- Email: [email protected]
Blockade of U50,488H analgesia by antisense oligodeoxynucleotides to a κ-opioid receptor
ELSEVIER
ejp European Journal of Pharmacology 253 (1994) R7-R8
Rapid communication
Blockade of U50,488H analgesia by antisense oligodeoxynucleotides to a K-opioid receptor Chih-Cheng Chien a, George Brown a, Ying-Xian Pan a,b, Gavril W. Pasternak *'a'b a The Cotzias Laboratory of Neuro-Oncology, Memorial Sloan-Kettering Cancer Center, New York, N Y 10021, USA b Departments of Neurology and Neuroscience and Pharmacology, Cornell U. Medical College, New York, NY 10021, USA (Received 27 January 1994; accepted 28 January 1994)
Abstract
The recently cloned K-opioid receptor has binding characteristics consistent with those of a Kl-opioid receptor. Repeated intrathecal administration of an antisense oligodeoxynucleotide against the Kl-opioid receptor selectively lowers U50,488H (trans-3,4-dichloro-N-methyI-N-[2-(1-pyrrolidinyl)cyclohexyl]benzeneacetemide) analgesia (P < 0.02) without affecting /x or t5 analgesia. A mismatched antisense oligodeoxynucleotide in which 4 bases had been switched is inactive against U50,488H analgesia. These studies confirm at the molecular level traditional pharmacological studies implying a distinct receptor mechanisms for Ks analgesia and demonstrate the utility of antisense approaches in studies of opioid pharmacology.
Key words: Antisense oligodeoxynucleotide; K-Opioid receptor; Opioid analgesia
Cloning the 6-opioid receptor (DOR-1) (Evans et al., 1992; Kieffer et al., 1992) provided the insights leading to the identification of a Kl-opioid receptor clone (KOR; Yasuda et al., 1993; Meng et al., in press). When expressed, the cloned receptor displays the binding selectivity anticipated from guinea pig brain assays and binds selective K~ agonists and antagonists with high affinity. Correlating this cloned receptor with the pharmacology of Kl-opioid receptor actions in vivo is important. Antisense approaches have proven valuable in examining a number of neurotransmitter receptors (Wahlestedt et al., 1993; Holopainin and Wojcik, 1993), including the 6-opioid receptor (DOR; Standifer et al., 1993). Using an antisense approach, we now confirm the pharmacological relevance of the cloned Kt receptor. [D-Pen2,D-PenS]Enkephalin (DPDPE), U50,488H
( trans- 3,4-dichloro-N-methyl-N-[ 2-(1-pyrroli dinyl )cycloh e x y l ] b e n z e n e a c e t e m i d e ) and [o-AlaZ,MePhe 4, Gly(ol)5]enkephalin (DAMGO) were generously provided by the Research Technology branch of NIDA.
* Corresponding author. Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, New York, NY 10021, USA. Tel. (212) 639-7046, fax (212) 794-4332. 0014-2999/94/$07.00 © 1994 Elsevier Science B.V. All rights reserved SSDI 0 0 1 4 - 2 9 9 9 ( 9 4 ) 0 0 0 6 6 - G
Oligodeoxynucleotides were synthesized by The Midland Certified Reagent Co. (Midland, TX). Analgesia was determined in male CD-1 mice (25-35 g; Charles River Breeding Laboratories, Wilmington, MA) 15 min after administration of the opioid and evaluated quantally in the radiant tailflick assay as a doubling or greater of baseline latencies (2-3 s) determined individually for each mouse (Standifer et al., 1993, in press). Baseline latencies are not affected by oligodeoxynucleotide administration. The maximal latency is 10 s to minimize tissue damage. Intrathecal (i.t.) injections were performed under halothane anesthesia, which rapidly wears off and does not interfere with the tailflick assay. To examine the role of KOR in ~q analgesia, we used a paradigm effective against the 6-opioid receptor in mice (Standifer et al., 1993, in press) and the receptor in rats (G. Rossi and G.W. Pasternak, unpublished observations). We designed an antisense oligodeoxynucleotide against the K O R and injected it intrathecally (5 /xg) on days 1, 3 and 5. On day 6 we compared the analgesia from U50,488H (25/zg, i.t.) in the antisense treated group to vehicle treated controls (Fig. 1). The antisense treatment markedly reduced U50,488H analgesia (P < 0.02). The selectivity of the response was established by the inactivity of a mis-
R8
C.-C. Chien et al. / European Journal of Pharmacology 253 (1994) R7-R8 8O
Control
•
Antisense m~ Mismatch
w o u l d d o w n r e g u l a t e all the m R N A s . T h e timing o f an t i sen se t r e a t m e n t s also is i m p o r t a n t . T o o b s e r ve a d o w n r e g u l a t i o n of opioid r e c e p t o r function, the synthesis o f n e w r e c e p t o r s must be b l o c k e d and sufficient time given to p e r m i t the recycling an d e l i m i n a t i o n o f p r eex i st i n g r e c e p t o r s in the m e m b r a n e .
