Blood miR-1275 is associated with risk of ischemic stroke and inhibits macrophage foam cell formation by targeting ApoC2 gene

Journal Pre-proofs Research paper Blood miR-1275 is associated with risk of ischemic stroke and inhibits macrophage foam cell formation by targeting ApoC2 gene Lu Li, Wang Xu, Xuejun Fu, Ying Huang, Ying Wen, Qianhui Xu, Xinpeng He, Kan Wang, Suli Huang, Ziquan Lv PII: DOI: Reference:

S0378-1119(20)30033-0 https://doi.org/10.1016/j.gene.2020.144364 GENE 144364

To appear in:

Gene Gene

Received Date: Revised Date: Accepted Date:

18 September 2019 9 January 2020 10 January 2020

Please cite this article as: L. Li, W. Xu, X. Fu, Y. Huang, Y. Wen, Q. Xu, X. He, K. Wang, S. Huang, Z. Lv, Blood miR-1275 is associated with risk of ischemic stroke and inhibits macrophage foam cell formation by targeting ApoC2 gene, Gene Gene (2020), doi: https://doi.org/10.1016/j.gene.2020.144364

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2020 Published by Elsevier B.V.

Blood miR-1275 is Associated with Risk of Ischemic Stroke and Inhibits Macrophage Foam Cell Formation by Targeting ApoC2 gene Lu Li1, #, Wang Xu1, #, Xuejun Fu2, Ying Huang2, Ying Wen3, Qianhui Xu2, Xinpeng He3, Kan Wang1, Suli Huang3, *, Ziquan Lv3, *, 1. Research Center of Translational Medicine, The Second Affiliated Hospital of Shantou University Medical College, Shantou, Guangdong, China 2. Department of Neurology, People's Hospital of Shenzhen, Guangdong, China 3. Shenzhen Center for Disease Control and Prevention, Shenzhen, Guangdong, China

#

These authors contributed equally to the article.

*Corresponding: Suli Huang, Department of Environment and Health, Shenzhen Center for Disease Control and Prevention, Shenzhen, Guangdong, China. E-mail: [email protected] Ziquan Lv, Department of Molecular Epidemiology, Shenzhen Center for Disease Control and Prevention, Shenzhen, Guangdong, China. E-mail: [email protected]

1

Abstract Apolipoprotein C2 (ApoC2) is an important member of the apolipoprotein C family and functions as a major activator of lipoprotein lipase (LPL). In cardiovascular and cerebrovascular systems, the lipolytic activity of the LPL-ApoC2 complex is critical for the metabolism of triglyceride-rich lipoproteins and contributes to the pathogenesis of ischemic stroke (IS). However, the regulation of ApoC2 in IS development remains unclear. In this study, we first explored potential ApoC2-targeting microRNAs (miRNAs) by bioinformatics tool and compared the miRNA expression profiles in the blood cells of 25 IS patients and 25 control subjects by miRNA microarray. miR-1275 was predicted to bind with the 3′ untranslated region of ApoC2, and a significant reduction of blood miR-1275 levels was observed in IS patients. Dual-luciferase reporter assay and quantitative RT-PCR confirmed the regulation of ApoC2 by miR-1275 in THP-1 derived macrophages. miR-1275 also inhibited cellular uptake of ox-LDL and suppressed formation of macrophage foam cell. Furthermore, the whole blood miR-1275 levels were validated in 279 IS patients and 279 control subjects by TaqMan assay. miR-1275 levels were significantly lower in IS cases and logistic regression analysis showed that miR-1275 level was negatively associated with the occurrence of IS (adjusted OR, 0.76; 95% CI, 0.69~0.85; p<0.001). Addition of miR-1275 to traditional risk factors showed an additive prediction value for IS. Our study shows that blood miR-1275 levels were negatively associated with the occurrence of IS, and miR-1275 might exert an athero-protective role against the development of IS by targeting ApoC2 and blocking the formation of macrophage foam cells. Keywords: lipoprotein lipase; ox-LDL; athero-protective

2

1 Introduction Stroke is one of the leading causes of mortality and long-term disability accompanied by high social and medical costs [Tegos et al., 2000]. Ischemic stroke (IS) is the most common type of stroke in China, which affects 43%~79% of the total stroke cases [Liu et al., 2011]. Besides the traditional risk factors of stroke, epigenetic features, especially microRNAs (miRNAs), play vital roles in the development of IS. miRNAs are 22 nucleotide long endogenous non-coding RNAs that function by post-transcriptional or translational regulation of target genes by interacting with the 3′ untranslated region (3′ UTR) of mRNAs [Felekkis et al., 2010; Ambros., 2004]. In the last decade, amounting reports of miRNA in population-based and animal model studies associated with IS have revealed miRNAs as key mediators in the pathological processes of IS [Eyileten et al., 2018; Li et al., 2018]. Recently, several miRNAs in peripheral blood cells (including immune cells, erythrocytes and platelets) have been identified as potential biomarkers for prediction of IS risk or outcome. Liang and his colleagues found that miR-34a-5p negatively associated with NIHSS scores and infarct volume and indicated miR-34a-5p might serve as a biomarker for acute IS prognosis [Liang et al., 2016]. The blood levels of miR-29b and miR-210, which are involved in the modulation of the leukocyte inflammatory response [Eken et al., 2019; Zaccagnini et al., 2017], predict the risk or prognosis of IS [Wang et al., 2015; Zeng et al., 2011]. Therefore, identification of IS-related miRNAs and exploration of their pathogenic roles might enable the development of novel biomarkers for disease prevention, diagnosis or prognosis. Atherosclerosis is one of the major pathogenic mechanisms of IS, which entails chronic inflammation of the arterial vessel walls, impairs lipid metabolism, and ultimately leads to plaque rupture and atherothrombosis [Wildgruber et al., 2013; Sadat et al., 2014]. Lipoproteins and macrophages are both critical in the development of atherosclerotic lesions. Circulating monocytes are recruited into the intima, differentiate into the macrophages and then absorb the modified lipoproteins. Progressive uptake of lipoproteins leads to foam cell formation, which is a hallmark of the onset and progression of atherosclerosis [Rader et al., 2005]. Lipoprotein lipase (LPL) is a soluble enzyme and member of the lipase family that hydrolyzes triglyceride into lipoprotein and promotes cellular uptake of lipoproteins and fatty acids [Glass et al., 2001]. LPL functions as a double-edged sword in the development of atherosclerosis. Deficiency or mutation of LPL gene 3

