- Email: [email protected]
blaCTX-M-carrying Escherichia coli of the O25b ST131 clonal group have emerged in China
Available online at www.sciencedirect.com
Diagnostic Microbiology and Infectious Disease 69 (2011) 228 – 231 www.elsevier.com/locate/diagmicrobio
blaCTX-M-carrying Escherichia coli of the O25b ST131 clonal group have emerged in China☆ Zhiyong Zonga,b,⁎, Rujia Yua,b b
a Center of Infectious Diseases, West China Hospital, Sichuan University, Chengdu, China State Key Laboratory of Biotherapy, Division of Infectious Diseases, Sichuan University, Chengdu, China Received 20 May 2010; accepted 14 October 2010
Abstract Six Escherichia coli O25b ST131 isolates, which were mostly hospital-acquired but from various types of samples, were found to carry blaCTX-M-3a, blaCTX-M-14, or blaCTX-M-65 genes, demonstrating that such isolates have emerged in China. The blaCTX-M genes were mostly carried by IncFII-related conjugative plasmids. All isolates were also resistant to ciprofloxacin and gentamicin and had substitutions in GyrA and carried an aac(3)-II gene. © 2011 Elsevier Inc. All rights reserved. Keywords: Escherichia coli; Plasmid; Extended-spectrum β-lactamase
blaCTX-M genes have become the dominant gene family encoding extended-spectrum β-lactamases. It was reported recently that the intercontinental spread of blaCTX-M-15, the most common blaCTX-M variant, is largely mediated by Escherichia coli of O antigen type 25 and sequence type 131 (O25 ST131) (Coque et al.,, 2008; Nicolas-Chanoine et al., 2008). O25 ST131 isolates have since been reported in many countries and are also associated with blaCTX-M variants other than blaCTX-M-15, representing an emerging, serious challenge for therapy and public health. Although blaCTX-M genes are prevalent in China, ST131 isolates have not yet been reported in this country. Several ST131 isolates carrying different blaCTX-M genes on conjugative plasmids were identified in this study and are described here. Local Enterobacteriaceae collected from October 2005 to April 2006 were screened for blaCTX-M genes by PCR (primers listed in Table 1), and 84 nonreplicate E. coli carrying blaCTX-M were detected. Species identification and antimicrobial susceptibility testing were performed using the Phoenix automated system (BD, Franklin Lakes, ☆
Nucleotide sequences accession number. The new RepFIIA of WCE035 has been deposited in GenBank as GU462158. ⁎ Corresponding author. Tel.: +86-28-8542-2637; fax: +86-28-85423212. E-mail address: [email protected] (Z. Zong). 0732-8893/$ – see front matter © 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.diagmicrobio.2010.10.007
NJ, USA). All E. coli carrying blaCTX-M genes were subjected to phylogenetic group typing (Clermont et al., 2000) and O25b allele PCR (Clermont et al., 2008). Two established PCR methods (Clermont et al., 2009; Johnson et al., 2009) were used to identify ST131 isolates among O25b-phylogroup B2 isolates. Conjugation experiments were carried out in broth using E. coli DH5αRf, a spontaneous rifampicin-resistant mutant of DH5α, or J53 (resistance to azide) as recipients. Transconjugants were selected on plates containing 4 μg/mL cefotaxime plus 250 μg/mL rifampicin (for DH5αRf) or plus 150 μg/mL sodium azide (for J53). Plasmids prepared from transconjugants by alkaline lysis were subjected to HpaI restriction and PCR-based replicon typing (Carattoli et al., 2005). IncFII-related replicons (RepFIIA) were amplified with primers CA1/OR1 (Osborn et al., 2000). As most ST131 isolates are resistant to ciprofloxacin, the gyrA alleles were amplified and partially sequenced as described previously (Lindgren et al., 2003). Plasmidmediated quinolone resistance (PMQR) determinants, qnrA, qnrB, qnrS, and qepA, were also screened for by PCR as described previously (Cattoir et al., 2007; Yamane et al., 2008) and aac(6′)-Ib-cr was identified by sequencing. aac(3)-II, blaTEM, and blaOXA-1 genes were also screened for as they are common in ST131 isolates carrying blaCTX-M-15.