"~ 60 4o
"~ 20 < 0
i US0,488H
1. A c k n o w l e d g m e n t s DAMGO
DPDPE *P < 0.02
Fig. l. Effects of antisense oligodeoxynucleotides to KOR on K1, and /x analgesia. An antisense oligodeoxynucleotide corresponding to bases 761-782 of KOR (5 /zg in 2 /zl; 5'-GGTGCCTCCAAGGACTATCGC-3') was injected intrathecally into groups of mice on days l, 3 and 5. Mice then received intrathecal injections of U50,488H (25/xg; n = 30), DAMGO (8 ng; n = 10) or DPDPE (500 ng; n = 10) on day 6 and were tested for analgesia in the tailflick assay 15 min later. Analgesia is defined quantally as a doubling or greater of baseline latencies for each animal. Control groups received vehicle and were tested with U50,488H (n= 30), DAMGO (n = 10) or DPDPE (n= 10). Another group (n = 10) received a mismatch oligodeoxynucleotide in which four bases had been switched (GGAGCCTGCAAGGTCTATGGC) instead of the antisense oligodeoxynucleotide. Significance was determined using the Fisher exact test.
m a t c h e d a n t i s e n s e o l i g o d e o x y n u c l e o t i d e in which four bases h a d b e e n switched (Fig. 1). This action of t h e a n t i s e n s e o l i g o d e o x y n u c l e o t i d e is r e s t r i c t e d to U50,488H. N o effect was seen with t h e K O R a n t i s e n s e o l i g o d e o x y n u c l e o t i d e against a n a l g e s i a elicited by e i t h e r t h e ~ ligand D P D P E or t h e / z ligand D A M G O . T h e s e results a r e consistent with p r i o r studies f r o m o u r l a b o r a t o r y in w h i c h an a n t i s e n s e o l i g o d e o x y n u c l e o t i d e d i r e c t e d against the D O R - 1 b l o c k e d D P D P E an a lg e s i a but not that o f U 5 0 , 4 8 8 H or m o r p h i n e ( S t a n d i f e r et al., 1993, in press). T o g e t h e r t h e s e results c o n f i r m t h e e x i s te n c e of distinct r e c e p t o r m e c h a n i s m s of o p i o i d a n a lg e s i a at t h e spinal level and illustrate th e p o w e r of a n ti s e n s e app r o a c h e s in the investigation o f o p i o i d r e c e p t o r p h ar macology. S e v e r a l issues must b e c o n s i d e r e d w h e n using this a p p r o a c h . T h e specificity o f t h e a p p r o a c h is b a s e d u p o n the n u c l e o t i d e s e q u e n c e o f the t a r g e t m R N A and an t i s en s e p r o b e s must be d i r e c t e d t o w ar d s u n i q u e s e q u e n c e s . This is p a r t i c u l a r l y i m p o r t a n t w h e n considering multiple products derived from alternative splicing. A n t i s e n s e d i r e c t e d at a c o m m o n s e q u e n c e
We thank Dr. J. Posner for his support and Drs. C. Wahlestedt and H. Furneaux for helpful discussions, This work was supported, in part, by grants from the NIDA to G.W.P. (DA02615 and DA07242) and a core grant from the NCI to MSKCC (CA08748). G.W.P. is supported by a Research Scientist Development Award from NIDA (DA000138). C,C.C. is supported by a fellowship from the Cathay General Hospital (Taipei, Taiwan) and Y.X.P. by an Aaron Diamond Fellowship.
