1. BPF causes oxidative stress and activates the nerve cell apoptosis. 2. The gene/protein expressions related with neurodevelopment and oxidative stress lead to the accumulation of genome damage, especially the expression of α1-tubulin and GFAP protein in the brain. Effective strategies to prevent the neurotoxicity of BPF are urgently needed.
markers for rapid developmental neurotoxicity screening. Neurotoxicol. Teratol. 32, 91–98. Gallart-Ayala, H., et al., 2011. Analysis of bisphenols in soft drinks by on-line solid phase extraction fast liquid chromatography-tandem mass spectrometry. Anal. Chim. Acta 683, 227–233. Ge, W., et al., 2015. Oxidative stress and DNA damage induced by imidacloprid in zebrafish (Danio rerio). J. Agric. Food Chem. 63, 1856–1862. Gu, J., et al., 2019. Neurobehavioral effects of bisphenol S exposure in early life stages of zebrafish larvae (Danio rerio). Chemosphere 217, 629–635. Gurunathan, S., et al., 2019. Mitochondrial peptide humanin protects silver nanoparticles-induced neurotoxicity in human neuroblastoma cancer cells (SH-SY5Y). Int. J. Mol. Sci. 20. Han, Y., et al., 2016. Genotoxicity and oxidative stress induced by the fungicide azoxystrobin in zebrafish (Danio rerio) livers. Pestic. Biochem. Physiol. 133, 13–19. Harland, R.M., 1991. In situ hybridization: an improved whole-mount method for Xenopus embryos. Methods Cell Biol. 36, 685. Huang, G.M., et al., 2016. Waterborne exposure to bisphenol F causes thyroid endocrine disruption in zebrafish larvae. Chemosphere 147, 188–194. Kao, H.T., et al., 1998. A third member of the synapsin gene family. Proc. Natl. Acad. Sci. U. S. A. 95, 4667–4672. Kim, C.H., et al., 1996. Zebrafish elav/HuC homologue as a very early neuronal marker. Neurosci. Lett. 216, 109–112. Li, H., et al., 2019. Mitochondrial dysfunction-based cardiotoxicity and neurotoxicity induced by pyraclostrobin in zebrafish larvae. Environ. Pollut. 251, 203–211. Liao, C., et al., 2012. Occurrence of eight bisphenol analogues in indoor dust from the United States and several Asian countries: implications for human exposure. Environ. Sci. Technol. 46, 9138–9145. Liu, W., et al., 2018. Long-term exposure to bisphenol S damages the visual system and reduces the tracking capability of male zebrafish (Danio rerio). J. Appl. Toxicol. 38 (2), 248–258. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408. Macczak, A., et al., 2017. Bisphenol A, bisphenol S, bisphenol F and bisphenol AF induce different oxidative stress and damage in human red blood cells (in vitro study). Toxicol. In Vitro 41, 143–149. Muller, C., et al., 2013. Making myelin basic protein -from mRNA transport to localized translation. Front. Cell. Neurosci. 7, 169. Nery, L.R., et al., 2014. Brain intraventricular injection of amyloid-beta in zebrafish embryo impairs cognition and increases tau phosphorylation, effects reversed by lithium. PLoS One 9, e105862. Nielsen, A.L., Jorgensen, A.L., 2003. Structural and functional characterization of the zebrafish gene for glial fibrillary acidic protein. GFAP. Gene. 310, 123–132. OECD, 1998. Fish Short-Term Toxicity Test on Embryo and Sac-Fry Stages. Qiu, W., et al., 2018. Immunotoxicity of bisphenol S and F are similar to that of bisphenol A during zebrafish early development. Chemosphere 194, 1–8. Sano, K., et al., 2016. In utero and lactational exposure to acetamiprid induces abnormalities in socio-sexual and anxiety-related behaviors of male mice. Front. Neurosci. 10, 228. Song, Y., et al., 2009. DNA damage and effects on antioxidative enzymes in earthworm (Eisenia foetida) induced by atrazine. Soil Biol. Biochem. 41, 905–909. Sun, L., et al., 2016. Developmental exposure of zebrafish larvae to organophosphate flame retardants causes neurotoxicity. Neurotoxicol. Teratol. 55, 16–22. Wang, C., et al., 2019a. Isoliquiritigenin as an antioxidant phytochemical ameliorates the developmental anomalies of zebrafish induced by 2,2',4,4'-tetrabromodiphenyl ether. Sci. Total Environ. 666, 390–398. Wang, H., et al., 2019b. Characterization of boscalid-induced oxidative stress and neurodevelopmental toxicity in zebrafish embryos. Chemosphere 238, 124753. Xu, J.B., et al., 1997. Determination of Catalase Activity and Catalase Inhibition by Ultraviolet Spectrophotometry. Yamasaki, K., et al., 2002. Comparison of reporter gene assay and immature rat uterotrophic assay of twenty-three chemicals. Toxicology 170, 21–30. Yamazaki, E., et al., 2015. Bisphenol A and other bisphenol analogues including BPS and BPF in surface water samples from Japan, China, Korea and India. Ecotoxicol. Environ. Saf. 122, 565–572. Ye, X., et al., 2015. Urinary concentrations of bisphenol a and three other bisphenols in convenience samples of U.S. Adults during 2000-2014. Environ. Sci. Technol. 49, 11834–11839. Zhu, M., et al., 2018. Bisphenol F disrupts thyroid hormone signaling and postembryonic development in Xenopus laevis. Environ. Sci. Technol. 52, 1602–1611.