Z. Zong, R. Yu / Diagnostic Microbiology and Infectious Disease 69 (2011) 228–231
229
Table 1 Selected primers for PCR Primer
Sequence 5–3a
Target
Reference
CTX-U1 CTX-U2 ISEcp1IR-F 5orf903-R orf477-R rfbO25b rfb.1bis ChuA.1 ChuA.2 TspE4C2.1 TspE4C2.2 YjaA.1 YjaA.2 O25pabBspe.F O25pabBspe.R mdh36_forward mdh36_reverse gyrB47_forward gyrB47_reverse CA1 OR1 blaTEM-F blaTEM-R OXA1A OXA1B aacA4-F aacA4-R2 aac(3)-II.F aac(3)-II.R QnrBm-F QnrBm-R GyrAF21 GyrAR1000
ATGTGCAGYACCAGTAARGTKATGGC TGGGTRAARTARGTSACCAGAAYCAGCGG CAATGTGTGAGAAGCAGTCTAAA CGGTTGATGAGGGCTTTATT GGTGGCATAATTTTTGAAGT TGCTATTCATTATGCGCAGC ATACCGACGACGCCGATCTG GACGAACCAACGGTCAGGAT TGCCGCCAGTACCAAAGACA GAGTAATGTCGGGGCATTCA CGCGCCAACAAAGTATTACG TGAAGTGTCAGGAGACGCTG ATGGAGAATGCGTTCCTCAAC TCCAGCAGGTGCTGGATCGT GCGAAATTTTTCGCCGTACTGT GTTTAACGTTAACGCCGGT GGTAACACCAGAGTGACCA CGCGATAAGCGCGAC ACCGTCTTTTTCGGTGGAA ATGTCGCASAYHGAAAATGC CCTTGCAGTTWWHTGTGRRTAA GAGTATTCAACATTTTCGT ACCAATGCTTAATCAGTGA AGCCGTTAAAATTAAGCCC CTTGATTGAAGGGTTGGGCG TGACCTTGCGATGCTCTATG TTAGGCAWCACTGCGTGTTC CGTATGAGATGCCGATGC AAGATAGGTGACGCCGAAC GGMATHGAAATTCGCCACTG TTTGCYGYYCGCCAGTCGAA GAACTCACCTTCCAGATCC GAGCGCGGATATACACCTT
blaCTX-M
(Mulvey et al., 2003)
ISEcp1, 3′ end IS903 orf477 O25b
(Zong et al., 2008) (Zong et al., 2008) (Zong et al., 2008) (Clermont et al., 2008)
chuA
(Clermont et al., 2000)
TspE4C2
(Clermont et al., 2000)
yjaA
(Clermont et al., 2000)
pabB specific for ST131
(Clermont et al., 2009)
mdh with SNP for ST131
(Johnson et al., 2009)
gyrB with SNP for ST131
(Johnson et al., 2009)
RepFIIA
(Osborn et al., 2000)
blaTEM
(Maynard et al., 2004)
blaOXA
(Aubert et al., 2001)
aac(6′)-Ib
This study
aac(3)-II qnrB
Thomas L. unpublished (Cattoir et al., 2007)
gyrA
(Lindgren et al., 2003)
a
H: A, C or T; K: G or T; M: A or C; R: A or G; S: C or G; W: A or T; Y: C or T.
Six local isolates were typed as O25b and belonged to phylogenetic group B2 (Table 2). All 6 isolates were identified as ST131 and accounted for 7% of local E. coli carrying blaCTX-M genes. These ST131 isolates were recovered from various sample types, that is, ascites, blood, pleural fluid, sputum, and urine; and all but one were associated with nosocomial infections (Table 2). Five of the 6 ST131 isolates carried blaCTX-M-14 and 1 carried blaCTX-M-65 (Table 2), which encodes a variant of CTX-M-14 with 2 amino acid substitutions. One isolate, WCE233, has blaCTX-M-3a (identical to GenBank accession no. Y10278) in addition to blaCTX-M-14. Although ST131 isolates carrying blaCTX-M-15 have been found in many countries (Coque et al., 2008; NicolasChanoine et al., 2008), such isolates were not identified in our local collection. In addition, none of isolates carrying blaCTX-M-15 collected from Guangzhou, southern China, were O25b ST131 (Zhuo C, unpublished data). These findings suggest that O25b ST131 isolates carrying blaCTX-M-15 might have not emerged in China. Transconjugants carrying blaCTX-M-14 or blaCTX-M-65 were obtained from 5 of 6 isolates, and for WCE233,
which had 2 blaCTX-M genes, only transconjugants carrying blaCTX-M-3a were obtained. Replicon typing revealed that 4 conjugative plasmids (all carrying blaCTX-M-14) had IncFII-like replicons. The plasmid carrying blaCTX-M-65 from WCE307 was IncN, while the incompatibility group for the plasmid carrying blaCTX-M-3a could not be assigned. Sequencing of the RepFIIA amplicon revealed that in 3 plasmids this region was identical to R100 (Table 2). This R100-type RepFIIA is also present on a few plasmids carrying blaCTX-M-15 from ST131 isolates recovered in different countries (Coque et al., 2008) including pC151a from Canada, pEK499 and pEK516 from UK, and pJIE100 and pJIE186 from Australia (Zong et al., unpublished data). The remaining local IncFII-related plasmid carried a new variant of RepFIIA, closest (94% identity) to that of pSFO157 and 90% identical to those of R100 and pC15-1a. HpaI fingerprinting of plasmid DNA gave identical patterns for the plasmids carrying blaCTX-M-14 from WCE266 and WCE296 and the plasmid from WCE208 gave a related pattern. The remaining 3 plasmids gave distinct HpaI patterns.
230
Z. Zong, R. Yu / Diagnostic Microbiology and Infectious Disease 69 (2011) 228–231
Table 2 Characteristics of ST131 isolates in this studya Isolate
Sample Sourceb Patient Predisposing (sex, age) conditions (interval)c
WCE035 Sputum H
M, 54
WCE208 Urine WCE233 Blood
C H
F, 56 F, 59
WCE266 Acites
H
M, 18
WCE296 Pleural fluid
H
F, 62
WCE307 Blood
H
F, 54
blaCTX-M variants
Plasmid Inc RepFIIA HpaI GyrA blaOXA-1 PMQR Cassette arrayd group type substitution(s)
Liver transplantation blaCTX-M-14 FII-related Newe (7 d) FII-related R100 Diabetes (5 y) blaCTX-M-14 Choledochotomy (5 d) blaCTX-M-3a, -14 Unassignedf – Tuberculous blaCTX-M-14 peritonitis (1 m) Unclassified blaCTX-M-14 connective tissue disease (1 m) Choledochoscope (2 d) blaCTX-M-65
1
S83Y
−
−
2A 3
S83Y, D87N S83Y, D87N
− +
−
FII-related
R100
2B
S83Y, D87N
−
− + qnrB4, − -cr g − +
FII-related
R100
2B
S83Y, D87N
−
−
+
N
–
4
S83Y, D87N
−
−
+
a
All of these isolates carry blaTEM and aac(3)-II, but neither genes were co-transferred with blaCTX-M. b Source: C, community-acquired; H, hospital-acquired. c Interval: the time interval between predisposing conditions and collection of samples from which ST131 isolates were recovered. y, years; m, months; d, days. d dfrA17-aadA5 cassette array. This cassette array was co-transferred with blaCTX-M from WCE266 and WCE296 but not from WCE208 and WCE307. e WCE035 had an identical, novel RepFIIA, closest (94% identity) to that of pSFO157 (see text). f Only blaCTX-M-3a was transferred by conjugation on a plasmid whose Inc group could not be assigned. g -cr, aac(6′)-Ib-cr.