2. References Evans, C.J., D.E. Keith, Jr., H. Morrison, K. Magendzo and R.H. Edwards, 1992, Cloning of a 6 opioid receptor by functional expression, Science 258, 1952. Holopainen, I. and W.J. Wojcik, 1993, A specific antisense oligodeoxynucleotide to mRNAs encoding receptors with seven transmembrane spanning regions decreases musearinic m 2 and GABA B receptors in rat cerebellar granule cells, J. Pharmacol. Exp. Ther. 264, 423. Kieffer, B.L., K. Befort, C. Gaveriaux-Ruff and C.G. Hirth, 1992, The 6-opioid receptor: isolation of a cDNA by expression cloning and pharmacological characterization, Proc. Natl. Acad. Sci. USA 89, 12048. Meng, F., G.-X. Xie, R.C. Thompson, A. Mansour, A. Goldstein, S.J. Watson and H. Akil, 1993, Cloning and pharmacological characterization of a rat • opioid receptor, Proc. Natl. Acad. Sci. USA 90, 9954. Standifer, K.M., C.-C. Chien, C. Wahlestedt and G.W. Pasternak, 1993, Reduction of opioid binding in NG108-15 neurohybrid cells by a specific antisense oligonucleotide, Soc. Neurosci. 19, 74. Standifer, K.M., C.-C. Chien, C. Wahlestedt, G. Brown and G.W. Pasternak, 1994, Selective loss of delta opioid analgesia and binding by antisense oligodeoxynucleotides to a delta opioid receptor, Neuron (in press). Wahlestedt, C., E. Golanov, S. Yamamoto, F. Yee, H. Ericson, H. Yoo, C.E. Inturrisi and D.J. Reis, 1993, Antisense oligodeoxynucleotides to NMDA-R1 receptor channel protect cortical neurons from excitotoxicity and reduce focal ischaemic infarctions, Nature 363, 260. Yasuda, K., K. Raynor, H. Kong, C.D. Breder, J. Takeda, T. Reisine and G.I. Bell, 1993, Cloning and functional comparison of K and 6 opioid receptors from mouse brain, Proc. Natl. Acad. Sci. USA 90, 6736.
ejp European Journal of Pharmacology 253 (1994) R7-R8
Rapid communication
Blockade of U50,488H analgesia by antisense oligodeoxynucleotides to a K-opioid receptor Chih-Cheng Chien a, George Brown a, Ying-Xian Pan a,b, Gavril W. Pasternak *'a'b a The Cotzias Laboratory of Neuro-Oncology, Memorial Sloan-Kettering Cancer Center, New York, N Y 10021, USA b Departments of Neurology and Neuroscience and Pharmacology, Cornell U. Medical College, New York, NY 10021, USA (Received 27 January 1994; accepted 28 January 1994)
Abstract
The recently cloned K-opioid receptor has binding characteristics consistent with those of a Kl-opioid receptor. Repeated intrathecal administration of an antisense oligodeoxynucleotide against the Kl-opioid receptor selectively lowers U50,488H (trans-3,4-dichloro-N-methyI-N-[2-(1-pyrrolidinyl)cyclohexyl]benzeneacetemide) analgesia (P < 0.02) without affecting /x or t5 analgesia. A mismatched antisense oligodeoxynucleotide in which 4 bases had been switched is inactive against U50,488H analgesia. These studies confirm at the molecular level traditional pharmacological studies implying a distinct receptor mechanisms for Ks analgesia and demonstrate the utility of antisense approaches in studies of opioid pharmacology.
Key words: Antisense oligodeoxynucleotide; K-Opioid receptor; Opioid analgesia
Cloning the 6-opioid receptor (DOR-1) (Evans et al., 1992; Kieffer et al., 1992) provided the insights leading to the identification of a Kl-opioid receptor clone (KOR; Yasuda et al., 1993; Meng et al., in press). When expressed, the cloned receptor displays the binding selectivity anticipated from guinea pig brain assays and binds selective K~ agonists and antagonists with high affinity. Correlating this cloned receptor with the pharmacology of Kl-opioid receptor actions in vivo is important. Antisense approaches have proven valuable in examining a number of neurotransmitter receptors (Wahlestedt et al., 1993; Holopainin and Wojcik, 1993), including the 6-opioid receptor (DOR; Standifer et al., 1993). Using an antisense approach, we now confirm the pharmacological relevance of the cloned Kt receptor. [D-Pen2,D-PenS]Enkephalin (DPDPE), U50,488H
( trans- 3,4-dichloro-N-methyl-N-[ 2-(1-pyrroli dinyl )cycloh e x y l ] b e n z e n e a c e t e m i d e ) and [o-AlaZ,MePhe 4, Gly(ol)5]enkephalin (DAMGO) were generously provided by the Research Technology branch of NIDA.
