BK polyomavirus-associated hemorrhagic cystitis among pediatric allogeneic bone marrow transplant recipients: Treatment response and evidence for nosocomial transmission

Journal of Clinical Virology 56 (2013) 77–81

Contents lists available at SciVerse ScienceDirect

Journal of Clinical Virology journal homepage: www.elsevier.com/locate/jcv

Short communication

BK polyomavirus-associated hemorrhagic cystitis among pediatric allogeneic bone marrow transplant recipients: Treatment response and evidence for nosocomial transmission Minna Koskenvuo a,∗ , Alexis Dumoulin b , Irmeli Lautenschlager c , Eeva Auvinen c , Laura Mannonen c , Veli-Jukka Anttila d , Kirsi Jahnukainen a , Ulla M. Saarinen-Pihkala a , Hans H. Hirsch b,e,∗∗ a

Division of Hematology-Oncology and Stem Cell Transplantation, Childrens’ Hospital and Helsinki University Central Hospital, Helsinki, Finland Transplantation and Clinical Virology, Institute for Medical Microbiology, Department of Biomedicine, University of Basel, Basel, Switzerland c Department of Virology, Helsinki University Central Hospital and University of Helsinki, Helsinki, Finland d Department of Medicine, Division of Infectious Diseases, Helsinki University Central Hospital and University of Helsinki, Helsinki, Finland e Division of Infectious Diseases & Hospital Epidemiology, University Hospital Basel, Basel, Switzerland b

a r t i c l e

i n f o

Article history: Received 1 July 2012 Received in revised form 31 August 2012 Accepted 3 September 2012 Keywords: BK virus Cluster Stem cell transplantation Infection Pediatric

a b s t r a c t Background: BK polyomavirus-associated hemorrhagic cystitis (BK-PyVHC) is a significant complication of allogenic hematopoietic stem cell transplantation (HSCT), but risk factors and treatment are currently unresolved. BK-PyVHC typically presents with clinical cystitis, macrohematuria, and increasing urine and blood BKV loads. Objectives: Characterization of children undergoing allogeneic HSCT with BK-PyVHC and their clinical and antibody response to cidofovir treatment. Study design: By prospective screening of urine and plasma in 50 pediatric allogenic HSCT performed between 2008 and 2010, we identified 6 (12%) children with BK-PyVHC. Cidofovir was administered intravenously to 5 patients and intravesically to 4 patients (3 double treatments). Results: Decreasing BKV viremia of > 2 log10 copies/mL and clinical resolution was seen in 4 patients over 5–12 weeks. Responses occurred only in patients mounting BKV-specific IgM and IgG responses. Epidemic curve plots, BKV genotyping and contact tracing provided evidence of transmission between 2 BKVseronegative patients, but ruled out transmission among the remaining four patients Conclusions: The data suggest that BK-PyVHC may be the result of nosocomial transmission in children with low/undetectable BKV antibodies and raises urgent questions about appropriate infection control measures and the role of cidofovir. © 2012 Elsevier B.V. All rights reserved.

1. Background BK polyomavirus-associated hemorrhagic cystitis (BK-PyVHC) affects 5–15% of allogenic hematopoietic stem cell transplantation (HSCT) patients.1–4 BK-PyVHC appears to result from significant cytopathic damage and mucosal denudation caused by high-level BKV replication in the urothelial cell layer damaged by conditioning

