Bluetongue virus with mutated genome segment 10 to differentiate infected from vaccinated animals: A genetic DIVA approach

ARTICLE IN PRESS

G Model JVAC 14623 1–4

Vaccine xxx (2013) xxx–xxx

Contents lists available at ScienceDirect

Vaccine journal homepage: www.elsevier.com/locate/vaccine

Short communication

1

Bluetonguevirus with mutated genome segment 10 to differentiate infected from vaccinated animals: A genetic DIVA approach

2

3

4 5

Q1

P.A. van Rijn ∗ , S.G.P. van Water, H.G.P. van Gennip Central Veterinary Institute of Wageningen UR (CVI), Department of Virology, P.O. Box 65, 8200 AB Lelystad, The Netherlands

6

7

a r t i c l e

i n f o

a b s t r a c t

8 9 10 11 12

Article history: Received 12 July 2013 Received in revised form 21 August 2013 Accepted 27 August 2013 Available online xxx

13

18

Keywords: Bluetongue PCR diagnostics DIVA Reverse genetics

19

1. Introduction

14 15 16 17

20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40

Bluetongue virus (BTV) includes 24 serotypes and recently even more serotypes are proposed. Mass vaccination campaigns highlight the need for differential diagnostics in vaccinated populations. Bluetongue disease is routinely diagnosed by serological and virological tests by which differentiation infected from vaccinated animals (DIVA principle) is not possible. Real time PCR tests preferably detect all BTV serotypes (panBTV PCR tests). These PCR tests operate as frontline test to detect new BTV incursions. However, highly sensitive panBTV PCR tests can also detect currently applied inactivated and modified-live vaccines. Here, BTV with eight silent mutations in segment 10 (Seg-10) was generated by reverse genetics. This BTV mutant is not detected by a Seg-10 panBTV PCR test (genetic DIVA). Thus, inactivated BT vaccine with this mutated Seg-10 will avoid false positive PCR results post vaccination, whereas BTV infected animals can be positively diagnosed with the accompanying Seg-10 panBTV PCR test (DIVA-test) far beyond the infectious period. © 2013 Published by Elsevier Ltd.

Bluetongue virus (BTV; family Reoviridae, subfamily Sedoreovirinae, genus Orbivirus) infects a wide range of ruminants and is responsible for significant losses of sheep and goats. Bluetongue (BT) is listed as a ‘notifiable disease’ by the World Organization for Animal Health [1]. BT is an arthropod-borne disease and transmission occurs by bites of vector-competent species of Culicoides [2]. The BTV species includes at least 24 serotypes, and new serotypes are proposed [3,4]. Since 1998 BTV serotypes 1, 2, 4, 8, 9 and 16 has invaded European countries [5], and expansion of areas affected in Europe and in the Americas have been experienced. Highly sensitive PCR diagnostics based on reverse transcription (RT), polymerase chain reaction (PCR) and real time detection have been developed targeting different genome segments of BTV, such as Seg-1[VP1], Seg-5[NS1], and Seg-10[NS3/NS3a], reviewed by Hoffmann et al. [6]. These real time PCR tests are supposed to detect all 24 BTV serotypes (panBTV PCR tests) of which several are targeting genome segment 10 (Seg-10) [3,7–10]. A high-throughput real time Seg-10 panBTV PCR test has been validated in a 5-years period of the BT-8 outbreak in the Netherlands [10]. It is of our special interest to frequently check the sensitivity of the panBTV PCR test operating as frontline tool to diagnose BTV incursions [5,11].

∗ Corresponding author. Tel.: +31 320238686; fax: +31 320238668. E-mail address: [email protected] (P.A. van Rijn).