leads to hypertriglyceridemia that greatly contributes to increased risk of atherosclerosis and coronary heart disease [Qin et al., 2018; Pugni et al., 2014]. Over-expression of LPL increased plasma low-density lipoprotein (LDL) and promotes atherosclerosis in the transgenic rabbit model [Ichikawa et al., 2004]. However, previous studies have shown that macrophage LPL accelerates formation of foam cells and atherosclerosis, and inactivation or depletion of LPL impedes this process [Babaev et al., 1999; Babaev et al., 2000; Olivier et al., 2012]. Apolipoprotein C2 (ApoC2), a lipoprotein encoded by the APOC2 gene, is a critical co-factor for LPL activation [Wolska et al., 2017], and genetic variants in APOC2 have been demonstrated to associate with the occurrence of coronary heart disease in the UK population [Ken-Dror et al., 2010]. Thus, deregulation of the LPL-ApoC2 complex might be critical for the development of cerebrovascular atherosclerosis. Extensive studies have explored the modulation of LPL in atherosclerosis-related diseases; however, whether APOC2 is regulated during stroke needs to be determined. In view of the important role of miRNAs in gene regulation and the development of IS, we analyzed miRNA expression profiles in 25 IS patients and 25 control subjects by miRNA microarray, and searched for putative APOC2-targeting miRNAs using prediction software. We identified miR-1275 as a differentially expressed miRNA between IS cases and control subjects, and might target ApoC2 gene. We examined miR-1275 levels in blood in an IS case-control Chinese Han population and the association with the occurrence of IS. We also examined the role of miR-1275 in macrophage foam cell formation. Finally, the regulation of ApoC2 by miR-1275 was investigated to evaluate the mechanism by which miR-1275 may contribute to IS pathogenesis.

4

2 Materials and Methods 2.1 Study population The IS cases of the validation cohort were recruited from Shenzhen People’s Hospital as described in the previous study [Huang et al., 2016]. All IS inpatients were diagnosed for the first time and confirmed according to the International Classification of Disease (10th Revision). Individuals undergoing physical examination at the Eighth Affiliated Hospital of Sun Yat-Sen University (Shenzhen, China) were enrolled as control subjects, matched by age and sex with IS patients. Subjects with stroke history, peripheral arterial occlusive disease, severe immunological diseases or cancer were excluded. Approximately 5 mL vein blood samples were collected into EDTA-anticoagulant tubes from each participant. The plasma and blood cells were immediately isolated by centrifugation at 2000 g for 10 min at 4C and then stored at −80C for use. To collect general characteristics and results of clinical biochemistry tests, the structured questionnaires were applied. The study protocol conforms to the ethical guidelines of the 1975 Declaration of Helsinki and was approved by the ethics committee of the Shenzhen Center for Disease Control and Prevention. Written informed consent was also collected from each participant. 2.2 miRNA profiling Peripheral blood cell samples for miRNA profiling were collected from 25 IS cases and 25 controls matched with age and sex. The general characteristics of the population are shown in Table S1. Total RNA extraction methods and the details of miRNA profiling are described in the Supplementary Material. Differentially expressed miRNAs were filtered through fold-change and FDR-adjusted p values. miRNAs with fold change >2 or <0.5 and FDR-adjusted p<0.05 were identified as differentially expressed between the case and control group. 2.3 Total RNA isolation For miRNA detection in blood samples, about 200 μL blood was used to extract total RNAs following the manufacturer’s instruction of the mirVana PARIS miRNA Isolation Kit (Ambion1556) with modifications. Unlike the standard protocol, we treated the blood cell samples twice with acid-phenol chloroform. For gene expression detection in cultured cells, the total RNAs were extracted by Trizol reagent (Invitrogen). 5

2.4 qRT-PCR assays miRNA expression was detected as previously described [24], and detailed methods are listed in the Supplementary material. For gene expression analysis, first strand cDNA was obtained using SuperScriptⅢ First-Strand Synthesis System (Life Technologies). Quantitative PCR was conducted to detect gene expressions using Platinum SYBR Green qPCR Supermix (Life Technologies). The mRNA levels were normalized to beta-actin mRNA levels. The primers for the genes were: beta-actin (F: 5′CCTGGCACCCAGCACAAT3′, R: 5′GCCGATC CACACGGAGTACT3′); APOC2 (F: 5′GACTCCTCCCAGCTCTGTTTCTTG3′, R: 5′ AGGTCGGGCTAGGCATCTCATCTT3′); and LPL (F: 5′GAAAGGCACCTGCG GTATT3′, R: 5′CATGCCGTTCTTTGTTCTGTA3′). 2.5 Target gene prediction The