All ST131 isolates in this study were resistant to ciprofloxacin, and sequencing of gyrA revealed the Ser83Tyr substitution alone (in WCE035) or with the Asp87Asn substitution (in all other isolates). Both substitutions of GyrA have been seen before in fluoroquinolone-resistant ST131 isolates (Cagnacci et al., 2008; Cerquetti et al., 2010; Johnson et al., 2010). PMQR were only detected in WCE233, which had qnrB4 and aac(6′)-Ib-cr. Only WCE233 had blaOXA-1, but blaOXA-1 and aac(6′)-Ib-cr were not co-transferred with blaCTX-M-3a. All ST131 isolates in this study were also resistant to gentamicin and tobramycin and had aac(3)-II. In contrast to a study from Canada (Pitout et al., 2009), which reported that no ST131 isolates carrying blaCTX-M-14 had blaTEM, all ST131 isolates in this study had blaTEM. However, the co-transfer of blaTEM or aac(3)-II with blaCTX-M was not observed here. In summary, O25b ST131 E. coli isolates carrying blaCTX-M genes have emerged in China, but only blaCTX-M-3a, blaCTX-M-14, and blaCTX-M-65 were identified, unlike many countries where ST131 isolates largely carry blaCTX-M-15. ST131 isolates carrying blaCTX-M-14 have been found in Cambodia (Clermont et al., 2009), Canada (Pitout et al., 2009), France (Clermont et al., 2009), Japan (Suzuki et al., 2009), Spain (Clermont et al., 2009; Oteo et al., 2009), and USA (Sidjabat et al., 2009). This study adds to the evidence that ST131 isolates are involved in the international spread of blaCTX-M-14, although to a much lesser extent than blaCTX-M-15. The identification of an O25b ST131 isolate carrying blaCTX-M-65 adds new evidence for this lineage acquiring plasmids with various blaCTX-M genes. The blaCTX-M genes in ST131 isolates identified here were usually carried by IncFII-related conjugative plasmids that did not harbor blaTEM, blaOXA-1, aac(6′)-Ib-cr, and
aac(3)-II, unlike plasmids carrying blaCTX-M-15. Of note, ST131 isolates may carry other β-lactamase genes, for example, blaSHV- or blaTEM-type ESBL genes (Cerquetti et al., 2010; Clermont et al., 2009; Novais et al., 2010) or the blaCMY-2 AmpC gene (Oteo et al., 2010), and/or may lack any β-lactamase genes (Cagnacci et al., 2008; LeflonGuibout et al., 2008). Together with previous observations, the data presented here suggest that O25b ST131 isolates have acquired different plasmids, mostly IncFII-related, and served as an important vector mediating the spread of different blaCTX-M variants to different regions of the world. Acknowledgments This work was partially supported by a grant from the National Natural Science Foundation of China (project no. 30900052). The authors thank Xiaobo Ma for collecting the clinical isolates. The authors are grateful to James Johnson, Brian Johnston, and Olivier Clemont for providing ST131 isolates carrying blaCTX-M-15 as controls and to Jon Iredell and Sally Partridge for providing E. coli DH5αRf, and also thank Sally Partridge for critical reading of the manuscript. References Aubert D, Poirel L, Chevalier J, Leotard S, Pages JM, Nordmann P (2001) Oxacillinase-mediated resistance to cefepime and susceptibility to ceftazidime in Pseudomonas aeruginosa. Antimicrob Agents Chemother 45:1615–1620. Cagnacci S, Gualco L, Debbia E, Schito GC, Marchese A (2008) European emergence of ciprofloxacin-resistant Escherichia coli clonal groups O25:H4-ST 131 and O15:K52:H1 causing community-acquired uncomplicated cystitis. J Clin Microbiol 46:2605–2612.