Vaccination has been successfully used to control BT. Preventive vaccination is now allowed in BT-free areas atrisk of BTV incursions. This highlights the need for differential diagnosis of infected from vaccinated animals to detect BTV incursions in vaccinated populations (DIVA principle). However, serological DIVA testing is not possible by commercially available ELISAs in combination with the currently used live attenuated and inactivated virus vaccines. Further, inactivated virus vaccines can be detected by PCR-testing [12,13]. Here, reverse genetics was used to generate mutant BTV which is not detected by the extensively validated Seg-10 panBTV PCR test, and therefore allows genetic DIVA by PCR testing. Use of this mutated Seg-10 is however limited to inactivated BT vaccines due to the risk on uncontrolled introduction in the field of this mutated genome segment by vaccine virus transmission or reassortment with virulent field viruses. 2. Materials and methods BSR cell line, a clone of the baby hamster kidney cell line 21 [14], was cultured in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen) containing 5% foetal bovine serum (FBS) and 100 IU/ml penicillin, 100 ␮g/ml streptomycin and 2.5 ␮g/ml Amphotericin B. Reference BTV strains 1–24 and BTV strain Kuwait (KUW, proposed as BTV serotype 26) were kindly provided by the PirbrightInstitute, UK. Plasmids with cDNA of genome segments Seg-1 to Seg-10 of rgBTV1 and rgBTV6 were previously described [15,16]. cDNAs of mutated Seg-10 with eight silent mutations in the sequence

0264-410X/$ – see front matter © 2013 Published by Elsevier Ltd. http://dx.doi.org/10.1016/j.vaccine.2013.08.089

Please cite this article in press as: van Rijn PA, et al. Bluetonguevirus with mutated genome segment 10 to differentiate infected from vaccinated animals: A genetic DIVA approach. Vaccine (2013), http://dx.doi.org/10.1016/j.vaccine.2013.08.089

41 42 43 44 45 46 47 48 49 50 51 52 53 54 55

56

57 58 59 60 61 62 63 64 65 66

G Model JVAC 14623 1–4

ARTICLE IN PRESS P.A. van Rijn et al. / Vaccine xxx (2013) xxx–xxx

2

Table 1 List of PCR primers and probes. Sequences are indicated in the 5 → 3 order. F, R, and P indicate forward primer, reverse primer, and probe, respectively. Primers and probes of Seg-1 and Seg-10 panBTVPCR tests have been previously described [10,18]. Primers indicated by ‘full’ were used to amplify complete Seg-10. F-pan-S1 R-pan-S1 P-pan-S1 F-pan-S10 R-pan-S10 P-pan-S10 F-full-S10 R-full-S10

67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87

88

89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104

TTAAAATGCAATGGTCGCAATC TCCGGATCAAGTTCACTCC FAM-CCGTGCAAGGTGC-MGB AGTGTCGCTGCCATGCTATC GCGTACGATGCGAATGCA FAM-CGAACCTTTGGATCAGCCCGGA-TAMRA GTTAAAAAGTGTCGCTGCCATG GTAAGTGTGTAGTGTCGCGCAC

of the probe(mutant A) or the reverse primer (mutant B) in Seg10 of rgBTV6were likewise synthesized by Genscript Corporation (Piscataway, NJ) [16]. The open reading frame of Seg-10 TOV (Genbank accession number EU839846) expressing NS3/NS3a of Toggenburg Orbivirus (TOV, proposed as BTV serotype 25) was flanked by nontranslated regions of Seg-10 of rgBTV8 [6,16]. BTV mutants were generated using reverse genetics (rgBTV) as previously described[16]. Supernatant was harvested from monolayers developing cytopathogenic effect specific for BTV as confirmed by immunostaining with monoclonal antibody of ATCC1875 [17]. Virus titres were determined by endpoint dilution and expressed as 50% tissue culture infective dose per ml (TCID50/ml). Genome segment 10 of generated viruses was amplified using primers F-full-S10 and R-full-S10 (Table 1) and amplicons were sequenced by standard methods. PanBTV PCR tests targeting Seg1 and Seg-10 were performed to detect reference BTV strains and BTV mutants with primers and probes as listed in Table 1 [10,18]. Viral RNA was isolated by an automated procedure with the High Pure Viral RNA kit (Roche), and used to detect Seg-1 orSeg10 by panBTV PCR tests according to the all-in-one protocol as described [10]. 3. Results Eight silent mutations in the region of probe or reverse primer would not change expressed NS3/NS3a proteins by mutant A or mutant B, respectively (Fig. 1). Generation of BTV6(S10)B was as efficient as for BTV6 but rescue of BTV6 with mutant A remained unsuccessful after several attempts (Table 2). Apparently these silent mutations between both start codons in Seg-10 are lethal, whereas silent mutations in the location of the reverse primer are not affecting BTV replication. BTV6(S10)B was indeed phenotypically indistinguishable from BTV6, and the introduced mutations were genetically stable as confirmed by sequencing of entire Seg-10 after several passages (not shown). In contrast to BTV6, BTV6(S10)B was not detected by the Seg-10 panBTV PCR test, whereas both viruses were detected using the Seg-1panBTV PCR test(Table 2). Propagation of different BTVs is preferred to investigate detection with panBTV PCR tests (in vitro sensitivity) but BTV25 cannot be cultured [3]. We generated BTV1 with Seg-10 containing