∗ Corresponding author at: Division of Hematology-Oncology and Stem Cell Transplantation, Hospital for Children and Adolescents, University of Helsinki, PO Box 281, FI-00029 HUS, Helsinki, Finland. Tel.: +358 947172720/358503624430; fax: +358 947174707. ∗∗ Corresponding author at: Div. of Infectious Diseases & Hospital Epidemiology University Hospital Basel, Petersgraben 4 4031 Basel, Switzerland. Tel.: +41 61 267 3262; fax: +41 61 267 3283. E-mail addresses: minna.koskenvuo@utu.fi (M. Koskenvuo), [email protected] (H.H. Hirsch). 1386-6532/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jcv.2012.09.003

regimen, extensive inflammation potentiated during engraftment and viral leakage into the blood detectable as BKV viremia.3–8 In a seminal study of adult HSCT patients by Arthur and co-workers,1 the risk of BK-PyVHC was linked to the presence of BKV-specific antibodies prior to transplantation. Similarly, pediatric patients with BK-PyVHC were found to be BKV-seropositive9 suggesting that high-level BKV replication in HSCT recipients resulted rather from BKV reactivation than from de novo infection. The current treatment for BK-PyVHC consists of pain relief, maintenance of good hydration and urine flow, local bladder irrigation to avoid clotting and postrenal obstruction, and urologic intervention to control anemic bleeding.4,10 Specific antiviral therapy has not been established. However, many centers resort to using cidofovir,11 a cytidine nucleotide analogue with some inhibitory activity against BKV replication in vitro.11–14 We report a detailed clinical, serological and virological study of six patients with BK-PyVHC identified in a prospectively screened pediatric HSCT cohort (Table 1).

At the time of peak plasma BKV load. At the time of resolution of HC, ALL = acute lymphoblastic leukemia, Bu = busulphan, Cy = cyclophosphamide, ATG = anti-thymocyte globulin, Ara-C = cytarabine, Etop = etoposide, TBI = total body irradiation, MUD = matched unrelated donor, IVS = intavesical cidofovir, TEN = toxic epidermal necrolysis, MTX = methotrexate, CR = complete remission.

a

None 5.0 I 0.345 0.060 1.52 22 17 17.3.2010 Cy/Etop/ATG/TBI ALL M 4 7

MUD

MUD MUD Cy/ATG/TBI Bu/Cy/Etop/TBI M M 6 5 4 6

b

MTX + infliximab

MTX MUD Ara-C/TBI

Burkitt’s 2 CR ALL ALL M 3

8

15.10.2009 11.3.2010

11 22

14 20

0.02 0.04

0.118 0.164

0.335 NA

II IV

5.0 5.0

none IVS

Died of relapse Gr II Died of toxicity Gr I IVS 20

22

0.03

0.004

0.096

III

5.0

TEN Gr III IVS IVS MUD MUD Bu/Cy/ATG/TBI Bu/Cy/ATG ALL ALL 12 8 1 2

M F

4.9.2008 I 14.2.2008 II 21.7.2009 24.9.2009

23 18

26 14

0.32 2.30

0.056 0.204

0.039 0.334

III IV

None 5.0

GvHD or other complication Other treatments for HC Dose of i.v. cidofovir (mg/kg) Grade of HC CD4 counta (109 /L)b CD4 counta (109 /L)a Peak plasma BKV load (× 106 ) Onset of HC (day) Time of engraftment (day) ANC less than 500 × 106 /L Time of BMT Source of the graft Conditioning Dg Sex Age (years) Patient

Table 1 Summary of HSCT patients with BKV-associated hemorrhagic cystitis.