Z. Zong, R. Yu / Diagnostic Microbiology and Infectious Disease 69 (2011) 228–231 Carattoli A, Bertini A, Villa L, Falbo V, Hopkins KL, Threlfall EJ (2005) Identification of plasmids by PCR-based replicon typing. J Microbiol Methods 63:219–228. Cattoir V, Poirel L, Rotimi V, Soussy CJ, Nordmann P (2007) Multiplex PCR for detection of plasmid-mediated quinolone resistance qnr genes in ESBL-producing enterobacterial isolates. J Antimicrob Chemother 60:394–397. Cerquetti M, Giufre M, Garcia-Fernandez A, Accogli M, Fortini D, Luzzi I, Carattoli A (2010) Ciprofloxacin-resistant, CTX-M-15–producing Escherichia coli ST131 clone in extraintestinal infections in Italy. Clin Microbiol Infect :2010, doi:10.1111/j.1469-0691.2010.03162.x. (published advance Jan). Clermont O, Bonacorsi S, Bingen E (2000) Rapid and simple determination of the Escherichia coli phylogenetic group. Appl Environ Microbiol 66:4555–4558. Clermont O, Lavollay M, Vimont S, Deschamps C, Forestier C, Branger C, Denamur E, Arlet G (2008) The CTX-M-15–producing Escherichia coli diffusing clone belongs to a highly virulent B2 phylogenetic subgroup. J Antimicrob Chemother 61:1024–1028. Clermont O, Dhanji H, Upton M, authors other (2009) Rapid detection of the O25b-ST131 clone of Escherichia coli encompassing the CTX-M-15– producing strains. J Antimicrob Chemother 64:274–277. Coque TM, Novais A, Carattoli A, Poirel L, Pitout J, Peixe L, Baquero F, Canton R, Nordmann P (2008) Dissemination of clonally related Escherichia coli strains expressing extended-spectrum β-lactamase CTX-M-15. Emerg Infect Dis 14:195–200. Johnson JR, Menard M, Johnston B, Kuskowski MA, Nichol K, Zhanel GG (2009) Epidemic clonal groups of Escherichia coli as a cause of antimicrobial-resistant urinary tract infections in Canada, 2002 to 2004. Antimicrob Agents Chemother 53:2733–2739. Johnson JR, Johnston B, Clabots C, Kuskowski MA, Castanheira M (2010) Escherichia coli sequence type ST131 as the major cause of serious multidrug-resistant E. coli infections in the United States. Clin Infect Dis 51:286–294. Leflon-Guibout V, Blanco J, Amaqdouf K, Mora A, Guize L, NicolasChanoine MH (2008) Absence of CTX-M enzymes but high prevalence of clones, including clone ST131, among fecal Escherichia coli isolates from healthy subjects living in the area of Paris, France. J Clin Microbiol 46:3900–3905. Lindgren PK, Karlsson A, Hughes D (2003) Mutation rate and evolution of fluoroquinolone resistance in Escherichia coli isolates from patients with urinary tract infections. Antimicrob Agents Chemother 47: 3222–3232. Maynard C, Bekal S, Sanschagrin F, Levesque RC, Brousseau R, Masson L, Lariviere S, Harel J (2004) Heterogeneity among virulence and antimicrobial resistance gene profiles of extraintestinal Escherichia
231
coli isolates of animal and human origin. J Clin Microbiol 42:5444–5452. Mulvey MR, Soule G, Boyd D, Demczuk W, Ahmed R (2003) Characterization of the first extended-spectrum β-lactamase–producing Salmonella isolate identified in Canada. J Clin Microbiol 41:460–462. Nicolas-Chanoine MH, Blanco J, Leflon-Guibout V, authors other (2008) Intercontinental emergence of Escherichia coli clone O25:H4-ST131 producing CTX-M-15. J Antimicrob Chemother 61:273–281. Novais A, Baquero F, Machado E, Canton R, Peixe L, Coque TM (2010) International spread and persistence of TEM-24 is caused by the confluence of highly penetrating enterobacteriaceae clones and an IncA/ C2 plasmid containing Tn1696::Tn1 and IS5075-Tn21. Antimicrob Agents Chemother 54:825–834. Osborn AM, da Silva Tatley FM, Steyn LM, Pickup RW, Saunders JR (2000) Mosaic plasmids and mosaic replicons: evolutionary lessons from the analysis of genetic diversity in IncFII-related replicons. Microbiology 146:2267–2275. Oteo J, Diestra K, Juan C, authors other (2009) Extended-spectrum β-lactamase–producing Escherichia coli in Spain belong to a large variety of multilocus sequence typing types, including ST10 complex/A, ST23 complex/A and ST131/B2. Int J Antimicrob Agents 34:173–176. Oteo J, Cercenado E, Cuevas O, Bautista V, Delgado-Iribarren A, Orden B, Perez-Vazquez M, Garcia-Cobos S, Campos J (2010) AmpC β-lactamases in Escherichia coli: emergence of CMY-2-producing virulent phylogroup D isolates belonging mainly to STs 57, 115, 354, 393, and 420, and phylogroup B2 isolates belonging to the international clone O25b-ST131. Diagn Microbiol Infect Dis 67:270–276. Pitout JD, Gregson DB, Campbell L, Laupland KB (2009) Molecular characteristics of extended-spectrum β-lactamase–producing Escherichia coli causing bacteraemia in the Calgary Health Region 2000–07: the emergence of clone ST131 as a cause of community-acquired infections. Antimicrob Agents Chemother 53:2846–2851. Sidjabat HE, Paterson DL, Adams-Haduch JM, Ewan L, Pasculle AW, Muto CA, Tian GB, Doi Y (2009) Molecular epidemiology of CTX-M– producing Escherichia coli isolates at a tertiary medical center in western Pennsylvania. Antimicrob Agents Chemother 53:4733–4739. Suzuki S, Shibata N, Yamane K, Wachino JI, Ito K, Arakawa Y (2009) Rapid change in the prevalence of extended-spectrum β-lactamase– producing Escherichia coli in Japan by clonal spread. J Antimicrob Chemother 63:72–79. Yamane K, Wachino J, Suzuki S, Arakawa Y (2008) Plasmid-mediated qepA gene among Escherichia coli clinical isolates from Japan. Antimicrob Agents Chemother 52:1564–1566. Zong Z, Partridge SR, Thomas L, Iredell JR (2008) Dominance of blaCTX-M within an Australian extended-spectrum β-lactamase gene pool. Antimicrob Agents Chemother 52:4198–4202.