Declaration of competing interest There are no conflicts of interest to declare. Acknowledgments This work was supported by Open Project of The Key Laboratory of Modern Toxicology of Ministry of Education, Nanjing Medical University (NMUAMT201811). References Audebert, M., et al., 2011. Use of the gammaH2AX assay for assessing the genotoxicity of bisphenol A and bisphenol F in human cell lines. Arch. Toxicol. 85, 1463–1473. Barrallo-Gimeno, A., et al., 2004. Neural crest survival and differentiation in zebrafish depends on mont blanc/tfap2a gene function. Development 131, 1463–1477. Brosamle, C., Halpern, M.E., 2002. Characterization of myelination in the developing zebrafish. Glia 39, 47–57. Chen, D., et al., 2016. Bisphenol analogues other than BPA: environmental occurrence, human exposure, and toxicity-A review. Environ. Sci. Technol. 50, 5438–5453. Fan, C.Y., et al., 2010. Gene expression changes in developing zebrafish as potential
7
Contents lists available at ScienceDirect
Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv
Bisphenol F exposure impairs neurodevelopment in zebrafish larvae (Danio rerio)
T
Jie Gua,b,c,1, Jiang Wub,c,1, Shuqin Xub,c, Liye Zhangb,c, Deling Fana, Lili Shia, Jun Wangb,c, Guixiang Jia,∗ a
Nanjing Institute of Environmental Sciences, Ministry of Ecology and Environment of the People's Republic of China, Nanjing, 210042, China State Key Laboratory of Reproductive Medicine, Institute of Toxicology, Nanjing Medical University, Nanjing, 211166, China c Key Laboratory of Modern Toxicology, Ministry of Education, School of Public Health, Nanjing Medical University, Nanjing, 211166, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: BPF Neurodevelopment Oxidative stress
BPF, a substitute of BPA, has been widely detected in environment and human bodies. Although the genotoxicity, endocrine disrupting effects, reproductive toxicity of BPF has been well documented, its neurodevelopmental toxicity still remains nebulous. In our study, zebrafish embryos were exposed to BPF treatment (0, 7, 70 and 700 μg/L) for 3 or 6 days. Our results showed that BPF exposure markedly decreased zebrafish locomotor behavior, increased oxidative stress, promoted apoptosis and altered brain structure in zebrafish. In addition, the expressions of neurodevelopment related genes were also downregulated upon BPF treatment. In conclusion, our results systematically demonstrated the developmental neurotoxicity of BPF in zebrafish.