Steroid Infliximab, budesonide

M. Koskenvuo et al. / Journal of Clinical Virology 56 (2013) 77–81

GvHD or other therapy

78

2. Objectives Between June 2008 and December 2010, 50 allogenic HSCT were performed at the Children’s Hospital, University of Helsinki, Finland. Prospective screening consisted of clinical and laboratory assessment and BKV urine PCR, and, when positive, followed by plasma PCR. BK-PyVHC was defined by the triad of clinical cystitis (dysuria, pain, increased frequency of urination), hematuria of grade II–IV (grade 0 = no symptoms, grade I = microscopic hematuria, grade II = macroscopic hematuria, grade IV = macroscopic hematuria with clots and/or urinary retention and possible need for clot evacuation) and BKV viruria followed by increasing viremia.4,15 3. Study design Patients were treated with continuous intravesical bladder irrigation as needed. In case of confirmed BKV viremia, intravenous and/or intravescial treatment with cidofovir was recommended. BKV loads were quantified as described previously.16,17 Total nucleic acids were extracted using the MagNA Pure LC instrument and Total Nucleic Acid extraction kit (Roche Applied Science, Indianapolis, IN). Phylogenetic comparison of BKV VP1 and NCCR were performed based on previous reports.18–22 Briefly, BKV genome sequences encoding part of the VP1 capsid were independently done in Helsinki and in Basel from the plasma samples with peak viral loads. In Helsinki, the VP1 primers VP1-1 (AAAAGGAGGAGTAGAAGTTC) and VP1-2 (TAGTTATTCCAATAACCTCTGT) were used to amplify the region nucleotide1650–1936 within the VP1 gene. In Basel, a nested protocol was used with the outer VP1 primers BKVVP1fsero/nes (CTGCTCCTCAATGGATGTTGCCT) and BKVVP1rsero/nes (CAACCAAAAGAAAAGGAGAGTGTC) were used for the outer PCR. For the inner PCR, the primers BKVVP1fsero (GTGCAAGTGCCAAAACTACTAATAA) and BKVVP1rsero (TGCATGAAGGTTAAGCATGCTAGT) were used. In addition, the NCCR region was amplified in Basel using the primers BKTT-5 (GAGCTCCATGGATTCTTC) and BKTT-6 (CCAGTCCAGGTTTTACCA) for the outer PCR, and BKTT-7 (CCCTGTTAAGAACTTTATCCATTT) and BKTT-8 (AACTTTCACTGAAGCTTGTCGT) for the inner PCR. The PCR mixes consisted of 12.5 ␮l of 2× Pwo Polymerase Master Mix (Roche Biochemicals), 50 pmol of both primers, 5 ␮l DNA extract in 50 ␮l end volume. For the inner PCR, 5 ␮l of outer PCR were used as template. The temperature profile included an activation/denaturation step of 10 min at 95 ◦ C, followed by 40 cycles consisting of 30 s at 95 ◦ C, 30 s at 50 ◦ C (outer PCR) or 55 ◦ C (inner PCR) and 90 s at 72 ◦ C. A final extension of 7 min at 72 ◦ C was added at the end of the reaction. The amplicons were sequenced using the primers BKVVP1fsero, BKVVP1rsero, BKTT7 or BKTT-8 and the BigDye 3.1 reagent mix (Life Technologies Europe, Zug, Switzerland) followed by capillar electrophoresis on a Applied Biosystems 3130 instrument. The VP1 and NCCR sequences were analysed separately or, when combined,22 using the MUSCLE, Gblocks, PhyML and TreeDyn algorithm (www.Phylogeny.fr). BKVIgG and IgM-serology was conducted using VP1-derived virus-like particles purified from baculovirus expression in SF9 cells using a cut-off of OD492 nm 0.110.23 4. Results In the study period from 2008 to 2010, 50 allogenic HSCT were performed in the Children’s Hospital, University of Helsinki, Finland. Six BK-PyVHC cases were identified yielding an incidence rate of 12%, all being matched unrelated HSCT. Patients received symptomatic treatment and continuous intravesical bladder irrigation as needed. Intravenous cidofovir (5 mg/kg weekly) was administered to 5 patients. A more than 2 log10 decline in

60 64 67 74

0.2 0.0

Case 2

0.6 0.4

Case 3

Intravesicular cidofovir Intravenous cidofovir

63

57

8 7

0.6

6

0.4

5 4

0.2

3

0.0

SD-treated plasma IVIg

113 121

2

BKV load (log cp/ml)

9

0.8

95

25 28 32 35 39 42 46 49

19

HSCT

0.2

10

71 78

0.4

1.0

30 43 50 56

0.6

10 9 8 7 6 5 4 3 2

HSCT

0.8

BKV VL (plasma) BKV VL (urine)