Diagnostic Microbiology and Infectious Disease 69 (2011) 228 – 231 www.elsevier.com/locate/diagmicrobio
blaCTX-M-carrying Escherichia coli of the O25b ST131 clonal group have emerged in China☆ Zhiyong Zonga,b,⁎, Rujia Yua,b b
a Center of Infectious Diseases, West China Hospital, Sichuan University, Chengdu, China State Key Laboratory of Biotherapy, Division of Infectious Diseases, Sichuan University, Chengdu, China Received 20 May 2010; accepted 14 October 2010
Abstract Six Escherichia coli O25b ST131 isolates, which were mostly hospital-acquired but from various types of samples, were found to carry blaCTX-M-3a, blaCTX-M-14, or blaCTX-M-65 genes, demonstrating that such isolates have emerged in China. The blaCTX-M genes were mostly carried by IncFII-related conjugative plasmids. All isolates were also resistant to ciprofloxacin and gentamicin and had substitutions in GyrA and carried an aac(3)-II gene. © 2011 Elsevier Inc. All rights reserved. Keywords: Escherichia coli; Plasmid; Extended-spectrum β-lactamase
blaCTX-M genes have become the dominant gene family encoding extended-spectrum β-lactamases. It was reported recently that the intercontinental spread of blaCTX-M-15, the most common blaCTX-M variant, is largely mediated by Escherichia coli of O antigen type 25 and sequence type 131 (O25 ST131) (Coque et al.,, 2008; Nicolas-Chanoine et al., 2008). O25 ST131 isolates have since been reported in many countries and are also associated with blaCTX-M variants other than blaCTX-M-15, representing an emerging, serious challenge for therapy and public health. Although blaCTX-M genes are prevalent in China, ST131 isolates have not yet been reported in this country. Several ST131 isolates carrying different blaCTX-M genes on conjugative plasmids were identified in this study and are described here. Local Enterobacteriaceae collected from October 2005 to April 2006 were screened for blaCTX-M genes by PCR (primers listed in Table 1), and 84 nonreplicate E. coli carrying blaCTX-M were detected. Species identification and antimicrobial susceptibility testing were performed using the Phoenix automated system (BD, Franklin Lakes, ☆
Nucleotide sequences accession number. The new RepFIIA of WCE035 has been deposited in GenBank as GU462158. ⁎ Corresponding author. Tel.: +86-28-8542-2637; fax: +86-28-85423212. E-mail address: [email protected] (Z. Zong). 0732-8893/$ – see front matter © 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.diagmicrobio.2010.10.007
NJ, USA). All E. coli carrying blaCTX-M genes were subjected to phylogenetic group typing (Clermont et al., 2000) and O25b allele PCR (Clermont et al., 2008). Two established PCR methods (Clermont et al., 2009; Johnson et al., 2009) were used to identify ST131 isolates among O25b-phylogroup B2 isolates. Conjugation experiments were carried out in broth using E. coli DH5αRf, a spontaneous rifampicin-resistant mutant of DH5α, or J53 (resistance to azide) as recipients. Transconjugants were selected on plates containing 4 μg/mL cefotaxime plus 250 μg/mL rifampicin (for DH5αRf) or plus 150 μg/mL sodium azide (for J53). Plasmids prepared from transconjugants by alkaline lysis were subjected to HpaI restriction and PCR-based replicon typing (Carattoli et al., 2005). IncFII-related replicons (RepFIIA) were amplified with primers CA1/OR1 (Osborn et al., 2000). As most ST131 isolates are resistant to ciprofloxacin, the gyrA alleles were amplified and partially sequenced as described previously (Lindgren et al., 2003). Plasmidmediated quinolone resistance (PMQR) determinants, qnrA, qnrB, qnrS, and qepA, were also screened for by PCR as described previously (Cattoir et al., 2007; Yamane et al., 2008) and aac(6′)-Ib-cr was identified by sequencing. aac(3)-II, blaTEM, and blaOXA-1 genes were also screened for as they are common in ST131 isolates carrying blaCTX-M-15.