1. Introduction The developmental toxicity of Bisphenol A (BPA; 2,2-bis(4-hydroxyphenyl) propane), an endocrine-disrupting chemical (EDC), has been well documented. More and more countries and organizations ban the use of bisphenol A. As a result, some bisphenol A substitutes such as bisphenol F (BPF), bisphenol S (BPS), bisphenol AF (BPAF) have been gradually developed. However, whether these new substitutes are safe is not adequately studied. It is usually considered to be more safer if the estrogenic-like activities is lower and activity of bisphenol A. Currently, Bisphenol F (BPF; 4,4′-methylenediphenol), a homolog of BPA, serves as BPA alternative and is widely used in industrial applications, such as the paper products, personal care products, and food containers (Qiu et al., 2018). BPF is widely distributed in environment. It has been reported that the concentrations of BPF were markedly higher than those of BPA in river and sea waters (Yamazaki et al., 2015). For example, Eriko Yamazaki et al. reported the concentrations of BPF were one to two orders of magnitude higher than those of BPA. In river and sea waters collected from Japan, Korea and China, BPF concentration was as high as 2850 ng/L in the Tamagawa River in Tokyo (Yamazaki et al., 2015). In addition, BPF was found in soft drinks at a mean concentration of
0.180 μg/L (Gallart-Ayala et al., 2011) and dust samples (the entire sample set) (Liao et al., 2012). Notability, in human urine, BPF was also detected, with concentration between 0.15 μg/L and 0.54 μg/L (Ye et al., 2015). Thus, identifying the toxicity of BPF is urgent. Several studies have shown that BPF exhibits genotoxicity, endocrine disrupting effects, reproductive toxicity effects due to its structural similarity to BPA (Yamasaki et al., 2002) (Chen et al., 2016). Audebert et al. reported similar ranges of cytotoxicity for BPA and BPF, whereas the genotoxicity was only observed for BPF (Audebert et al., 2011). BPF impaired the hypothalamic-pituitary-thyroid axis and abnormally increased thyroid hormones and thyroid-stimulating hormone in zebrafish (Huang et al., 2016). Similarly results were also found in xenopus laevis with BPF treatment (Zhu et al., 2018). However, the effect of BPF on brain development still remains unknown. In this study, zebrafish embryos were exposed to different concentration of BPF. The locomotion, oxidative and apoptotic status of zebrafish embryos as well as the expression of neural development genes were determined. Our results demonstrate the developmental neurotoxicity of BPF in zebrafish relatively systematically.
Abbreviations: BPF, 2,2-bis-4-hydroxyphenyl; LC50, Lethal Concentration 50%; CPF, Chlorpyrifos ∗ Corresponding author. Nanjing Institute of Environmental Sciences (NIES), Ministry of Environmental Protection (MEP), 8 Jiangwangmiao street, Nanjing, China. E-mail address: [email protected] (G. Ji). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.ecoenv.2019.109870 Received 15 July 2019; Received in revised form 27 September 2019; Accepted 24 October 2019 0147-6513/ © 2019 Elsevier Inc. All rights reserved.
Ecotoxicology and Environmental Safety 188 (2020) 109870
J. Gu, et al.
2. Materials and methods
transparent membrane treatment with PBSTX were operated in 5 min × 3 times with PBSTX. After that, embryos were digested by protease K (10μg/mL) at 37 °C for 30–45 min, 500μL/tube. Then washed in 1 × PBST in 5 min × 3 times. Refixed in 4%PFA for 10–15 min. And after that, rewashed the embryos in 1 × PBST for 5 min × 6 times. Extract the PBS and add TdT Buffer working fluid. To keep out of the sun and embryos were incubated on ice for an hour, followed by 1 h incubation at 37 °C. Finally, the inverted fluorescence microscope was used for photo analysis and counting. Observe and count the number of green fluorescence points in the head, that is, the number of apoptosis in the brain.
2.1. Zebrafish husbandry AB strain zebrafish (Danio rerio), obtained from the Institute of Hydrobiology of the Chinese Academy of Science (Wuhan, China), were kept in a recirculating system at 28 ± 0.5 °C, with a photoperiod of 14 h light/10 h dark. Fish were fed with freshly hatched brine shrimp (Artemia nauplii) twice a day. Male and female adult fish with a preferable ratio of 2:1 were transferred into mating tanks 1 h prior the light cycle. After spawning, eggs were collected and cleaned with fresh water. All the animal experiments were conducted following the guiding principles for the care and use of animals approved by the animal ethics committee of Nanjing Medical University (Permit number: 2014092).
2.7. Determination of SOD, CAT activities and MDA content The fertilized eggs were treated with BPF for 6 days. A total of 20 living larvae from each treatment were homogenized to for SOD, CAT and MDA analysis. The activities of SOD and CAT were measured as described by Song et al. (2009) and Xu et al. (1997), respectively. The MDA content was detected as described by Han et al. (2016).
2.2. Chemicals and reagents BPF (CAS 620-92-8; purity 99%) was purchased from Tokyo Chemical Industry (Tokyo, Japan). Chlorpyrifos (CAS: 2921-88-2; purity 99%), acridine orange (AO) staining reagent were obtained from Sigma-Aldrich (St. Louis, MO, USA).
2.8. Hematoxylin-eosin (HE) staining The HE staining was conducted as reported previously (Liu et al., 2018). Briefly, fertilized eggs were treated with BPF for 6 days. Then, the zebrafish larvaes were fixed in paraformaldehyde, dehydrated with ethanol, cleared in xylene, embedded in paraffin, and cut into 5 μm sections for HE staining. The stained sections were observed under a microscope (Leica, Germany).