48

Case 6

1.0

BKV IgG BKV IgM

42

21

0.0

35

0.2

10 9 8 7 6 5 4 3 2

BKV load (log cp/ml)

0.8

7

10 9 8 7 6 5 4 3 2

1.0

HSCT

148

107 118

90

31 41 48 55 66 76

HSCT 6 17

251

Case 5

3 2 1.0 0.8 0.6 0.4 0.2 0.0

0.0

BKV load (log cp/ml)

0.4

29

40

47 53

27 33

HSCT 4

-10

0.2

0.6

43

0.4

10 9 8 7 6 5 4 3 2

0.8

HSCT 3 7 11 14 18 21 25 28 32 35 39

0.6

1.0

-7

0.8

10 9 8 7 6 5 4 3 2

-209 -203

1.0

0.0

79

Case 4

Case 1

-120

BKV antibody EIA (OD492 nm)

BKV antibody EIA (OD492 nm)

BKV antibody EIA (OD492 nm)

M. Koskenvuo et al. / Journal of Clinical Virology 56 (2013) 77–81

Exitus

Fig. 1. Plasma BKV loads and BKV-specific antibody responses. The cut-off value for positive antibody response is 0.1 EIA (OD492 nm ).

plasma BKV load was observed in 4 patients over 5–12 weeks (Fig. 1). Intravesical cidofovir was administered to 4 patients, three of whom also received intravenous cidofovir. Two patients (Case 3 and Case 6) had persistent or increasing plasma BKV loads despite of administration of intravenous and intravesical cidofovir (Fig. 1). Five of 6 patients had undetectable BKV antibody levels prior to HSCT and at the time of the on-set of BKV viremia. However, four of the 6 patients (Cases 1, 2, 4 and 6) developed new onset IgM and significantly increasing IgG titers, which was paralleled by declining plasma BKV loads and resolving PyVHC. Conversely, two patients without BKV antibody increase had persistent BKV viremia with persistent PyVHC despite administering intravesical/intravenous cidofovir. During the study of 50 patients, 5 of the six cases of BK-PyVHC occurred in 2 overlapping clusters (Fig. 2A). Genomic sequences of the BKV non-coding control region (NCCR) and the BKV capsid VP1 from the peak viremia samples identified thirteen informative polymorphic sites were identified over a length of 585 bp of BKV genome sequence. Thus, BKV in Case 1 having occurred more than 10 months before the first cluster, differed from all other strains

(Fig. 2B). In the first cluster, Case 2 and Case 3 had 100% identical sequences, whereas 9 differences were identified in Case 4. The data indicated that the genetic analysis was able to discriminate between unrelated BKV archetypes and suggested that in the first cluster, Case 2 and Case 3 were genetically and epidemiologically related, but Case 4 was not. In the second cluster, the sequences of Cases 5 and 6 were clearly different indicating that these cases of the second cluster were not epidemiologically related. However, genetic analysis revealed that Case 5 was identical to Case 2 and Case 3 of the first cluster. Given the isolation conditions on the pediatric HSCT ward, we searched for possible modes of contact between Cases 2 and 3 in the first cluster. We found that the single isolation rooms were located next to each other. Both patients had their own nurses at the shifts, but they helped each other whenever needed. Toilet utensils had been shared only after disinfection, but it is unknown whether standard procedures are sufficient for BKV. Of note, the relatives of Cases 2 and 5 had been in direct family contact, and cross-visits had occurred during the time of hospitalization. This offers an unexpected explanation for nosocomial transmission via caring relatives (Fig. 2).

80

M. Koskenvuo et al. / Journal of Clinical Virology 56 (2013) 77–81

Fig. 2. Epidemiological studies. (A) Epidemic curve plot of BKV viremia. (B) Phylogenetic tree of the BKV variants. The tree reflects the combined analysis of the VP1 and NCCR sequences (total 585 nucleotides). The bar indicates the number of nucleotide changes per position.