target

genes

of

miRNA

were

predicted

with

TargetScan

Human

(http://www.targetscan.org/vert_71/) [Friedman et al., 2009]. 2.6 Chemicals, cell culture and transfection Human acute monocytic leukemia cells (THP-1) and human embryonic kidney 293 cells (HEK-293) were obtained from the type culture collection of the Chinese Academy of Sciences (Shanghai, China). THP-1 cells were cultured in RPMI-1640 medium (Gibco) supplemented with 10% fetal bovine serum (FBS), sodium pyruvate and GlutaMax. HEK-293 cells were cultured with Dulbecco Minimum Essential Medium (DMEM, GIBCO) supplemented with 10% FBS. Ox-LDL and dil-ox-LDL were provided by Yiyuan Biotechnologies Co., Ltd (Guangzhou, China). Phorbol 12-myristate 13-acetate (PMA) was obtained from Sigma-Aldrich (St. Louis, MO, USA). miRNA mimics and inhibitor, synthesized by Ruibo Bio Co., Ltd. (Guangzhou, China), were transfected into cells using Lipofectamine 3000 (Invitrogen) in accordance with the manufacturer’s protocol. 2.7 UTR cloning and reporter gene assay The

ApoC2

gene

sequence

was

achieved

from

the

GenBank

database

(http://www.ncbi.nlm.nih.gov/). The fragments of ApoC2 3′ UTR were synthesized by GENEWIZ Inc. (Suzhou, China) and inserted into the psiCheck2 luciferase plasmid at NotI and XhoI restriction endonuclease sites. HEK-293 cells were seeded into 96-well plates at 5×103 cells per well and incubated at 37ºC 6

for 24 h. After reaching 80~90% confluence, cells were co-transfected by reporter gene constructs and miRNA mimics using Lipofectamine 3000. At 48 h post-transfection, cells were lysed and we detected the luciferase activities using the dual-luciferase reporter assay system (Promega, Madison, WI, USA) on a Tecan Infinite M200 PRO Multi-Detection Microplate Reader (Swiss). The renilla luciferase activity was used for normalization. 2.8 Oil red O staining The THP-1 cells were seeded into 6-well plate at 2×106 cells per well and treated with 50 ng/ml PMA for 24 h for cell differentiation to macrophages. miRNA mimics or inhibitor were transfected using Lipofectamine 3000. At 48 h post-transfection, cells were stimulated with ox-LDL (50 μg/ml) in order to induce foam cell formation. After 48 h, cells were fixed with 4% paraformaldehyde/PBS and stained with Oil Red O solution (Biotechnology Co., Ltd; Beijing, China). The lipid contents of THP-1 macrophage-derived foam cells were evaluated by microscopy [Xu et al., 2017]. 2.9 Cellular uptake of LDL assay THP-1 cells were seeded into 6-well plate at 2×106 cells per well and cultured with 50 ng/ml PMA for 24 h. miRNA mimics and inhibitors were transfected into cells. At 48 h post-transfection, THP-1-derived macrophages were washed with PBS and resuspended in medium with 20 μg/ml Dil-labeled ox-LDL (Leagene Biotechnology Co., Ltd) for 4 h. For counterstaining, cell nuclei were stained with 4′,6-diamidine-2′-phenylindole dihydrochloride (DAPI, 1μg/ml) at room temperature for 10 min. Dil-ox-LDL uptake was evaluated using Olympus BX-41 fluorescence microscopy [Yi et al., 2018].

7

2.10 Statistical analysis The general characteristics of the population are presented as mean ± standard deviation (SD), median (interquartile range) or percentage. Comparison of the differences was performed by Student’s t test, Mann–Whitney U test, or the Chi-square test depending on the data distribution. The difference in circulating miR-1275 levels between IS patients and controls was examined by Student’s t test. The odds ratios (ORs) and 95% confidence intervals (CIs) were calculated to indicate the relationship between miR-1275 expression and the occurrence of IS by multivariate logistic regression model, with adjustment for traditional risk factors including age, sex, smoking, hypertension and diabetes mellitus. The ability for miR-1275 to discriminate stroke cases from controls was analyzed by receiver operating characteristic (ROC) curves and reclassification analysis in two models. The baseline model was composed of traditional risk factors, and the extended model incorporated miR-1275 expression with traditional risk factors. Quantitative analyses of human THP-1 macrophages stained with Oil Red O or DIL-ox-LDL were conducted with Image J and data were presented as mean ±SD. The difference in the percentages of positive staining between miR-1275 (or its inhibitor) and negative control was assessed by Student’s t test. Statistical analyses were conducted by SPSS 16.0 software (Statistical Package for the Social Sciences, Chicago, IL, USA). Two-tailed p<0.05 was supposed to be statistically significant.