2.3. Calculation of lethal concentration (LC50) value The acute toxicology of BPF to zebrafish embryos were conducted according to the OECD test guidance (OECD, 1998). In brief, twenty zebrafish embryos were cultured in a 6-well plate and exposed to BPF (0, 0.05, 0.25, 1.25, 2, 4, 6, 8, 10, 12 and 14 mg/L) treatment for 96 h. The BPF solutions were renewed daily. The embryos were observed three times a day, and dead ones were recorded and removed. Each treatment was performed in triplicate.
2.9. Immunofluorescence staining The dewaxing sections were blocked with PBS containing 5% goat serum for 1 h, and incubated with primary antibodies (α1-tubulin, Abcam, 1:100; GFAP, Abcam, 1:100) overnight. Then, sections were further incubated with immunofluorescent antibody (Jackson ImmunoResearch, 1:200) and stained with DAPI (Beyotime, China) before examination with a fluorescence microscope (Olympus BX43 Japan).
2.4. Detection of BPF exposure concentration Test samples were filtered using 0.22 μm nylon filters. BPF concentrations in the test samples were measured with an LC-HRMS system composed of an Ultimate 3000 UHPLC system (Thermo Fisher Scientific, CA, USA) equipped with a QExactive Focus Orbitrap mass spectrometer (Thermo Fisher Scientific, CA, USA) operating under selective ion monitoring (SIM) mode. An Infinitylab poroshell 120EC-C18 Column (150 mm × 2.1 m × 2.7 μm, Thermo Fisher, USA) was used to separated analytes under 40 °C, the mobile phase was composed of acetonitrile and 0.1% ammonia (20:80, V/V) at a flow rate of 0.3 mL/ min for 5 min. Meanwhile, the data of sheath pressure is 40arb, as well as 10arb auxiliary pressure and capillary temperature at 350 °C.
2.10. Real-time RT-PCR (qRT-PCR) Total RNA from the 10 living larvae was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. The RNA was reversely transcripted to cDNA using the MMLV RTase (TaKaRa, Tokyo, Japan). The primer sequences for the selected genes were listed in Table 1. The expressions of the indicated genes were normalized to β-actin by using 2−ΔΔCt method (Livak and Schmittgen, 2001). Each sample was performed in triplicate.
2.5. Locomotion analysis The locomotion analysis was conducted as reported previously (Nery et al., 2014). In brief, fertilized eggs were exposed to BPF treatment in a 24-well plate for 6 days. The BPF solutions were renewed daily. Before the locomotion analysis by the Danio vision (Noldus, Netherlands), the exposure solutions were changed to clean water. Free swimming activities during visible light (25 min) and dark (25 min) were recorded. Each treatment was performed in triplicate. The total swimming distance during moving time were calculated by EthoVision.
2.11. Whole mount in situ hybridization (WISH)
2.6. TUNEL staining
2.12. Statistical analysis
The TUNEL staining of zebrafish was conducted as reported previously (Barrallo-Gimeno et al., 2004). First, in order to remove melanin before 24hpf, we added PTU to zebrafish embryos which were exposed to BPF (0, 7, 70 and 700 μg/L) at 4hpf. After 24hpf, the embryos treated with chain ProE were collected in 1.5ml centrifuge tube. 4%PFA was used to fix the tissue overnight in a cold storage at 4 °C. The
All experiments were performed in triplicate and independently repeated at least twice. Statistically differences were analyzed by one way ANOVA or Student's t-test (mean ± SEM) using SPSS (version 20.0) or GraphPad Prism (version 5.0). P < 0.05 was designated as significance. Trimmed Spearman-Karber Method (Version 1.5, USEPA) was used to calculate the LC50 and 95% confidence interval (CI).
WISH was performed as described (Harland, 1991). In brief, embryos or larvae were grown in 0.003% 1-phenyl-2-thiourea (PTU; Sigma) until 3 dpf. Then, zebrafish were hybridized with indicated probes overnight at 55 °C. On the next day, the zebrafish were washed and incubated with an alkaline phosphatase-conjugated antibody (Roche Diagnostics) at a dilution of 1:1500.
2
Ecotoxicology and Environmental Safety 188 (2020) 109870
J. Gu, et al.
Table 1 Sequences of primers for the genes tested. Target Gene
GenBank Accession No.