Nosocomial transmission of polyomaviruses including BKV has not been documented.15 Seroprevalence studies indicate that up to 90% of primary BKV infections occur in children aged 2–4 years after waning of maternal antibodies.27 BKV and JCV are hardy agents fairly resistant to environmental inactivation and their detection in urban sewage is consistent with a risk of feco-oral transmission.28 In addition, polyomaviruses have been detected in stool specimens of children and adults.29–31 About 10–40% of healthy blood donors have been found to shed low-levels of BKV and JCV in the urine,23 and the rates and viral loads increase significantly in immunocompromised and HSCT patients. High-level BKV viruria is found most asymptomatic HSCT patients32 indicating that high-level BKV viruria by itself is not sufficient for BK-PyVHC pathology rendering BKV viremia a more specific marker for screening and follow-up.4,8 We cannot exclude that viral transmission occurred prior to transplantation. However, the children had been very sick from their underlying disease and hospitalized for treatment/conditioning. Hence, our results suggest that nosocomial BKV transmission pre- or post-HSCT is a possible scenario in severely immunocompromised children with low or undetectable BKV-specific antibodies. Combined epidemiologic cluster and molecular-genetic analysis is required to rule in a common source. Future studies need to verify our data in other setting, but strict attention to hygiene measure may be warranted for health care works and relatives caring for patients with BK-PyVHC. 6. Summary

5. Discussion BK-PyVHC is a significant complication after allogeneic HSCT and critical issues of incidence, risk factors and treatment are far from resolved.4,10 The rate of 12% in our study is in the higher range of current experiences. The time course of increasing and decreasing BKV viremia suggests that plasma BKV loads might be a surrogate of significant BK-PyVHC as suggested previously.8,24 The BKV-specific IgM and IgG increase in our patients is novel and independent of the administration of intravenous immunoglobulin. The rise was associated with a clinical response and declining plasma BKV loads in patients treated with cidofovir. Conversely, 2 patients did not show a rise in BKV-specific antibodies and also failed to show a response to cidofovir treatment. As virus-specific cellular immunity is viewed as the major mechanism of control for CMV and BKV in kidney transplant patients,25,26 we favor the hypothesis that rising BKV antibody titers identify patients with residual cellular immune competence facilitating the resolution of BK-PyVHC under cidofovir treatment. However, virus neutralization and clearance might have a cofactorial role. The low/undetectable BKV antibody titers and the clustering of 5 patients with BK-PyVHC among 50 allogeneic HSCT suggested the possibility of nosocomial transmission. This was supported by phylogenetic analysis indicating that Cases 2 and 3 of the first cluster were infected with the same BKV variant. Despite reports of genotypic individual PyV polymorphisms,19–21 we cannot rule out that two individuals by chance alone might harbour an identical BKV archetype. However, by combining the NCCR and the VP1 gene sequences for analysis, we have found only one similar sequence among more than 250 of data base entries. Although no population-based data are available, we regard this as good support that individual tracing is possible, by allowing to rule out strain identity and hence exclude transmission to other patients within the clusters. Conversely, the genetic identity between Case 2 and Case 5 belonging to two unrelated clusters helped us to uncover previously unnoticed contacts through cross visits. Importantly, phylogenetic analysis clearly ruled out genetic identity, and hence transmission, between the remaining patients of this study.