Table 2 BT-viruses used in this study. BTV1-24 and BTV26 (KUW) are reference BTV strains. rgBTV1, rgBTV6, BTV1(S10)25 , and BTV6(S10)B were generated from cDNAsusing reverse genetics (+), whereas virus rescue with mutant A (BTV6(S10)A ) was not successful (−). Therefore, PCR tests for this theoretical virus were not done(nd). BTVs with mutated genome segment 10 (S10) differ from their ancestor as indicated. Note that BTV(S10)25 contains the open reading frame of S10 of TOV (BTV25) and the same Seg-1 as rgBTV1. Mutant A andmutant B (BTV6(S10)B ) containeight silent mutations and encodefor identicalNS3/NS3a protein (Fig.1). Virus

Virus rescue

BTV1-24 BTV26 BTV1(S10)25 rgBTV1 rgBTV6 BTV6(S10)A BTV6(S10)B

nd nd + + + +

panBTV PCR test S1

S10

+ + + + nd +

+ + + + + nd -

the NS3/NS3a gene of BTV25(BTV1(S10)25 . AllBTVs including BTV1(S10)25 and BTV26 were detected by the Seg-10 panBTV PCR test (Table 2). Except for BTV26, all BTV strains were also detected with the Seg-1 panBTV PCR test. Note, that BTV1(S10)25 contains Seg-1 of rgBTV1. The in silico sensitivity and specificity were checked for several Seg-10 panBTV PCR tests targeting the 5 region (Fig. 2). This update confirmed the strong conservation of these sequences but some genetic variation was observed (Fig. 2). Forward primer and probe of our PCR test are located in the region 1–47 [10], which is highly conserved and contain no or one mismatch per BTV sequence. The locations of most other probes (216–230 and 246–265) are also highly conserved (Fig. 2). The reverse primer of our PCR test is located in highly conserved region 248–265 [10]. The sequence of the region of the reverse primer of PCR tests published by Orru et al., LeBlanc et al., and Hofmann et al. (277–285) is more variable. One mismatch per primer or probe will not abolish BTV detection but could reduce the diagnostic sensitivity. Summarizing, regions 1–47, 216–230, and 246–265 are highly conserved regions and thus favourable to detect all BTV variants. Eight silent mutations in the region 248–265 do not affect BTV replication but completely preventsdetection with the Seg-10 panBTV PCR test.

4. Conclusion and discussion Eight silent mutations in highly conserved region 248–265 of Seg-10 were introduced by reverse genetics resulting in expression of identical NS3/NS3a (Fig. 1). These silent mutations however abolished detection with the extensively validated Seg-10 panBTV PCR test (Fig. 2). Thus, in contrast to all BTV variants in the field, BTV6(S10)B is not detected with this panBTV PCR test. Other real time Seg-10 panBTV PCR tests contain a probe in this region and would amplify the PCR target of BTV6(S10)B but will not detect the amplicon due to these mismatches in the region of the probe [3,9].

: . . . . . . BTV6 : 5’-GTTAAAAAGTGTCGCTGCC.ATG.CTA.TCC.GGG.CTG.ATC.CAA.AGG.TTC.GAA.GAA.GAA.AAA.ATG/ mutant A : 5’-GTTAAAAAGTGTCGCTGCC.ATG.CTA.TCG.GGC.TTA.ATA.CAG.AGA.TTT.GAA.GAA.GAA.AAA.ATG/ NS3 : 1-Met.Leu.Ser.Gly.Leu.Ile.Gln.Arg.Phe.Glu.Glu.Glu.Lys.Met/ : BTV6 : mutant B : NS3/NS3a :