8

3 Results 3.1 miRNA expression profiles and prediction of APOC2-related miRNAs As LPL activity is critical for the development of atherosclerosis and IS, we focused on its most important regulatory co-factor, the APOC2 gene. We firstly analyzed the putative miRNAs which might target the 3’UTR of APOC2 gene using the bioinformatics tool TargetScan Human. Results suggest that a total of 319 miRNAs were predicted to harbor the direct binding sites in the 3’UTR of APOC2 gene. We also explored the miRNA expression profiles of the whole blood cells in 25 IS patients and 25 control subjects by miRNA microarray (Fig S1), and a total of 355 miRNAs were identified as differentially expressed. Notably, miR-1275 showed a relatively higher fold change between the cases and controls (fold change=6.46, FDR-adjusted p <0.01). One putative seeding site for miR-1275 is located within the 3’UTR of APOC2 gene, as indicated in Fig 1a. Therefore, we focused on miR-1275 in this study. 3.2 miR-1275 negatively regulates ApoC2 gene expression To evaluate the potential regulation of the ApoC2 gene by miR-1275, we conducted a dual luciferase reporter assay. The luciferase reporter construct psiCheck2- ApoC2UTR was co-transfected with different doses of miR-1275 into human embryonic kidney 293 cells. The effects of miR-1275 on the luminescence intensities were analyzed and the relative luciferase activities of the reporter gene construct containing the ApoC2 3′ UTR dropped to 71% after 100nM miR-1275 mimic transfection, as shown in Fig 1b. As it is widely accepted, the activity of LPL was controlled by the levels of itself and co-factor APOC2 [Jiang et al., 2016; Liu et al., 2017]. We next assessed the effects of miR-1275 on the expression levels of LPL and ApoC2 genes. miR-1275 mimics and inhibitor were transfected into THP-1 derived macrophages to elevate or suppress the intracellular levels of miR-1275. As shown in Fig 1c, ApoC2 mRNA levels decreased by about 21% in the THP-1 derived macrophages after miR-1275 transfection, while miR-1275 inhibitor increased ApoC2 mRNA expression by about 31%. However, we failed to observe changes in LPL mRNA levels after transfection of miR-1275 mimic or inhibitor in THP-1-derived macrophages. 3.3 miR-1275 inhibits ox-LDL uptake and suppresses macrophage foam cell formation As lipoprotein uptake is an essential step of the formation of foam cells, we analyzed the effect of miR-1275 on cellular uptake of Dil-labeled ox-LDL in THP-1-derived macrophages. 9

THP-1-derived macrophages transfected with miR-1275 mimics or inhibitor were incubated with Dil-ox-LDL to induce the foam cell formation. After 4h of incubation, the uptake of Dil-ox-LDL was observed using a fluorescence microscope. Fig 2a showed that miR-1275 mimics significantly decreased the uptake of Dil-ox-LDL, compared to negative control. Meanwhile, the fluorescence signals of Dil-ox-LDL were clearly augmented after transfection of miR-1275 inhibitor (Fig 2b). We next examined the effect of miR-1275 on the lipid content in Ox-LDL-induced foam cells. THP-1-derived macrophages transfected with miR-1275 mimic or inhibitor were treated with Ox-LDL and the formation of foam cells were induced. After 48 h of treatment, cells were stained with Oil Red O solution (a lysochrome diazo dye) and the lipid content was evaluated. As shown in Fig 3a/b, Oil Red O positive cells were almost undetected in the cells which were not transfected or stimulated with Ox-LDL（UN group）. miR-1275 mimics reduced lipid content and suppressed macrophage foam cell formation, compared to N.C. mimics group. Meanwhile, miR-1275 inhibitor increased the staining in Ox-LDL-induced foam cells, compared to N.C. inhibitor group. As atherosclerosis contributes greatly to the onset of IS, we validated the pathophysiologic role of miR-1275 in IS development in the next step. 3.4 General characteristics of the study population We detected the blood cell expression levels of miR-1275 in the population composed of 279 IS patients and 279 control subjects. The general characteristics of the population are shown in Table 1. The blood levels of fasting glucose (FG) and total cholesterol (TC) were significantly higher in IS patients than controls (p<0.05). In contrast, the blood level of high-density lipoprotein cholesterol (HDL-c) was significantly lower in IS cases than controls (p<0.05). In addition, the IS cases were more likely to have the history of hypertension or diabetes mellitus (p<0.05). 3.5 Association of the whole blood levels of miR-1275 with the occurrence of IS We evaluated miR-1275 levels in the study population, and the miR-1275 levels were log-transformed relative to U6. As indicated in Fig 4, after normalization to U6, miR-1275 levels in whole blood cells were lower in IS cases than controls (-6.45 ± 1.56 vs. -5.62 ± 2.10, p<0.001). We then performed logistic regression analysis to investigate the relationship between miR-1275 levels and the occurrence of IS. Results showed that the expression levels of miR-1275 were negatively associated with the occurrence of IS (adjusted OR, 0.76; 95% CI, 0.69~0.85; p<0.001; 10

Table 2) after adjustment for traditional risk factors. 3.6 Diagnostic value of miR-1275 by ROC curve and reclassification analysis The additive prediction value of miR-1275 was evaluated. As shown in Table 3, the area under the ROC curve of the baseline model was 0.73 (95% CI, 0.70–0.78) and increased to 0.76 (95% CI, 0.71–0.80) after miR-1275 inclusion (p=0.004). The indexes of net reclassification improvement (NRI) and integrated discrimination improvement (IDI) were calculated to indicate the ability of miR-1275 to reclassify patients. The results showed that miR-1275 was capable of reclassifying a portion of patients with an NRI of 35.47% (95% CI, 19.07%–51.88%, p<0.001) and an IDI of 0.04 (95% CI, 0.02–0.05, p<0.001).