Primer Sequences
β-actin
AF025305
α1-tubulin
NM_194388
elavl3
NM_131449
mbp
AY860977
Syn2a
NM_001002597
gfap
NM_131373
Cat
NM_130912.2
Sod1
NM_131294.1
Forward: 5′-ACAGGGAAAAGATGACACAGATCA-3′ Reverse: 5′-CAGCCTGGATGGCAACGTA-3′ Forward: 5′- AAT CAC CAA TGC TTG CTT CGA GCC-3′ Reverse: 5′- TTC ACG TCT TTG GGT ACC ACG TCA-3′ Forward: 5′- AGA CAA GAT CAC AGG CCA GAG CTT-3′ Reverse: 5′- TGG TCT GCA GTT TGA GAC CGT TGA-3′ Forward: 5′-AATCAGCAGGTTCTTCGGAGGAGA-3′ Reverse: 5′-AAGAAATGCACGACAGGGTTGACG-3′ Forward: 5′-GTGACCATGCCAGCATTTC-3′ Reverse: 5′-TGGTTCTCCACTTTCACCTT-3′ Forward: 5′- GGA TGC AGC CAA TCG TAA T-3′ Reverse: 5′- TTC CAG GTC ACA GGT CAG-3′ Forward: 5′- TGATCTTAGCAAATGCAACACTGA -3′ Reverse: 5′- TGCAAAGGCCCCCATTTT -3′ Forward: 5′- GGAAGAGCCGGTTGAAATATTG -3′ Reverse: 5′- AGCGGGCTAAGTGCTTTCAG -3′
3.2. Determination of lethal concentration (LC50) value of BPF on zebrafish
Table 2 Measured concentrations of BPF in the test solutions. Nominal concentrations (μg/L)
Measured concentration at 0 h (μg/L)
Measured concentration after 24 h (μg/L)
Average of measured concentration (μg/ L)
7.00
7.19 7.03 7.26 73.21 77.20 70.22 721.52 705.24 685.80
7.02 6.90 7.08 70.25 75.04 68.68 715.30 689.53 685.20
7.08 ± 0.19
70.0
700
Zebrafish were exposed to the indicated dose of BPF treatment, and the calculated LC50 values of BPF were 9.13 mg/L (24 h), 8.93 mg/L (48 h), 8.56 mg/L (72 h) and 7.40 mg/L (96 h). Based on the LC50, the concentrations of 0, 7 μg/L (1/1000 LC50), 70 μg/L (1/100 LC50), 700 μg/L (1/10 LC50) were selected for biochemical indicators analysis. According to the study of Sun et al. (2016), the concentration of positive control CPF was 300 μg/L.
72.43 ± 3.28
3.3. BPF impaired the locomotor behavior in zebrafish 700.43 ± 15.84
As shown in Fig. 1, the free-swimming total distance of the zebrafish larvae tended to decline in a dose-dependent manner (Fig. 1B), with a significant difference being observed at 70 μg/L and 700 μg/L compared with the controls. In the CPF group (positive control), the freeswimming total distance of the zebrafish larvae also decline compared with the control group, suggesting the experiment is effective.
3. Results 3.1. BPF exposure concentration
3.4. BPF triggered oxidative stress in zebrafish
The measured BPF concentrations in test solutions are shown in Table 2. The mean measured concentrations validated the nominal concentrations of BPS in test solutions with less than 20% deviation. Since, there was a good agreement between the nominal and measured concentrations.
In 3dpf and 6dpf larvae, the oxidative levels were determined. As shown in Fig. 2 A-F, BPF treatment markedly decreased the activities of SOD, and increased the activity of MDA in a dose-dependent manner. While the CAT activity significantly increased in 3dpf larvae and
Fig. 1. BPF treatment impaired the locomotion behavior of 6dpf zebrafish larvae. The Representative locomotion tracks (A) and total travelled distance (B) are shown. Each treatment was performed in triplicate. *p < 0.05, **p < 0.01, ***p < 0.001. 3
Ecotoxicology and Environmental Safety 188 (2020) 109870
J. Gu, et al.
Fig. 2. BPF treatment altered the levels of CAT, SOD and MDA. (A–F) Fertilized eggs were exposed to BPF for 3 or 6 days. The activity of CAT, SOD and MDA were detected. The values are presented as units per milligram of total protein. (G–H) qPCR analysis was subjected to determine cat and sod mRNA levels in the indicated zebrafish larvae. The expressions were normalized to β-actin. *p < 0.05, **p < 0.01, ***p < 0.001.
Fig. 3. BPF treatment induced apoptosis in brains of zebrafish larvae. (A–D) The BPF treated zebrafish larvae were exposed to TUNEL staining. The reprehensive images are shown.