Z. Zong, R. Yu / Diagnostic Microbiology and Infectious Disease 69 (2011) 228–231
229
Table 1 Selected primers for PCR Primer
Sequence 5–3a
Target
Reference
CTX-U1 CTX-U2 ISEcp1IR-F 5orf903-R orf477-R rfbO25b rfb.1bis ChuA.1 ChuA.2 TspE4C2.1 TspE4C2.2 YjaA.1 YjaA.2 O25pabBspe.F O25pabBspe.R mdh36_forward mdh36_reverse gyrB47_forward gyrB47_reverse CA1 OR1 blaTEM-F blaTEM-R OXA1A OXA1B aacA4-F aacA4-R2 aac(3)-II.F aac(3)-II.R QnrBm-F QnrBm-R GyrAF21 GyrAR1000
ATGTGCAGYACCAGTAARGTKATGGC TGGGTRAARTARGTSACCAGAAYCAGCGG CAATGTGTGAGAAGCAGTCTAAA CGGTTGATGAGGGCTTTATT GGTGGCATAATTTTTGAAGT TGCTATTCATTATGCGCAGC ATACCGACGACGCCGATCTG GACGAACCAACGGTCAGGAT TGCCGCCAGTACCAAAGACA GAGTAATGTCGGGGCATTCA CGCGCCAACAAAGTATTACG TGAAGTGTCAGGAGACGCTG ATGGAGAATGCGTTCCTCAAC TCCAGCAGGTGCTGGATCGT GCGAAATTTTTCGCCGTACTGT GTTTAACGTTAACGCCGGT GGTAACACCAGAGTGACCA CGCGATAAGCGCGAC ACCGTCTTTTTCGGTGGAA ATGTCGCASAYHGAAAATGC CCTTGCAGTTWWHTGTGRRTAA GAGTATTCAACATTTTCGT ACCAATGCTTAATCAGTGA AGCCGTTAAAATTAAGCCC CTTGATTGAAGGGTTGGGCG TGACCTTGCGATGCTCTATG TTAGGCAWCACTGCGTGTTC CGTATGAGATGCCGATGC AAGATAGGTGACGCCGAAC GGMATHGAAATTCGCCACTG TTTGCYGYYCGCCAGTCGAA GAACTCACCTTCCAGATCC GAGCGCGGATATACACCTT
blaCTX-M
(Mulvey et al., 2003)
ISEcp1, 3′ end IS903 orf477 O25b
(Zong et al., 2008) (Zong et al., 2008) (Zong et al., 2008) (Clermont et al., 2008)
chuA
(Clermont et al., 2000)
TspE4C2
(Clermont et al., 2000)
yjaA
(Clermont et al., 2000)
pabB specific for ST131
(Clermont et al., 2009)
mdh with SNP for ST131
(Johnson et al., 2009)
gyrB with SNP for ST131
(Johnson et al., 2009)
RepFIIA
(Osborn et al., 2000)
blaTEM
(Maynard et al., 2004)
blaOXA
(Aubert et al., 2001)
aac(6′)-Ib
This study
aac(3)-II qnrB
Thomas L. unpublished (Cattoir et al., 2007)
gyrA
(Lindgren et al., 2003)
a
H: A, C or T; K: G or T; M: A or C; R: A or G; S: C or G; W: A or T; Y: C or T.
Six local isolates were typed as O25b and belonged to phylogenetic group B2 (Table 2). All 6 isolates were identified as ST131 and accounted for 7% of local E. coli carrying blaCTX-M genes. These ST131 isolates were recovered from various sample types, that is, ascites, blood, pleural fluid, sputum, and urine; and all but one were associated with nosocomial infections (Table 2). Five of the 6 ST131 isolates carried blaCTX-M-14 and 1 carried blaCTX-M-65 (Table 2), which encodes a variant of CTX-M-14 with 2 amino acid substitutions. One isolate, WCE233, has blaCTX-M-3a (identical to GenBank accession no. Y10278) in addition to blaCTX-M-14. Although ST131 isolates carrying blaCTX-M-15 have been found in many countries (Coque et al., 2008; NicolasChanoine et al., 2008), such isolates were not identified in our local collection. In addition, none of isolates carrying blaCTX-M-15 collected from Guangzhou, southern China, were O25b ST131 (Zhuo C, unpublished data). These findings suggest that O25b ST131 isolates carrying blaCTX-M-15 might have not emerged in China. Transconjugants carrying blaCTX-M-14 or blaCTX-M-65 were obtained from 5 of 6 isolates, and for WCE233,
which had 2 blaCTX-M genes, only transconjugants carrying blaCTX-M-3a were obtained. Replicon typing revealed that 4 conjugative plasmids (all carrying blaCTX-M-14) had IncFII-like replicons. The plasmid carrying blaCTX-M-65 from WCE307 was IncN, while the incompatibility group for the plasmid carrying blaCTX-M-3a could not be assigned. Sequencing of the RepFIIA amplicon revealed that in 3 plasmids this region was identical to R100 (Table 2). This R100-type RepFIIA is also present on a few plasmids carrying blaCTX-M-15 from ST131 isolates recovered in different countries (Coque et al., 2008) including pC151a from Canada, pEK499 and pEK516 from UK, and pJIE100 and pJIE186 from Australia (Zong et al., unpublished data). The remaining local IncFII-related plasmid carried a new variant of RepFIIA, closest (94% identity) to that of pSFO157 and 90% identical to those of R100 and pC15-1a. HpaI fingerprinting of plasmid DNA gave identical patterns for the plasmids carrying blaCTX-M-14 from WCE266 and WCE296 and the plasmid from WCE208 gave a related pattern. The remaining 3 plasmids gave distinct HpaI patterns.
230
Z. Zong, R. Yu / Diagnostic Microbiology and Infectious Disease 69 (2011) 228–231
Table 2 Characteristics of ST131 isolates in this studya Isolate
Sample Sourceb Patient Predisposing (sex, age) conditions (interval)c
WCE035 Sputum H
M, 54
WCE208 Urine WCE233 Blood
C H
F, 56 F, 59
WCE266 Acites
H
M, 18
WCE296 Pleural fluid
H
F, 62
WCE307 Blood
H
F, 54
blaCTX-M variants
Plasmid Inc RepFIIA HpaI GyrA blaOXA-1 PMQR Cassette arrayd group type substitution(s)
Liver transplantation blaCTX-M-14 FII-related Newe (7 d) FII-related R100 Diabetes (5 y) blaCTX-M-14 Choledochotomy (5 d) blaCTX-M-3a, -14 Unassignedf – Tuberculous blaCTX-M-14 peritonitis (1 m) Unclassified blaCTX-M-14 connective tissue disease (1 m) Choledochoscope (2 d) blaCTX-M-65
1
S83Y
−
−
2A 3
S83Y, D87N S83Y, D87N
− +
−
FII-related
R100
2B
S83Y, D87N
−
− + qnrB4, − -cr g − +
FII-related
R100
2B
S83Y, D87N
−
−
+
N
–
4
S83Y, D87N
−
−
+
a
All of these isolates carry blaTEM and aac(3)-II, but neither genes were co-transferred with blaCTX-M. b Source: C, community-acquired; H, hospital-acquired. c Interval: the time interval between predisposing conditions and collection of samples from which ST131 isolates were recovered. y, years; m, months; d, days. d dfrA17-aadA5 cassette array. This cassette array was co-transferred with blaCTX-M from WCE266 and WCE296 but not from WCE208 and WCE307. e WCE035 had an identical, novel RepFIIA, closest (94% identity) to that of pSFO157 (see text). f Only blaCTX-M-3a was transferred by conjugation on a plasmid whose Inc group could not be assigned. g -cr, aac(6′)-Ib-cr.