. . . . . /231-CAG.AAA.GCG.GAG.AAG.GCT.GCA.TTC.GCA.TCG.TAC.GCG.GAA.GCG.TTT.CGT.GAT.GAT.GTG/ /231-CAG.AAA.GCG.GAG.AAG.GCA.GCT.TTT.GCT.AGC.TAT.GCG.GAA.GCG.TTT.CGT.GAT.GAT.GTG/ / 77-Gln.Lys.Ala.Glu.Lys.Ala.Ala.Phe.Ala.Ser.Tyr.Ala.Glu.Ala.Phe.Arg.Asp.Asp.Val/

Fig. 1. Regions of primers and probe in genome segment 10 (Seg-10). Codons and putative amino acid sequence of NS3/NS3a protein of BTV6/net08 are indicated. Positions of primers (bold) and probe (italics) are underlined. Positions in the probe (upper part) and reverse primer (lower part) were mutated (double underlined) in mutant A and B, respectively.

Please cite this article in press as: van Rijn PA, et al. Bluetonguevirus with mutated genome segment 10 to differentiate infected from vaccinated animals: A genetic DIVA approach. Vaccine (2013), http://dx.doi.org/10.1016/j.vaccine.2013.08.089

105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126

127

128 129 130 131 132 133 134 135 136

ARTICLE IN PRESS

G Model JVAC 14623 1–4

P.A. van Rijn et al. / Vaccine xxx (2013) xxx–xxx

3

: BTV6/net08: 1-26 : TOV : KUW :

. . . . . . /1-GTTAAAAAGTGTCGCTGCC.ATG.CTA.TCC.GGG.CTG.ATC.CAA.AGG.TTC.GAA.GAA.GAA.AAA.ATG/------------------+ --- --- --- +-- --- --- *+- --- --+ ++* ++* ++* +-* ---/------------------- --- --- --- --- --- --- --- --- --- --- --- --- --- ---/------------------- --- --- --- --- --- --- --- --- --T --- --- --- --- ---/-

A* L* R* R*

: : : :

forward 20F F-pan-S10 P-pan-S10

TCGCTGCC ATG CTA TCC G> ATG CTA TCC GGG CTG ATY C> AGTGTCGCTGCC ATG CTA TC>
. . . . : . . . . -/151-CGATGCCATCATCTATGCCAACGGTTGCCCTTGAAATATTGGACAAGGCGATGTCAAACACAACTGGTGCAACGCAAACA 1-26 :-****--**-**-*-----*-**--+--*--*--*-+**----*--*--*-----*-**+-*--*-----+-----++-+ TOV :-TGCA--GC-GG-G-------GC-----------G—C------T--------------T--------------------KUW :-AGC---GC-GG-G--------T--------------T--------A--------------------------------A* probe*: O* OGP265: O* probe : H* F :

CGGTTGCCCTTGAAATACTGGACAAAGCGATGTCAAACAC> AYAAAGCGATGTCAAA>

: . . . . . BTV6/net08 231-CAG.AAA.GCG.GAG.AAG.GCT.GCA.TTC.GCA.TCG.TAC.GCG.GAA.GCG.TTT.CGT.GAT.GAT.GTG/ 1-26 :--* --* *-+ --* --* --- --- -+- --- --+ --- +-* +*- *** *** --- --- --* --*/ TOV :--A --- --- --- --- --- --- -A- --- --- --- --A --- --- --- --- --- --- --A/ KUW :--A --- A-- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- ---/ A* O* H* H* L* L* R*

reverse OGP266 R P 245P 285R R-pan-S10

: : : : : : :

GCT GCA TTC GCA TCG TAC GC>
Fig. 2. Overview of primers and probes of Seg-10 panBTV PCR tests. The Seg-10 sequences of the regions of primers and probes are compared with that of BTV6/net08 (bold). Positions with genetic variability in BTV1-26 (NCBI Genbank); conserved (−), one mismatch per BTV in a 20-bps region (+), and >1 mismatch per BTV in a 20-bps-region (*). Differences in these regions for BTV25(TOV) and BTV26 (KUW) are shown. Forward and reverse primers (underlined) and probes (double underlined) and their orientation (arrowed) are indicated: A*; [7], L*; [9], R*; [10], O*; [8], H*; [3].