4
Ecotoxicology and Environmental Safety 188 (2020) 109870
J. Gu, et al.
Fig. 4. BPF delayed neurodevelopment in the zebrafish larvae. (A–B) qPCR analysis was subjected to determine α1-tubulin, elavl3, mbp, Syn2a, gfap levels in the indicated zebrafish larvae. The expressions were normalized to β-actin. *p < 0.05 (C–F) The zebrafish larvae were subjected to WISH assay. The reprehensive images are shown.
4. Discussion
decreased in 6dpf larvae after BPF exposure. The oxidative stress-related gene transcription (cat and sod1) were also detected in 3dpf and 6dpf larvae. As showed in Fig. 2 G-H, significant down-regulation of cat and sod1 mRNA expression was observed in a dose dependent manner after BPF exposure.
BPF, a homolog of BPA, has been widely detected in environment and human bodies. Although the genotoxicity, endocrine disrupting effects, reproductive toxicity of BPF has been well identified, its developmental neurotoxicity remains elusive. In this study, we found that BPF exposure led to the aberrant brain development in zebrafish by increasing oxidative stress and down regulating neurodevelopment related genes. Locomotion behavior, which represents the activities controlled by the nervous system, has been widely used to test neurotoxicity of environmental chemicals (Sano et al., 2016). In our study, we found that BPF treatment markedly reduced the total travelled distance and average speed of zebrafish larvae, which suggesting that BPF could mediate neurotoxicity in the early life stage. Oxidative stress is defined as the imbalance of prooxidants and antioxidants, which is subsequently responsible for oxidative damage. The antioxidant defense system, including the antioxidant enzymes, is essential in maintaining redox state and protecting against oxidative damage. SOD, which converts superoxide radicals to hydrogen peroxide, is the first defensive barrier in the antioxidant system. While, CAT catalyzes the conversion of hydrogen peroxide into water. In our study, we demonstrated that the activity and transcriptional levels of SOD and CAT were substantially decreased upon BPF treatment, which is similar to the findings in human red blood cells (Macczak et al., 2017). Aberrant SOD and CAT fails to scavenge ROS, thus generating byproducts of lipid peroxidation (such as MDA). Redundant MDA will ultimately severely damages cell membranes. In our assay, the MDA content was increased in zebrafish larvae under BPF, which is in accordance with the study of Weili Ge (Ge et al., 2015). Some studies have shown that exposure to exogenous chemicals can lead to apoptosis
3.5. BPF promoted apoptosis in zebrafish larvae brain TUNEL staining was performed to detect BPF induced apoptosis in 3dpf larvae. As shown in Fig. 3, the number of death cell (green fluorescence points) in larvae brain tissues increased with the BPF concentration, suggesting that the nervous system might impaired by BPF treatment.
3.6. BPF delayed neurodevelopment The transcriptional levels of genes regulating neurodevelopment (α1-tubulin, elavl3, mbp, syn2a and gfap) in BPF treated larvaes (3dpf and 6dpf) were determined by qRT-PCR. As shown in Fig. 4A–B, BPF decreased the expressions of the indicated genes in a dose dependent manner. In addition, WISH assay also revealed that 700 μg/L BPF treatment significantly alleviated mbp and syn2a expressions in situ (Fig. 4C–F). Furthermore, BPF treatment also lead to histopathological abnormalities in brains (Fig. 5A–D). As shown in Fig. 5B–C, no significant changes were observed compared with control group (Fig. 5A). However, zebrafish larvae exposed to 700 μg/L BPF showed morphological abnormalities of the brain with the characteristic of empty areas (Red arrow) (Fig. 5D). Decreased α1-tubulin and GFAP expressions in the BPF treated brain sections were also observed (Fig. 5E–L). 5
Ecotoxicology and Environmental Safety 188 (2020) 109870
J. Gu, et al.
Fig. 5. BPF treatment altered brain structure and protein expressions. (A–D) Zebrafish larvae were exposed to different dose of BPF. The reprehensive section images of brain HE staining are shown. (E–H) Expressions of α1-tubulin in the indicated brain sections were analyzed by immunofluorescence. The reprehensive images are shown. (I–L) Expressions of GFAP in the indicated brain sections were analyzed by immunofluorescence. The reprehensive images are shown.