11

4 Discussion In this study, we report the potential anti-atherogenic role of miR-1275 in IS development. First, bioinformatics analysis and cell experiments suggested that miR-1275 may regulate the expression of ApoC2 gene, which encodes a critical co-factor for LPL that is involved in the pathogenesis of atherosclerosis-related diseases. Second, we found that miR-1275 inhibited the cellular uptake of Ox-LDL and suppressed the formation of macrophage foam cells. Finally, we found that blood miR-1275 was negatively associated with the risk of IS. ROC curve and reclassification analysis indicated that blood miR-1275 improved the prediction of IS risk, in combination with traditional risk factors. Together our results suggest that miR-1275 might be involved in the development of IS partially by down-regulating ApoC2 gene expression and blocking foam cell formation in the condition of ox-LDL stimulation. The formation of macrophage foam cells, a key step in the onset and development of atherosclerosis, occurs as a result of uncontrolled lipoprotein uptake, excessive fatty acid esterification and impaired cholesterol efflux. The critical role of macrophage LPL has been demonstrated in foam cell formation and atherosclerosis progression. Macrophage LPL promotes foam cell formation by accelerating lipoprotein uptake and lipid retention in the cytoplasm [Ishibashi et al., 1990; Rumsey et al., 1992], and the lipolytic activity of LPL is required for this process [Olivier et al., 2012]. ApoC2 is the most important co-factor required for LPL lipolytic activity. Elevated plasma level of ApoC2 was detected in diabetic patients with CHD [Barbagallo et al., 1990], and ApoC2 polymorphism rs5127 decreased the risk of coronary heart disease [Ken-Dror et al., 2010]. Moreover, low serum level of ApoC2 increased the risk of reinfarction or revascularization in myocardial infarction patients with acute ST-segment elevation [Hermans et al., 2017]. Thus, we speculated that dysregulation of ApoC2 might also contribute greatly to the development of atherosclerosis or related vascular diseases. However, few studies have focused on this issue. miRNAs have been demonstrated as key regulators in the pathogenic processes of atherosclerosis and IS, and we verified that ApoC2 gene could be directly targeted by miR-1275, revealing a post-transcriptional regulatory mechanism for ApoC2. In addition, down-regulation of miR-1275 expression increased ApoC2 levels and promoted LDL uptake and foam cell progression. Using miRNA microarray, we also found that miR-1275 was differentially expressed in IS cases compared with control subjects. Therefore, we strongly suggested that miR-1275 might 12

play a protective role against IS via suppressing atherosclerosis progression. Thus, we further examined the expression levels of miR-1275 in 279 IS cases and 279 control subjects, and the results were consistent with the microarray data. Using logistic regression and reclassification analysis, we demonstrated that the level of blood miR-1275 was negatively associated with IS occurrence, and addition of miR-1275 to the traditional risk factor model increased the prediction probability. A previous study demonstrated that miR-1275 was an important regulator of the B-cell centered immune function involved in the pathogenesis of coronary heart disease [Huan et al., 2015]. The maternal serum level of miR-1275 was differentially expressed in pregnant women with congenital heart defect fetuses [Gu et al., 2019]. In addition, miR-1275 was found to inhibit adipogenesis via the ELK1 gene and the expression levels of miR-1275 were decreased in obese subjects [Pang et al., 2016]. To the best of our knowledge, this is the first study documenting a moderate risk predicting value of miR-1275 for the occurrence of IS. This study has several strengths. First, our study revealed a new post-transcriptional regulation of ApoC2 in IS. Second, we conducted cell experiments and epidemiological study to illustrate the biological consequences of miR-1275 downregulation and shed new light on the pathological role of blood miRNAs in IS development. This study has several limitations. First, because miRNAs often exert effects synergistically with each other, more miRNAs should be monitored for better prediction efficiency. Second, the detailed change of phenotypes that miR-1275 may influence in the progression of atherosclerosis or IS should be evaluated in future studies. Third, the biological consequence of miR-1275 depletion on macrophage foam cell formation and progression should be evaluated in further research using atherosclerotic mouse models. In summary, our study suggested that the blood cell levels of miR-1275 were negatively associated with the risk of IS. The combination of blood miR-1275 levels with traditional risk factors significantly improved the predictive value of IS. Moreover, we also demonstrated that miR-1275 blocked macrophage foam cell formation via suppressing macrophage ApoC2 gene expression, which might affect LPL activity. Therefore, miR-1275 might exert a protective role against the development of IS. Further studies in an atherosclerotic mouse model are warranted to clarify the biological function of miR-1275 in the development and progression of atherosclerosis 13

and elucidate the underlying mechanism. Acknowledgements We are particularly grateful to all the ischemic stroke patients and volunteers who participated in this study and to the medical personnel of People's Hospital of Shenzhen and the Eighth Affiliated Hospital of Sun Yat-Sen University for their kind assistance in collecting questionnaires and blood samples. We also thank Liwen Bianji, Edanz Editing China (www.liwenbianji.cn/ac) for the English language editing of this manuscript. Funding This work was supported by the following sources: National Natural Science Foundation of China (81973004, 81700372, and 81602407), Science and Technology Planning Project of Shantou Municipal (medical), Medical Scientific Research Foundation of Guangdong Province of China

(B2019020),

Guangdong

(NO:2019A1515011959)

and

Basic

and

Shenzhen

Applied

Municipal

Basic

Research

Technological

Project

JCYJ20170306160036900)

Conflicts of interest None.

Abbreviations： AIS

Acute Ischemic Stroke

Apo C2

Apolipoprotein C2

CI

Confidence Interval

CHD

Coronary Heart Diseases

DAPI

4’,6-Diamidine-2’-Phenylindole Dihydrochloride

Dil

1,1'-Dioctadecyl-3,3,3',3'-Tetramethylindocarbocyanine Perchlorate

DMEM

Dulbecco Minimum Essential Medium

FBS

Fetal Bovine Serum

FDR

False Discovery Rate

FG

Fast Glucose

HDL

High-density Lipoprotein

IDI

Integrated Discrimination Improvement 14

Foundation (No.