137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165

Virus BTV6(S10)B with eight silent mutations in highly conserved region 248-265is indistinguishable from BTV6 with respect to virus growth, whereas eight silent mutations in highly conserved region 1–45 was lethal (Fig. 2). Thus, region 1–45 is indeed an excellent target for the panBTV PCR test. Frontline diagnostic tests for Bluetongue must detect all BTV variants of known and unknown origin and sensitivity for new BTV variants have to be frequently checked [10]. Evidently, divergence in circulating BTV scan be assumed by genetic drifting. In particular, genetic variation can be expected in newly discovered BTV serotypes [3,4]. Sequences of newly proposed BTV serotypes TOV (BTV25) and KUW strain (BTV26) were checked for primers and probe regions, and showed one mismatch in the reverse primer and probe (Fig. 2). We therefore confirmed the detection of strain KUW (BTV26) and BTV1(S10)25 , the latter as representative of TOV (BTV25). We conclude that incursions ofBTV serotype 25 (TOV) and 26 (KUW) will be detected with the Seg-10 panBTV PCR test [10]. PCR tests are extremely sensitive and can occasionally detect inactivated BT vaccine for several days after vaccination [12,13]. False positive PCR results due to the use of inactivated BT vaccine will have significant economic impact in BT-free countries. Mutant B in inactivated BT vaccines (here as an example in infectious BTV6(S10)B ) will avoid positive PCR results after vaccination (Fig. 1, Table 2). Seg-10is freely exchangeable between BTVs by laboratory techniques as well as in nature [17,19]. Consequently, in nature mutant B in Seg-10 could be easily incorporated in virulent field viruses by reassortment resulting in virulent DIVA virus escaping from detection by Seg-10 panBTV PCR tests. Therefore, incorporation of genetic DIVA in replicating BT vaccines must be

strongly avoided in order to prevent exchange of mutant B with field BTV strains. In other words, use of this genetic DIVA approach is limited to inactivated BT vaccines. To generate desired DIVA vaccine viruses for master seeds, incorporation of mutated Seg-10 of mutant B can be easily combined with exchanging the serotype using reverse genetics as previously described [20]. Genetic DIVA in master seeds of BTV serotypes for production of inactivated BT vaccine is safe and will not interfere with production costs and efficacy of inactivated BT vaccines. Acknowledgements The authors would like to thank Dr. Carrie Batten (Pirbright Institute, UK) for providing BTV strain Kuwait (KUW, BTV26) and Prof. Polly Roy (London School of Hygienic and Tropical Medicine, UK) for the BSR cell line. PCR testing byEline Verheij, Mieke Maris-Veldhuis and Jan Boonstra is very appreciated. This research was funded by the Dutch Ministry of Economic Affairs, and EMIDA-project OrbiNet (CVI-project 1630031500). References [1] OIE. Manual of diagnostic tests and vaccines for terrestrial animals. 6th ed. Q2 Paris: OIE; 2006. [2] Mellor PS, Boorman J, Baylis M. Culicoides biting midges: their role as arbovirus vectors. Annu Rev Entomol 2000;45:307–40. [3] Hofmann MA, Renzullo S, Mader M, Chaignat V, Worwa G, Thuer B. Genetic characterization of toggenburg orbivirus, a new bluetongue virus, from goats, Switzerland. Emerg Infect Dis 2008;14:1855–61. [4] Maan S, Maan NS, Nomikou K, Batten C, Antony F, Belaganahalli MN, et al. Novel bluetongue virus serotype from Kuwait. Emerg Infect Dis 2011;17:886–9.