Fig. 6. Mechanism diagram. The developing nervous system may be very susceptible to BPF due to the following mechanisms: 1. BPF causes oxidative stress and activates the nerve cell apoptosis. 2. The gene/protein expressions related with neurodevelopment and oxidative stress lead to the accumulation of genome damage, especially the expression of α1-tubulin and GFAP protein in the brain.
in vitro experiments, a previous study was to assess the harmful effects of AgNPs on human neuroblastoma SH-SY5Y cells and also to investigate the protective effect of HN from AgNPs-induced cell death, mitochondrial dysfunctions, DNA damage, and apoptosis (Gurunathan et al., 2019). These results suggest that oxidative stress is inextricably linked to neurotoxicity and is consistent with our results. Thus, BPF impaired neurodevelopment partially by increasing oxidative stress.
caused by oxidative stress and, ultimately, a neurotoxicity. For example, in vivo experiments, boscalid, bisphenol S, pyraclostrobin and so on induce apoptosis and eventually lead to neurotoxicity through oxidative stress (Gu et al., 2019; Li et al., 2019; Wang et al., 2019b). At the same time, isoliquiritigenin is used as an antioxidant phytochemical ameliorates, which has alleviated the neurotoxicity caused by oxidative stress in zebrafish induced by BDE47 (Wang et al., 2019a). Meanwhile, 6
Ecotoxicology and Environmental Safety 188 (2020) 109870
J. Gu, et al.
TUNEL staining is useful for detecting apoptosis in zebrafish larvae. In our study, significant and dose-dependent apoptosis signal intensity was detected in brains of BPF treated zebrafish larvae, which suggesting that BPF may lead to apoptosis during neurodevelopment. Furthermore, transcriptional profiles of neurodevelopment related genes were also characterized. The α1-tubulin gene, which expresses in the neuronal stem cells and the developing neurons, are responsible for cytoskeletal organization and brain architecture construction (Fan et al., 2010). The elavl3 gene, encoding the neural specific RNA-binding protein HuC, is considered as early neuronal biomarker (Kim et al., 1996). The mbp gene, which is found in oligodendrocytes of myelin sheath, is also considered as the biomarker for neurodevelopment (Brosamle and Halpern, 2002; Muller et al., 2013). The syn2a gene acts as a key modulator in the neurotransmitter release and involves in synaptogenesis (Kao et al., 1998). And the gfap gene, mainly expresses in astrocytes and ependymal cells, directs critical processes in nervous system (Nielsen and Jorgensen, 2003). In our study, we have revealed that BPF treatment could noticeably inhibit the expressions of the genes mentioned, which contributing to the impaired neurodevelopment. In addition, changes of brain structure were also found in BPF treated zebrafish. The histological analyses showed that BPF exposure led to disordered nuclei arrangement in brains, which may explain the aberrant locomotion behavior. However, further studies are still need to decipher the underlying mechanisms. In summary, our study demonstrated that exposure of BPF in early life could impair neurodevelopment via several mechanisms. The developing nervous system may be very susceptible to BPF due to the following mechanisms (Fig. 6): 1. BPF causes oxidative stress and activates the nerve cell apoptosis. 2. The gene/protein expressions related with neurodevelopment and oxidative stress lead to the accumulation of genome damage, especially the expression of α1-tubulin and GFAP protein in the brain. Effective strategies to prevent the neurotoxicity of BPF are urgently needed.
markers for rapid developmental neurotoxicity screening. Neurotoxicol. Teratol. 32, 91–98. Gallart-Ayala, H., et al., 2011. Analysis of bisphenols in soft drinks by on-line solid phase extraction fast liquid chromatography-tandem mass spectrometry. Anal. Chim. Acta 683, 227–233. Ge, W., et al., 2015. Oxidative stress and DNA damage induced by imidacloprid in zebrafish (Danio rerio). J. Agric. Food Chem. 63, 1856–1862. Gu, J., et al., 2019. Neurobehavioral effects of bisphenol S exposure in early life stages of zebrafish larvae (Danio rerio). Chemosphere 217, 629–635. Gurunathan, S., et al., 2019. Mitochondrial peptide humanin protects silver nanoparticles-induced neurotoxicity in human neuroblastoma cancer cells (SH-SY5Y). Int. J. Mol. Sci. 20. Han, Y., et al., 2016. Genotoxicity and oxidative stress induced by the fungicide azoxystrobin in zebrafish (Danio rerio) livers. Pestic. Biochem. Physiol. 