IS

Ischemic Stroke

LDL

Low-density Lipoprotein

LPL

Lipoprotein Lipase

miRNA

microRNA

NIHSS

National Institute Of Health Stroke Scale

NRI

Net Reclassification Improvement

OR

Odd Ratio

Ox-LDL

Oxidized Low Density Lipoprotein

PMA

Phorbol 12-myristate 13-acetate

RLA

Relative Luciferase Activity

ROC

Receiver Operating Characteristic

TC

Total Cholesterol

TG

Triglycerides

UTR

Untranslated Region

15

Reference Ambros, V., 2004. The functions of animal microRNAs. Nature 431(7006), 350-355. Babaev, V. R., Fazio, S., Gleaves, L. A., Carter, K. J., Semenkovich, C. F., Linton, M. F., 1999. Macrophage lipoprotein lipase promotes foam cell formation and atherosclerosis in vivo. Journal of Clinical Investigation 103(12), 1697-1705. Babaev, V.R., Patel, M. B., Semenkovich, C. F., Fazio, S., Linton, M. F., 2000. Macrophage lipoprotein lipase promotes foam cell formation and atherosclerosis in low density lipoprotein receptor-deficient mice. The Journal of Biological Chemistry 275(34),26293-26299. Barbagallo, C. M., Averna, M. R., Amato, S., Marino, G., Labisi, M., Rao, A. C., et al., 1990. Apolipoprotein profile in type II diabetic patients with and without coronary heart disease. Acta Diabetologica Latina 27(4), 371-377. Eken, S. M., Christersdottir, T., Winski, G., Sangsuwan, T., Jin, H., Chernogubova, E., et al., 2019. miR-29b Mediates the Chronic Inflammatory Response in Radiotherapy-Induced Vascular Disease. JACC: Basic to Translational Science 4(1), 72-82. Eyileten, C., Wicik, Z., De Rosa, S., Mirowska-Guzel, D., Soplinska, A., Indolfi, C., et al., 2018. MicroRNAs as Diagnostic and Prognostic Biomarkers in Ischemic Stroke-A Comprehensive Review and Bioinformatic Analysis. Cells 7(12), pii: E249. Felekkis, K., Touvana, E., Stefanou, Ch., Deltas, C., 2010. microRNAs: a newly described class of encoded molecules that play a role in health and disease. Hippokratia 14(4), 236-240. Friedman, R. C., Farh, K. K., Burge, C. B., Bartel, D. P., 2009. Most Mammalian mRNAs Are Conserved Targets of MicroRNAs. Genome Research 19, 92-105 Glass, C.K., Witztum, J. L., 2001. Atherosclerosis. the road ahead. Cell 104(4), 503-516. Gu, H., Chen, L., Xue, J., Huang, T., Wei, X., Liu, D., et al., 2019. Expression profile of maternal circulating microRNAs as non-invasive biomarkers for prenatal diagnosis of congenital heart defects. Biomedicine & Pharmacotherapy 109, 823-830. Hermans, M. P. J., Bodde, M. C., Jukema, J. W., Schalij, M. J., van der Laarse, A., Cobbaert, C. 16

M., 2017. Low levels of apolipoprotein-CII in normotriglyceridemic patients with very premature coronary artery disease: Observations from the MISSION! Intervention study. Journal of Clinical Lipidology 11(6), 1407-1414. Huan, T., Rong, J., Tanriverdi, K., Meng, Q., Bhattacharya, A., McManus, D. D., et al., 2015. Dissecting the roles of microRNAs in coronary heart disease via integrative genomic analyses. Arteriosclerosis, Thrombosis, and Vascular Biology 35(4),1011-1021. Huang, S., Lv, Z., Guo, Y., Li, L., Zhang, Y., Zhou, L., et al. Identification of blood let-7e-5p as a biomarker for ischemic stroke. PLoS One 2016; 11:e0163951. Ichikawa, T., Kitajima, S., Liang, J., Koike, T., Wang, X., Sun, H., et al., Watanabe, T., Yamada, N., Fan, J., 2004. Overexpression of lipoprotein lipase in transgenic rabbits leads to increased small dense LDL in plasma and promotes atherosclerosis. Laboratory Investigation 84(6),715-726. Ishibashi, S., Yamada, N., Shimano, H., Mori, N., Mokuno, H., Gotohda, T., et al., 1990. Apolipoprotein E and lipoprotein lipase secreted from human monocyte-derived macrophages modulate very low-density lipoprotein uptake. The Journal of Biological Chemistry 265(6), 3040– 3047. Jiang, J., Wang, Y., Ling, Y., Kayouma, A., Liu, G., Gao, X., 2016. A novel APOC2 gene mutation identified in a Chinese patient with severe hypertriglyceridemia and recurrent pancreatitis. Lipids Health Dis. 2016 Jan 16; 15:12. Ken-Dror, G., Talmud, P. J., Humphries, S. E., Drenos, F., 2010. APOE/C1/C4/C2 gene cluster genotypes, haplotypes and lipid levels in prospective coronary heart disease risk among UK healthy men. Molecular Medicine 16(9-10);389-399. Li, G., Morris-Blanco, K. C., Lopez, M. S., Yang, T., Zhao, H., Vemuganti, R., et al., 2018. Impact of microRNAs on ischemic stroke: From pre- to post-disease. Progress in Neurobiology 163-164, 59-78. Liang, T. Y., Lou, J. Y., 2016. Increased Expression of mir-34a-5p and Clinical Association in Acute Ischemic Stroke Patients and in a Rat Model. Medical Science Monitor 22, 2950-2955. Liu, C., Gaudent, D., Miller, Y.I., 2017. Deficient Cholesterol Esterification in Plasma of apoc2 17