* Corresponding author. Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, New York, NY 10021, USA. Tel. (212) 639-7046, fax (212) 794-4332. 0014-2999/94/$07.00 © 1994 Elsevier Science B.V. All rights reserved SSDI 0 0 1 4 - 2 9 9 9 ( 9 4 ) 0 0 0 6 6 - G
Oligodeoxynucleotides were synthesized by The Midland Certified Reagent Co. (Midland, TX). Analgesia was determined in male CD-1 mice (25-35 g; Charles River Breeding Laboratories, Wilmington, MA) 15 min after administration of the opioid and evaluated quantally in the radiant tailflick assay as a doubling or greater of baseline latencies (2-3 s) determined individually for each mouse (Standifer et al., 1993, in press). Baseline latencies are not affected by oligodeoxynucleotide administration. The maximal latency is 10 s to minimize tissue damage. Intrathecal (i.t.) injections were performed under halothane anesthesia, which rapidly wears off and does not interfere with the tailflick assay. To examine the role of KOR in ~q analgesia, we used a paradigm effective against the 6-opioid receptor in mice (Standifer et al., 1993, in press) and the receptor in rats (G. Rossi and G.W. Pasternak, unpublished observations). We designed an antisense oligodeoxynucleotide against the K O R and injected it intrathecally (5 /xg) on days 1, 3 and 5. On day 6 we compared the analgesia from U50,488H (25/zg, i.t.) in the antisense treated group to vehicle treated controls (Fig. 1). The antisense treatment markedly reduced U50,488H analgesia (P < 0.02). The selectivity of the response was established by the inactivity of a mis-
R8
C.-C. Chien et al. / European Journal of Pharmacology 253 (1994) R7-R8 8O
Control
•
Antisense m~ Mismatch
w o u l d d o w n r e g u l a t e all the m R N A s . T h e timing o f an t i sen se t r e a t m e n t s also is i m p o r t a n t . T o o b s e r ve a d o w n r e g u l a t i o n of opioid r e c e p t o r function, the synthesis o f n e w r e c e p t o r s must be b l o c k e d and sufficient time given to p e r m i t the recycling an d e l i m i n a t i o n o f p r eex i st i n g r e c e p t o r s in the m e m b r a n e .
"~ 60 4o
"~ 20 < 0
i US0,488H
1. A c k n o w l e d g m e n t s DAMGO
DPDPE *P < 0.02
Fig. l. Effects of antisense oligodeoxynucleotides to KOR on K1, and /x analgesia. An antisense oligodeoxynucleotide corresponding to bases 761-782 of KOR (5 /zg in 2 /zl; 5'-GGTGCCTCCAAGGACTATCGC-3') was injected intrathecally into groups of mice on days l, 3 and 5. Mice then received intrathecal injections of U50,488H (25/xg; n = 30), DAMGO (8 ng; n = 10) or DPDPE (500 ng; n = 10) on day 6 and were tested for analgesia in the tailflick assay 15 min later. Analgesia is defined quantally as a doubling or greater of baseline latencies for each animal. Control groups received vehicle and were tested with U50,488H (n= 30), DAMGO (n = 10) or DPDPE (n= 10). Another group (n = 10) received a mismatch oligodeoxynucleotide in which four bases had been switched (GGAGCCTGCAAGGTCTATGGC) instead of the antisense oligodeoxynucleotide. Significance was determined using the Fisher exact test.