All ST131 isolates in this study were resistant to ciprofloxacin, and sequencing of gyrA revealed the Ser83Tyr substitution alone (in WCE035) or with the Asp87Asn substitution (in all other isolates). Both substitutions of GyrA have been seen before in fluoroquinolone-resistant ST131 isolates (Cagnacci et al., 2008; Cerquetti et al., 2010; Johnson et al., 2010). PMQR were only detected in WCE233, which had qnrB4 and aac(6′)-Ib-cr. Only WCE233 had blaOXA-1, but blaOXA-1 and aac(6′)-Ib-cr were not co-transferred with blaCTX-M-3a. All ST131 isolates in this study were also resistant to gentamicin and tobramycin and had aac(3)-II. In contrast to a study from Canada (Pitout et al., 2009), which reported that no ST131 isolates carrying blaCTX-M-14 had blaTEM, all ST131 isolates in this study had blaTEM. However, the co-transfer of blaTEM or aac(3)-II with blaCTX-M was not observed here. In summary, O25b ST131 E. coli isolates carrying blaCTX-M genes have emerged in China, but only blaCTX-M-3a, blaCTX-M-14, and blaCTX-M-65 were identified, unlike many countries where ST131 isolates largely carry blaCTX-M-15. ST131 isolates carrying blaCTX-M-14 have been found in Cambodia (Clermont et al., 2009), Canada (Pitout et al., 2009), France (Clermont et al., 2009), Japan (Suzuki et al., 2009), Spain (Clermont et al., 2009; Oteo et al., 2009), and USA (Sidjabat et al., 2009). This study adds to the evidence that ST131 isolates are involved in the international spread of blaCTX-M-14, although to a much lesser extent than blaCTX-M-15. The identification of an O25b ST131 isolate carrying blaCTX-M-65 adds new evidence for this lineage acquiring plasmids with various blaCTX-M genes. The blaCTX-M genes in ST131 isolates identified here were usually carried by IncFII-related conjugative plasmids that did not harbor blaTEM, blaOXA-1, aac(6′)-Ib-cr, and
aac(3)-II, unlike plasmids carrying blaCTX-M-15. Of note, ST131 isolates may carry other β-lactamase genes, for example, blaSHV- or blaTEM-type ESBL genes (Cerquetti et al., 2010; Clermont et al., 2009; Novais et al., 2010) or the blaCMY-2 AmpC gene (Oteo et al., 2010), and/or may lack any β-lactamase genes (Cagnacci et al., 2008; LeflonGuibout et al., 2008). Together with previous observations, the data presented here suggest that O25b ST131 isolates have acquired different plasmids, mostly IncFII-related, and served as an important vector mediating the spread of different blaCTX-M variants to different regions of the world. Acknowledgments This work was partially supported by a grant from the National Natural Science Foundation of China (project no. 30900052). The authors thank Xiaobo Ma for collecting the clinical isolates. The authors are grateful to James Johnson, Brian Johnston, and Olivier Clemont for providing ST131 isolates carrying blaCTX-M-15 as controls and to Jon Iredell and Sally Partridge for providing E. coli DH5αRf, and also thank Sally Partridge for critical reading of the manuscript. References Aubert D, Poirel L, Chevalier J, Leotard S, Pages JM, Nordmann P (2001) Oxacillinase-mediated resistance to cefepime and susceptibility to ceftazidime in Pseudomonas aeruginosa. Antimicrob Agents Chemother 45:1615–1620. Cagnacci S, Gualco L, Debbia E, Schito GC, Marchese A (2008) European emergence of ciprofloxacin-resistant Escherichia coli clonal groups O25:H4-ST 131 and O15:K52:H1 causing community-acquired uncomplicated cystitis. J Clin Microbiol 46:2605–2612.