Hemorrhagic cystitis can significantly complicate allogenic HSCT, but risk factors and therapy are unresolved. We report 6 cases out of our prospectively followed cohort of pediatric HSCT. Decreasing plasma BKV viremia following cidofovir treatment occurred only with a significant antibody increases. Genetic analysis identified two cases of nosocomial transmission. Funding This work was supported by grants from Helsinki University Hospital Funds to U.P. and I.L., and by an unrestricted appointment grant of the University of Basel to H.H.H. Competing interest The authors declare no competing financial interests. Ethical approval The study was approved by the Ethics Committee of Helsinki University Hospital. References 1. Arthur RR, Shah KV, Baust SJ, Santos GW, Saral R. Association of BK viruria with hemorrhagic cystitis in recipients of bone marrow transplants. N Engl J Med 1986;315(4):230–4. 2. Bedi A, Miller CB, Hanson JL, Goodman S, Ambinder RF, Charache P, et al. Association of BK virus with failure of prophylaxis against hemorrhagic cystitis following bone marrow transplantation. J Clin Oncol 1995;13(5):1103–9. 3. Gorczynska E, Turkiewicz D, Rybka K, Toporski J, Kalwak K, Dyla A, et al. Incidence, clinical outcome, and management of virus-induced hemorrhagic cystitis in children and adolescents after allogeneic hematopoietic cell transplantation. Biol Blood Marrow Transplant 2005;11(10):797–804. 4. Hirsch HH. Polyoma and papilloma virus infections after hematopoietic stem cell or solid organ transplantation. In: Bowden P, Ljungman P, Snydman DR, editors. Transplant infections. Third ed. Lippincott Williams & Wilkins; 2010. p. 465–82. 5. Binet I, Nickeleit V, Hirsch HH. Polyomavirus infections in transplant recipients. Curr Opin Organ Transplant 2000;5:210–6. 6. Azzi A, Fanci R, Bosi A, Ciappi S, Zakrzewska K, de Santis R, et al. Monitoring of polyomavirus BK viruria in bone marrow transplantation patients by DNA hybridization assay and by polymerase chain reaction: an approach to assess

M. Koskenvuo et al. / Journal of Clinical Virology 56 (2013) 77–81

7.

8.

9.

10. 11.

12.

13.

14.

15.

16.

17.

18.

the relationship between BK viruria and hemorrhagic cystitis. Bone Marrow Transplant 1994;14(2):235–40. Leung AY, Suen CK, Lie AK, Liang RH, Yuen KY, Kwong YL. Quantification of polyoma BK viruria in hemorrhagic cystitis complicating bone marrow transplantation. Blood 2001;98(6):1971–8. Erard V, Kim HW, Corey L, Limaye A, Huang ML, Myerson D, et al. BK DNA viral load in plasma: evidence for an association with hemorrhagic cystitis in allogeneic hematopoietic cell transplant recipients. Blood 2005;106(3):1130–2. Bogdanovic G, Priftakis P, Taemmeraes B, Gustafsson A, Flaegstad T, Winiarski J, et al. Primary BK virus (BKV) infection due to possible BKV transmission during bone marrow transplantation is not the major cause of hemorrhagic cystitis in transplanted children. Pediatr Transplant 1998;2(4):288–93. Dropulic LK, Jones RJ. Polyomavirus BK infection in blood and marrow transplant recipients. Bone Marrow Transplant 2008;41(1):11–8. Cesaro S, Hirsch HH, Faraci M, Owoc-Lempach J, Beltrame A, Tendas A, et al. Cidofovir for BK virus-associated hemorrhagic cystitis: a retrospective study. Clin Infect Dis 2009;49(2):233–40. Bernhoff E, Gutteberg TJ, Sandvik K, Hirsch HH, Rinaldo CH. Cidofovir inhibits polyomavirus BK replication in human renal tubular cells downstream of viral early gene expression. Am J Transplant 2008;8:1413–22. Rinaldo CH, Gosert R, Bernhoff E, Finstad S, Hirsch HH. 1-O-hexadecyloxypropyl cidofovir (CMX001) effectively inhibits polyomavirus BK replication in primary human renal tubular epithelial cells. Antimicrob Agents Chemother 2010;54(11):4714–22. Randhawa P, Farasati NA, Shapiro R, Hostetler KY. Ether lipid ester derivatives of cidofovir inhibit polyomavirus BK replication in vitro. Antimicrob Agents Chemother 2006;50(4):1564–6. Zaia J, Baden L, Boeckh MJ, Chakrabarti S, Einsele H, Ljungman P, et al. Viral disease prevention after hematopoietic cell transplantation. Bone Marrow Transplant 2009;44(8):471–82. Hirsch HH, Mohaupt M, Klimkait T. Prospective monitoring of BK virus load after discontinuing sirolimus treatment in a renal transplant patient with BK virus nephropathy. J Infect Dis 2001;184(11):1494–5, author reply 5–6. Dumoulin A, Hirsch HH. Reevaluating and optimizing polyomavirus BK and JC real-time PCR assays to detect rare sequence polymorphisms. J Clin Microbiol 2011;49(4):1382–8. Jin L. Molecular methods for identification and genotyping of BK virus. Methods Mol Biol 2001;165:33–48.