m a t c h e d a n t i s e n s e o l i g o d e o x y n u c l e o t i d e in which four bases h a d b e e n switched (Fig. 1). This action of t h e a n t i s e n s e o l i g o d e o x y n u c l e o t i d e is r e s t r i c t e d to U50,488H. N o effect was seen with t h e K O R a n t i s e n s e o l i g o d e o x y n u c l e o t i d e against a n a l g e s i a elicited by e i t h e r t h e ~ ligand D P D P E or t h e / z ligand D A M G O . T h e s e results a r e consistent with p r i o r studies f r o m o u r l a b o r a t o r y in w h i c h an a n t i s e n s e o l i g o d e o x y n u c l e o t i d e d i r e c t e d against the D O R - 1 b l o c k e d D P D P E an a lg e s i a but not that o f U 5 0 , 4 8 8 H or m o r p h i n e ( S t a n d i f e r et al., 1993, in press). T o g e t h e r t h e s e results c o n f i r m t h e e x i s te n c e of distinct r e c e p t o r m e c h a n i s m s of o p i o i d a n a lg e s i a at t h e spinal level and illustrate th e p o w e r of a n ti s e n s e app r o a c h e s in the investigation o f o p i o i d r e c e p t o r p h ar macology. S e v e r a l issues must b e c o n s i d e r e d w h e n using this a p p r o a c h . T h e specificity o f t h e a p p r o a c h is b a s e d u p o n the n u c l e o t i d e s e q u e n c e o f the t a r g e t m R N A and an t i s en s e p r o b e s must be d i r e c t e d t o w ar d s u n i q u e s e q u e n c e s . This is p a r t i c u l a r l y i m p o r t a n t w h e n considering multiple products derived from alternative splicing. A n t i s e n s e d i r e c t e d at a c o m m o n s e q u e n c e
We thank Dr. J. Posner for his support and Drs. C. Wahlestedt and H. Furneaux for helpful discussions, This work was supported, in part, by grants from the NIDA to G.W.P. (DA02615 and DA07242) and a core grant from the NCI to MSKCC (CA08748). G.W.P. is supported by a Research Scientist Development Award from NIDA (DA000138). C,C.C. is supported by a fellowship from the Cathay General Hospital (Taipei, Taiwan) and Y.X.P. by an Aaron Diamond Fellowship.
2. References Evans, C.J., D.E. Keith, Jr., H. Morrison, K. Magendzo and R.H. Edwards, 1992, Cloning of a 6 opioid receptor by functional expression, Science 258, 1952. Holopainen, I. and W.J. Wojcik, 1993, A specific antisense oligodeoxynucleotide to mRNAs encoding receptors with seven transmembrane spanning regions decreases musearinic m 2 and GABA B receptors in rat cerebellar granule cells, J. Pharmacol. Exp. Ther. 264, 423. Kieffer, B.L., K. Befort, C. Gaveriaux-Ruff and C.G. Hirth, 1992, The 6-opioid receptor: isolation of a cDNA by expression cloning and pharmacological characterization, Proc. Natl. Acad. Sci. USA 89, 12048. Meng, F., G.-X. Xie, R.C. Thompson, A. Mansour, A. Goldstein, S.J. Watson and H. Akil, 1993, Cloning and pharmacological characterization of a rat • opioid receptor, Proc. Natl. Acad. Sci. USA 90, 9954. Standifer, K.M., C.-C. Chien, C. Wahlestedt and G.W. Pasternak, 1993, Reduction of opioid binding in NG108-15 neurohybrid cells by a specific antisense oligonucleotide, Soc. Neurosci. 19, 74. Standifer, K.M., C.-C. Chien, C. Wahlestedt, G. Brown and G.W. Pasternak, 1994, Selective loss of delta opioid analgesia and binding by antisense oligodeoxynucleotides to a delta opioid receptor, Neuron (in press). Wahlestedt, C., E. Golanov, S. Yamamoto, F. Yee, H. Ericson, H. Yoo, C.E. Inturrisi and D.J. Reis, 1993, Antisense oligodeoxynucleotides to NMDA-R1 receptor channel protect cortical neurons from excitotoxicity and reduce focal ischaemic infarctions, Nature 363, 260. Yasuda, K., K. Raynor, H. Kong, C.D. Breder, J. Takeda, T. Reisine and G.I. Bell, 1993, Cloning and functional comparison of K and 6 opioid receptors from mouse brain, Proc. Natl. Acad. Sci. USA 90, 6736.