133, 13–19. Harland, R.M., 1991. In situ hybridization: an improved whole-mount method for Xenopus embryos. Methods Cell Biol. 36, 685. Huang, G.M., et al., 2016. Waterborne exposure to bisphenol F causes thyroid endocrine disruption in zebrafish larvae. Chemosphere 147, 188–194. Kao, H.T., et al., 1998. A third member of the synapsin gene family. Proc. Natl. Acad. Sci. U. S. A. 95, 4667–4672. Kim, C.H., et al., 1996. Zebrafish elav/HuC homologue as a very early neuronal marker. Neurosci. Lett. 216, 109–112. Li, H., et al., 2019. Mitochondrial dysfunction-based cardiotoxicity and neurotoxicity induced by pyraclostrobin in zebrafish larvae. Environ. Pollut. 251, 203–211. Liao, C., et al., 2012. Occurrence of eight bisphenol analogues in indoor dust from the United States and several Asian countries: implications for human exposure. Environ. Sci. Technol. 46, 9138–9145. Liu, W., et al., 2018. Long-term exposure to bisphenol S damages the visual system and reduces the tracking capability of male zebrafish (Danio rerio). J. Appl. Toxicol. 38 (2), 248–258. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408. Macczak, A., et al., 2017. Bisphenol A, bisphenol S, bisphenol F and bisphenol AF induce different oxidative stress and damage in human red blood cells (in vitro study). Toxicol. In Vitro 41, 143–149. Muller, C., et al., 2013. Making myelin basic protein -from mRNA transport to localized translation. Front. Cell. Neurosci. 7, 169. Nery, L.R., et al., 2014. Brain intraventricular injection of amyloid-beta in zebrafish embryo impairs cognition and increases tau phosphorylation, effects reversed by lithium. PLoS One 9, e105862. Nielsen, A.L., Jorgensen, A.L., 2003. Structural and functional characterization of the zebrafish gene for glial fibrillary acidic protein. GFAP. Gene. 310, 123–132. OECD, 1998. Fish Short-Term Toxicity Test on Embryo and Sac-Fry Stages. Qiu, W., et al., 2018. Immunotoxicity of bisphenol S and F are similar to that of bisphenol A during zebrafish early development. Chemosphere 194, 1–8. Sano, K., et al., 2016. In utero and lactational exposure to acetamiprid induces abnormalities in socio-sexual and anxiety-related behaviors of male mice. Front. Neurosci. 10, 228. Song, Y., et al., 2009. DNA damage and effects on antioxidative enzymes in earthworm (Eisenia foetida) induced by atrazine. Soil Biol. Biochem. 41, 905–909. Sun, L., et al., 2016. Developmental exposure of zebrafish larvae to organophosphate flame retardants causes neurotoxicity. Neurotoxicol. Teratol. 55, 16–22. Wang, C., et al., 2019a. Isoliquiritigenin as an antioxidant phytochemical ameliorates the developmental anomalies of zebrafish induced by 2,2',4,4'-tetrabromodiphenyl ether. Sci. Total Environ. 666, 390–398. Wang, H., et al., 2019b. Characterization of boscalid-induced oxidative stress and neurodevelopmental toxicity in zebrafish embryos. Chemosphere 238, 124753. Xu, J.B., et al., 1997. Determination of Catalase Activity and Catalase Inhibition by Ultraviolet Spectrophotometry. Yamasaki, K., et al., 2002. Comparison of reporter gene assay and immature rat uterotrophic assay of twenty-three chemicals. Toxicology 170, 21–30. Yamazaki, E., et al., 2015. Bisphenol A and other bisphenol analogues including BPS and BPF in surface water samples from Japan, China, Korea and India. Ecotoxicol. Environ. Saf. 122, 565–572. Ye, X., et al., 2015. Urinary concentrations of bisphenol a and three other bisphenols in convenience samples of U.S. Adults during 2000-2014. Environ. Sci. Technol. 49, 11834–11839. Zhu, M., et al., 2018. Bisphenol F disrupts thyroid hormone signaling and postembryonic development in Xenopus laevis. Environ. Sci. Technol. 52, 1602–1611.
Declaration of competing interest There are no conflicts of interest to declare. Acknowledgments This work was supported by Open Project of The Key Laboratory of Modern Toxicology of Ministry of Education, Nanjing Medical University (NMUAMT201811). References Audebert, M., et al., 2011. Use of the gammaH2AX assay for assessing the genotoxicity of bisphenol A and bisphenol F in human cell lines. Arch. Toxicol. 85, 1463–1473. Barrallo-Gimeno, A., et al., 2004. Neural crest survival and differentiation in zebrafish depends on mont blanc/tfap2a gene function. Development 131, 1463–1477. Brosamle, C., Halpern, M.E., 2002. Characterization of myelination in the developing zebrafish. Glia 39, 47–57. Chen, D., et al., 2016. Bisphenol analogues other than BPA: environmental occurrence, human exposure, and toxicity-A review. Environ. Sci. Technol. 50, 5438–5453. Fan, C.Y., et al., 2010. Gene expression changes in developing zebrafish as potential
7