81

19. Cubitt CL. Molecular genetics of the BK virus. Adv Exp Med Biol 2006;577:85–95. 20. Ikegaya H, Saukko PJ, Tertti R, Metsarinne KP, Carr MJ, Crowley B, et al. Identification of a genomic subgroup of BK polyomavirus spread in European populations. J Gen Virol 2006;87(Pt 11):3201–8. 21. Bohl DL, Storch GA, Ryschkewitsch C, Gaudreault-Keener M, Schnitzler MA, Major EO, et al. Donor origin of BK virus in renal transplantation and role of HLA C7 in susceptibility to sustained BK viremia. Am J Transplant 2005;5(9):2213–21. 22. Scuda N, Hofmann J, Calvignac-Spencer S, Ruprecht K, Liman P, Kuhn J, et al. A novel human polyomavirus closely related to the African green monkey-derived lymphotropic polyomavirus (LPV). J Virol 2011. 23. Egli A, Infanti L, Dumoulin A, Buser A, Samaridis J, Stebler C, et al. Prevalence of polyomavirus BK and JC infection and replication in 400 healthy blood donors. J Infect Dis 2009;199:837–46. 24. Hirsch HH, Knowles W, Dickenmann M, Passweg J, Klimkait T, Mihatsch MJ, et al. Prospective study of polyomavirus type BK replication and nephropathy in renal-transplant recipients. N Engl J Med 2002;347(7):488–96. 25. Binggeli S, Egli A, Schaub S, Binet I, Mayr M, Steiger J, et al. Polyomavirus BK-specific cellular immune response to VP1 and large T-antigen in kidney transplant recipients. Am J Transplant 2007;7(5):1131–9. 26. Widmann T, Sester U, Gartner BC, Schubert J, Pfreundschuh M, Kohler H, et al. Levels of CMV specific CD4 T cells are dynamic and correlate with CMV viremia after allogeneic stem cell transplantation. PLoS One 2008;3(11):e3634. 27. Knowles WA, Pipkin P, Andrews N, Vyse A, Minor P, Brown DW, et al. Populationbased study of antibody to the human polyomaviruses BKV and JCV and the simian polyomavirus SV40. J Med Virol 2003;71(1):115–23. 28. Bofill-Mas S, Formiga-Cruz M, Clemente-Casares P, Calafell F, Girones R. Potential transmission of human polyomaviruses through the gastrointestinal tract after exposure to virions or viral DNA. J Virol 2001;75(21):10290–9. 29. Vanchiere JA, Abudayyeh S, Copeland CM, Lu LB, Graham DY, Butel JS. Polyomavirus shedding in the stool of healthy adults. J Clin Microbiol 2009;47(8):2388–91. 30. Vanchiere JA, White ZS, Butel JS. Detection of BK virus and simian virus 40 in the urine of healthy children. J Med Virol 2005;75(3):447–54. 31. Vanchiere JA, Nicome RK, Greer JM, Demmler GJ, Butel JS. Frequent detection of polyomaviruses in stool samples from hospitalized children. J Infect Dis 2005;192(4):658–64. 32. Arthur RR, Shah KV, Charache P, Saral R. BK and JC virus infections in recipients of bone marrow transplants. J Infect Dis 1988;158(3):563–9.