Z. Zong, R. Yu / Diagnostic Microbiology and Infectious Disease 69 (2011) 228–231 Carattoli A, Bertini A, Villa L, Falbo V, Hopkins KL, Threlfall EJ (2005) Identification of plasmids by PCR-based replicon typing. J Microbiol Methods 63:219–228. Cattoir V, Poirel L, Rotimi V, Soussy CJ, Nordmann P (2007) Multiplex PCR for detection of plasmid-mediated quinolone resistance qnr genes in ESBL-producing enterobacterial isolates. J Antimicrob Chemother 60:394–397. Cerquetti M, Giufre M, Garcia-Fernandez A, Accogli M, Fortini D, Luzzi I, Carattoli A (2010) Ciprofloxacin-resistant, CTX-M-15–producing Escherichia coli ST131 clone in extraintestinal infections in Italy. Clin Microbiol Infect :2010, doi:10.1111/j.1469-0691.2010.03162.x. (published advance Jan). Clermont O, Bonacorsi S, Bingen E (2000) Rapid and simple determination of the Escherichia coli phylogenetic group. Appl Environ Microbiol 66:4555–4558. Clermont O, Lavollay M, Vimont S, Deschamps C, Forestier C, Branger C, Denamur E, Arlet G (2008) The CTX-M-15–producing Escherichia coli diffusing clone belongs to a highly virulent B2 phylogenetic subgroup. J Antimicrob Chemother 61:1024–1028. Clermont O, Dhanji H, Upton M, authors other (2009) Rapid detection of the O25b-ST131 clone of Escherichia coli encompassing the CTX-M-15– producing strains. J Antimicrob Chemother 64:274–277. Coque TM, Novais A, Carattoli A, Poirel L, Pitout J, Peixe L, Baquero F, Canton R, Nordmann P (2008) Dissemination of clonally related Escherichia coli strains expressing extended-spectrum β-lactamase CTX-M-15. Emerg Infect Dis 14:195–200. Johnson JR, Menard M, Johnston B, Kuskowski MA, Nichol K, Zhanel GG (2009) Epidemic clonal groups of Escherichia coli as a cause of antimicrobial-resistant urinary tract infections in Canada, 2002 to 2004. Antimicrob Agents Chemother 53:2733–2739. Johnson JR, Johnston B, Clabots C, Kuskowski MA, Castanheira M (2010) Escherichia coli sequence type ST131 as the major cause of serious multidrug-resistant E. coli infections in the United States. Clin Infect Dis 51:286–294. Leflon-Guibout V, Blanco J, Amaqdouf K, Mora A, Guize L, NicolasChanoine MH (2008) Absence of CTX-M enzymes but high prevalence of clones, including clone ST131, among fecal Escherichia coli isolates from healthy subjects living in the area of Paris, France. J Clin Microbiol 46:3900–3905. Lindgren PK, Karlsson A, Hughes D (2003) Mutation rate and evolution of fluoroquinolone resistance in Escherichia coli isolates from patients with urinary tract infections. Antimicrob Agents Chemother 47: 3222–3232. Maynard C, Bekal S, Sanschagrin F, Levesque RC, Brousseau R, Masson L, Lariviere S, Harel J (2004) Heterogeneity among virulence and antimicrobial resistance gene profiles of extraintestinal Escherichia
231
coli isolates of animal and human origin. J Clin Microbiol 42:5444–5452. Mulvey MR, Soule G, Boyd D, Demczuk W, Ahmed R (2003) Characterization of the first extended-spectrum β-lactamase–producing Salmonella isolate identified in Canada. J Clin Microbiol 41:460–462. Nicolas-Chanoine MH, Blanco J, Leflon-Guibout V, authors other (2008) Intercontinental emergence of Escherichia coli clone O25:H4-ST131 producing CTX-M-15. J Antimicrob Chemother 61:273–281. Novais A, Baquero F, Machado E, Canton R, Peixe L, Coque TM (2010) International spread and persistence of TEM-24 is caused by the confluence of highly penetrating enterobacteriaceae clones and an IncA/ C2 plasmid containing Tn1696::Tn1 and IS5075-Tn21. Antimicrob Agents Chemother 54:825–834. Osborn AM, da Silva Tatley FM, Steyn LM, Pickup RW, Saunders JR (2000) Mosaic plasmids and mosaic replicons: evolutionary lessons from the analysis of genetic diversity in IncFII-related replicons. Microbiology 146:2267–2275. Oteo J, Diestra K, Juan C, authors other (2009) Extended-spectrum β-lactamase–producing Escherichia coli in Spain belong to a large variety of multilocus sequence typing types, including ST10 complex/A, ST23 complex/A and ST131/B2. Int J Antimicrob Agents 34:173–176. Oteo J, Cercenado E, Cuevas O, Bautista V, Delgado-Iribarren A, Orden B, Perez-Vazquez M, Garcia-Cobos S, Campos J (2010) AmpC β-lactamases in Escherichia coli: emergence of CMY-2-producing virulent phylogroup D isolates belonging mainly to STs 57, 115, 354, 393, and 420, and phylogroup B2 isolates belonging to the international clone O25b-ST131. Diagn Microbiol Infect Dis 67:270–276. Pitout JD, Gregson DB, Campbell L, Laupland KB (2009) Molecular characteristics of extended-spectrum β-lactamase–producing Escherichia coli causing bacteraemia in the Calgary Health Region 2000–07: the emergence of clone ST131 as a cause of community-acquired infections. Antimicrob Agents Chemother 53:2846–2851. Sidjabat HE, Paterson DL, Adams-Haduch JM, Ewan L, Pasculle AW, Muto CA, Tian GB, Doi Y (2009) Molecular epidemiology of CTX-M– producing Escherichia coli isolates at a tertiary medical center in western Pennsylvania. Antimicrob Agents Chemother 53:4733–4739. Suzuki S, Shibata N, Yamane K, Wachino JI, Ito K, Arakawa Y (2009) Rapid change in the prevalence of extended-spectrum β-lactamase– producing Escherichia coli in Japan by clonal spread. J Antimicrob Chemother 63:72–79. Yamane K, Wachino J, Suzuki S, Arakawa Y (2008) Plasmid-mediated qepA gene among Escherichia coli clinical isolates from Japan. Antimicrob Agents Chemother 52:1564–1566. Zong Z, Partridge SR, Thomas L, Iredell JR (2008) Dominance of blaCTX-M within an Australian extended-spectrum β-lactamase gene pool. Antimicrob Agents Chemother 52:4198–4202.