Please cite this article in press as: van Rijn PA, et al. Bluetonguevirus with mutated genome segment 10 to differentiate infected from vaccinated animals: A genetic DIVA approach. Vaccine (2013), http://dx.doi.org/10.1016/j.vaccine.2013.08.089

166 167 168 169 170 171 172 173 174

175

176 177 178 179 180 181 182

183

184 185 186 187 188 189 190 191 192

G Model JVAC 14623 1–4 4

193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217

ARTICLE IN PRESS P.A. van Rijn et al. / Vaccine xxx (2013) xxx–xxx

[5] ISID Promed mail. Bluetongue – Europe (1): Bluetongue, ovine, Netherlands, confirmed: ProMED-mail 2006. 0818.2311. http://www.promedmail.org; 2006 [18.08.06]. [6] Hoffmann B, Beer M, Reid SM, Mertens P, Oura CA, van Rijn PA, et al. A review of RT-PCR technologies used in veterinary virology and disease control: sensitive and specific diagnosis of five livestock diseases notifiable to the World Organisation for Animal Health. Vet Microbiol 2009;139(1–2):1–23. [7] Akita GY, Chinsangaram J, Osburn BI, Ianconescu M, Kaufman R. Detection of bluetongue virus serogroup by polymerase chain reaction. J Vet Diagn Invest 1992;4:400–5. [8] Orru G, Ferrando ML, Meloni M, Liciardi M, Savini G, De Santis P. Rapid detection and quantitation of bluetongue virus (BTV) using a molecular beacon fluorescent probe assay. J Virol Methods 2006;137:34–42. [9] Leblanc N, Rasmussen TB, Fernandez J, Sailleau C, Rasmussen LD, Uttenthal A, et al. Development of a real-time RT-PCR assay based on primer-probe energy transfer for the detection of all serotypes of bluetongue virus. J Virol Methods 2010;167:165–71. [10] van Rijn PA, Heutink RG, Boonstra J, Kramps HA, van Gennip RG. Sustained high-throughput polymerase chain reaction diagnostics during the European epidemic of Bluetongue virus serotype 8. J Vet Diagn Invest 2012;24: 469–78. [11] ISID Promed mail. Bluetongue—Europe (61): Netherlands, New Strain Susp. 20081018.3301. http://www.promedmail.org; 2008. [12] Steinrigl A, Revilla-Fernandez S, Eichinger M, Koefer J, Winter P. Bluetongue virus RNA detection by RT-qPCR in blood samples of sheep vaccinated with a commercially available inactivated BTV-8 vaccine. Vaccine 2010;28:5573–81.

[13] De Leeuw I, Garigliany M, Bertels G, Willems T, Desmecht D, De Clercq K, et al. Detection by real-time RT-PCR in post-vaccination samples from cattle. Transboundary Emerg Dis 2013, http://dx.doi.org/10.1111/tbed.12100. [14] Sato M, Tanaka H, Yamada T, Yamamoto N. Persistent infection of BHK21/WI2 cells with rubella virus and characterization of rubella variants. Arch Virol 1977;54:333–43. [15] Boyce M, Celma CC, Roy P. Development of reverse genetics systems for bluetongue virus: recovery of infectious virus from synthetic RNA transcripts. J Virol 2008;82:8339–48. [16] van Gennip RG, van de Water SG, Potgieter CA, Wright IM, Veldman D, van Rijn PA. Rescue of recent virulent and avirulent field strains of bluetongue virus by reverse genetics. PLoS ONE 2012;7(2):e30540. [17] van Gennip RG, Veldman D, van de Water SG, van Rijn PA. Genetic modification of Bluetongue virus by uptake of “synthetic” genome segments. Virol J 2010;7:261. [18] Toussaint JF, Sailleau C, Breard E, Zientara S, De Clercq K. Bluetongue virus detection by two real-time RT-qPCRs targeting two different genomic segments. J Virol Methods 2007;140:115–23. [19] Maan S, Maan NS, van Rijn PA, van Gennip RG, Sanders A, Wright IM, et al. Full genome characterisation of bluetongue virus serotype 6 from the Netherlands 2008 and comparison to other field and vaccine strains. PLoS ONE 2010;5(4):e10323. [20] van Gennip RG, van de Water SG, Maris-Veldhuis M, van Rijn PA. Bluetongue viruses based on modified-live vaccine serotype 6 with exchanged outer shell proteins confer full protection in sheep against virulent BTV8. PLoS ONE 2012;7(9):e44619.

Please cite this article in press as: van Rijn PA, et al. Bluetonguevirus with mutated genome segment 10 to differentiate infected from vaccinated animals: A genetic DIVA approach. Vaccine (2013), http://dx.doi.org/10.1016/j.vaccine.2013.08.089

218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243