Knockout Zebrafish and Familial Chylomicronemia Patients. PLoS One. 2017 Jan 20;12(1):e0169939. Liu, L., Wang, D., Wong, K.S., Wang, Y., 2011. Stroke and stroke care in China: huge burden, significant workload, and a national priority. Stroke 42(12), 3651-3654. Olivier, M., Tanck, M. W., Out, R., Villard, E. F., Lammers, B., Bouchareychas, L., et al., 2012. Human ATP-binding cassette G1 controls macrophage lipoprotein lipase bioavailability and promotes foam cell formation. Arteriosclerosis, Thrombosis, and Vascular Biology 32(9), 2223-2231. Pang, L., You, L., Ji, C., Shi, C., Chen, L., Yang, L., et al., 2016. miR-1275 inhibits adipogenesis via ELK1 and its expression decreases in obese subjects. Journal of Molecular Endocrinology 57(1), 33-43. Pugni, L., Riva, E., Pietrasanta, C., Rabacchi, C., Bertolini, S., Pederiva, C., et al., 2014. Severe hypertriglyceridemia in a newborn with monogenic lipoprotein lipase deficiency: an unconventional therapeutic approach with exchange transfusion. JIMD Reports 13, 59-64. Qin. Y. Y., Wei, A. Q., Shan, Q. W., Xian, X. Y., Wu, Y. Y., Liao, L., et al., 2018. Rare LPL gene missense mutation in an infant with hypertriglyceridemia. Journal of Clinical Laboratory Analysis, http://doi: 10.1002/jcla.22414. Rader, D. J., Puré, E., 2005. Lipoproteins, macrophage function, and atherosclerosis: beyond the foam cell? Cell Metabolism 1(4), 223-230. Rumsey, S. C., Obunike, J. C., Arad, Y., Deckelbaum, R. J., Goldberg, I. J., 1992. Lipoprotein lipase-mediated uptake and degradation of low-density lipoproteins by fibroblasts and macrophages. Journal of Clinical Investigation 90(4):1504-12. Sadat, U., Jaffer, F. A., van Zandvoort, M. A., Nicholls, S. J., Ribatti, D., Gillard, J. H., 2014. Inflammation and neovascularization intertwined in atherosclerosis: imaging of structural and molecular imaging targets. Circulation 130(9), 786-794. Tegos, T.J., Kalodiki, E., Sabetai, M.M., Nicolaides, A.N., 2000. Stroke: epidemiology, clinical picture, and risk factors-Part I of III. Angiology 51(11), 793–808. 18

Wang, Y., Huang, J., Ma, Y., Tang, G., Liu, Y., Chen, X., et al., 2015. MicroRNA-29b is a therapeutic target in cerebral ischemia associated with aquaporin 4. Journal of Cerebral Blood Flow & Metabolism 35(12), 1977-1984. Wildgruber, M., Swirski, F. K., Zernecke, A., 2013. Molecular imaging of inflammation in atherosclerosis. Theranostics 3(11), 865-884. Wolska, A., Dunbar, R. L., Freeman, L. A., Ueda, M., Amar, M. J., Sviridov, D. O., et al., 2017. Apolipoprotein C-II: New findings related to genetics, biochemistry, and role in triglyceride metabolism. Atherosclerosis 267, 49-60. Xu, Z., Dong, A., Feng, Z., Li, J., 2017. Interleukin-32 promotes lipid accumulation through inhibition of cholesterol efflux. Experimental and Therapeutic Medicine 14(2), 947-952. Yi, X., Zhang, J., Zhuang, R., Wang, S., Cheng, S., Zhang, D., Xie, J., et al., 2018. Silencing LAIR-1 in human THP-1 macrophage increases foam cell formation by modulating PPARγ and M2 polarization. Cytokine 111,194-205. Zaccagnini, G., Maimone, B., Fuschi, P., Maselli, D., Spinetti, G., Gaetano, C., et al., 2017. Overexpression of miR-210 and its significance in ischemic tissue damage. Scientific Reports 7(1):9563. Zeng, L., Liu, J., Wang, Y., Wang, L., Weng, S., Tang, Y., et al., 2011. MicroRNA-210 as a novel blood biomarker in acute cerebral ischemia. Frontiers in Bioscience 3, 1265-1272.

19

Figure Legends Fig. 1. miR-1275 downregulates ApoC2 gene in THP-1-derived macrophages. A: Sequence alignment of the miR-1275 mature binding sequence with the ApoC2 3′ UTR (TargetScan). B: The 3′ UTR fragment of ApoC2 gene was inserted into psiCHECK2. Relative luciferase activity (RLA) was analyzed in HEK293 cells co-transfected with the reporter gene harboring the ApoC2 3′ UTR (0.2 μg) and various doses of miR-1275 mimics. ***P < 0.001, 50 nM mimics or 100 nM mimics vs. negative control. C: Endogenous ApoC2 and LPL mRNA expression was measured by quantitative RT-PCR in human THP-1 macrophages transfected with miR-1275 or inhibitors. *P < 0.05 vs. negative control. n.s.= not statistically significant. Fig. 2. miR-1275 inhibits cellular uptake of dil-ox-LDL in THP-1-derived macrophages. A: THP-1 cells were cultured with phorbol 12-myristate 13-acetate (PMA, 10 ng/ml) to differentiate into macrophages. After 48 h incubation, cells were transfected with miR-1275 mimics or inhibitor (miR-1275 inh). At 48 h post-transfection, cells were washed with PBS twice and stimulated with Dil-ox-LDL (20 μg/ml) for 4 h. Cells were washed with PBS twice and the uptake of Dil-ox-LDL was observed with a fluorescence microscope. B: Percentages of positive staining in three microscopic fields. N.C. means negative control mimic, N.C. inh means negative control inhibitor and miR-1275 inh means inhibitor of miR-1275. Fig. 3. miR-1275 decreases lipid content in THP-1-derived macrophages stimulated with ox-LDL. A: THP-1 cells were cultured with PMA (10 ng/ml) to differentiate into macrophages. After 48 h incubation, cells were transfected with miR-1275 mimics or inhibitor (miR-1275 inh). At 48 h post-transfection, cells were stimulated with ox-LDL (50 μg/ml) for 48 h. Formation of foam cells was assayed by Oil Red staining and cell nuclei were stained with hematoxylin. Cells without ox-LDL stimulation (UN) served as controls. B: Percentages of positive staining in three microscopic fields.

N.C. means negative control mimic, N.C. inh means negative control

inhibitor and miR-1275 inh means inhibitor of miR-1275. Fig. 4. Expression levels of miR-1275 in ischemic patients and control subjects. The expression of miR-1275 was detected in 279 patients and 279 control subjects. Relative expression levels were normalized to U6 and then log-transformed. The whiskers of the plots 20

represent the 2.5–97.5 percentiles. Table 1. General characteristics of the study population Variables

Control (n=279)

Case (n=279)

p value

Age, year Male, n (%) Smoking, n (%) Hypertension, n (%) Diabetes, n (%) FG, mmol/L TC, mmol/L TG, mmol/L HDL-c, mmol/L LDL-c, mmol/L Onset time Carotid plaque, n (%)

55.59±10.45 161 (57.7) 42 (15.1) 59 (21.1) 16 (5.7) 5.27 (4.93~5.87) 4.82 ± 1.38 1.37 (0.92~2.30) 1.26 ± 0.31 3.08 ± 0.87 no data no data

57.02±10.19 165 (59.1) 64 (22.9) 163 (58.4) 46 (16.5) 5.52 (4.97~6.70) 5.07 ± 1.25 1.29 (0.95~1.83) 1.04± 0.27 3.04 ± 0.94 48 (14.25~72) 55 (19.7)

0.101 * 0.886 † 0.149† <0.001† 0.016 † 0.002‡ 0.025* 0.132 ‡ <0.001* 0.58 * -

Data are expressed as mean ± SD, median (25th, 75th quartiles) or percentages. FG, fasting glucose; TC, total cholesterol; TG, triglycerides; HDL-c, high-density lipoprotein cholesterol; LDL-c, low-density lipoprotein cholesterol; * Student’s t test for the difference between ischemic stroke patients and controls. † Chi-square test for the difference in the distribution frequencies between ischemic stroke patients and controls. ‡ Mann–Whitney U test for the differences between ischemic stroke patients and controls.

21

Table 2. Association of the expression level of miR-1275 with the occurrence of ischemic stroke Variables Age Male Smoking Hypertension Diabetes miR-1275

Odds Ratio (95% CI) *

p value

1.00 (0.98~1.02) 0.89 (0.60~1.36) 2.47 (1.45~4.20) 5.13 (3.41~7.71) 2.04 (1.05~3.95) 0.76 (0.69~0.85)

0.890 0.610 0.001 <0.001 0.035 <0.001

CI, confidence interval. * Logistic regression analysis adjusted with age, sex, smoking, history of hypertension and diabetes.

22

Table 3. AUC, NRI, and IDI calculations for miR-1275 Variables Baseline model AUC (95% CI) Extended model AUC (95% CI) NRI, % (95% CI) IDI, (95% CI)

miR-1275

p value

0.73 (0.70~0.78) 0.76 (0.71~0.80) 35.47 (19.07~51.88) 0.04 (0.02~0.05)

0.004 <0.001 <0.001

AUC calculations are based on a multivariate logistic regression analysis including age, sex, smoking, history of hypertension, history of diabetes (baseline model) or the addition of miR-1275 (extended model). AUC, area under the receiver operating characteristic curve; CI, confidence interval; NRI, net reclassification improvement; IDI, integrated discrimination improvement.

Highlights： miR-1275 targets the 3UTR of ApoC2 gene, which encodes a critical activator for LPL. miR-1275 inhibits the formation of macrophage foam cells. Blood miR-1275 level is negatively associated with the risk of ischemic stroke.

Abbreviations： AIS

Acute Ischemic Stroke

Apo C2

Apolipoprotein C2

CI

Confidence Interval

CHD

Coronary Heart Diseases

DAPI

4’,6-Diamidine-2’-Phenylindole Dihydrochloride

Dil

1,1'-Dioctadecyl-3,3,3',3'-Tetramethylindocarbocyanine Perchlorate

DMEM

Dulbecco Minimum Essential Medium

FBS

Fetal Bovine Serum

FDR

False Discovery Rate

FG

Fast Glucose

HDL

High-density Lipoprotein 23

IDI

Integrated Discrimination Improvement

IS

Ischemic Stroke

LDL

Low-density Lipoprotein

LPL

Lipoprotein Lipase

miRNA

microRNA

NIHSS

National Institute Of Health Stroke Scale

NRI

Net Reclassification Improvement

OR

Odd Ratio

Ox-LDL

Oxidized Low Density Lipoprotein

PMA

Phorbol 12-myristate 13-acetate

RLA

Relative Luciferase Activity

ROC

Receiver Operating Characteristic

TC

Total Cholesterol

TG

Triglycerides

UTR

Untranslated Region

CRediT author statement

Lu Li: Methodology, Investigation, Writing- Original draft preparation, Funding Acquisition Xu Wang:

Investigation, Writing – Review & Editing, Visualization

Xuejun Fu:

Investigation, Resources

Ying Huang: Investigation, Resources Ying Wen:

Methodology, Data Curation, Funding Acquisition

Qianhui Xu: Investigation, Resources Xinpeng He:

Investigation

Kan Wang: Investigation Suli Huang:

Conceptualization, Supervision, Writing- Reviewing and Editing,

Funding Acquisition Ziquan Lv:

Conceptualization, Supervision, Writing- Reviewing and Editing 24

Suli Huang:

Conceptualization, Supervision, Writing- Reviewing and Editing,

Funding Acquisition

25