BMP4 substitutes for loss of BMP7 during kidney development

Developmental Biology 286 (2005) 637 – 646 www.elsevier.com/locate/ydbio

Genomes & Developmental Control

BMP4 substitutes for loss of BMP7 during kidney development Leif Oxburgh 1, Andrew T. Dudley 2, Robert E. Godin 3, Chad H. Koonce, Ayesha Islam, Dorian C. Anderson 4, Elizabeth K. Bikoff *, Elizabeth J. Robertson * Wellcome Trust Center for Human Genetics, University of Oxford, Roosevelt Drive, Oxford OX3 7BN, UK Received for publication 14 June 2005, revised 29 July 2005, accepted 11 August 2005 Available online 8 September 2005

Abstract Functional inactivation of divergent bone morphogenetic proteins (BMPs) causes discrete disturbances during mouse development. BMP4deficient embryos display mesodermal patterning defects at early post-implantation stages, whereas loss of BMP7 selectively disrupts kidney and eye morphogenesis. Whether these distinct phenotypes simply reflect differences in expression domains, or alternatively intrinsic differences in the signaling properties of these ligands remains unknown. To address this issue, we created embryos exclusively expressing BMP4 under control of the BMP7 locus. Surprisingly, this novel knock-in allele efficiently rescues kidney development. These results demonstrate unequivocally that these structurally divergent BMP family members, sharing only minimal sequence similarity can function interchangeably to activate all the essential signaling pathways for growth and morphogenesis of the kidney. Thus, we conclude that partially overlapping expression patterns of BMPs serve to modulate strength of BMP signaling rather than create discrete fields of ligands with intrinsically different signaling properties. D 2005 Elsevier Inc. All rights reserved. Keywords: Bone morphogenetic protein; BMP; Kidney development

Introduction Bone morphogenetic proteins (BMPs), the largest subfamily of TGFh secreted growth factors, regulate cell growth, survival and differentiation throughout development (reviewed Chang et al., 2001; Hogan, 1996; Kingsley, 1994). On the basis of sequence similarity with prototypic Drosophila family members, vertebrate BMPs have been divided into two subgroups. These share approximately 30% identity at the amino acid level (Fig. 1A). The vertebrate BMP2 and BMP4 genes are functional orthologues of Drosophila Decapentaplegic (dpp). Thus, dpp mutant embryos can be rescued by human * Corresponding authors. E-mail addresses: [email protected] (E.K. Bikoff), [email protected] (E.J. Robertson). 1 Current address: Maine Medical Center Research Institute, 81 Research Drive, Scarborough, ME 04074, USA. 2 Current address: Northwestern University, 2205 Tech Drive, Hogan 2-100, Evanston, IL 60208, USA. 3 Current address: Astrazeneca Pharmaceuticals LP, 35 Gatehouse Drive, Waltham, MA 02451, USA. 4 Current address: Skirball Institute of Biomolecular Medicine, New York University Medical School, 540 First Avenue, New York, NY 10016, USA. 0012-1606/$ - see front matter D 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.ydbio.2005.08.024

BMP4 sequences (Padgett et al., 1993), and DPP can induce endochondral bone formation in rats (Sampath et al., 1993). On the other hand, the vertebrate BMPs 5, 6, 7 and 8 and the fly ligand Glass bottom boat-60A (gbb) constitute a distinct sub-group. In Drosophila, signaling activities of dpp and gbb are context dependent. Thus, GBB and DPP signals are synergistic during wing morphogenesis, while having antagonistic effects in the developing midgut (Khalsa et al., 1998; Wharton et al., 1999). The conservation of these two BMP sub-groups across a wide phylogenetic distance suggests that different ligands may have unique functions during embryogenesis. The concentration of available ligand at the cell surface is interpreted by a receptor complex containing type I (ALK) and type II serine/threonine receptor kinases. Of the seven receptors that have been identified, ALK 2, 3 and 6 transduce BMP signals, but individual BMP family members bind these receptors with varying efficiencies. For example, BMP7 binds ALK2 and 6 with high affinity, whereas BMP2 and BMP4 preferentially bind ALK3 and 6 (ten Dijke et al., 1994). The activated BMP receptors phosphorylate Smad 1, 5 and 8 downstream effectors that oligomerize with Smad4, and translocate to the nucleus to regulate the activity of target genes

638

L. Oxburgh et al. / Developmental Biology 286 (2005) 637 – 646

(reviewed Massague´, 1998). Numerous studies have shown that different BMP ligands can elicit diverse biological responses in vitro. For example, different effects were observed

by culturing kidney explants with recombinant proteins (Piscione et al., 1997). BMP7 stimulates branching of collecting ducts at low concentrations while high concentra-

L. Oxburgh et al. / Developmental Biology 286 (2005) 637 – 646

tions cause inhibitory effects. In contrast, treatment with BMP2 and/or BMP4 consistently inhibits branching. The present experiments were designed to test whether these distinct functional activities are due to divergent signaling properties mediated by different ligands. Despite widespread BMP7 expression throughout the early mouse embryo, BMP7 functional loss causes highly focal defects. Thus, BMP7-deficient embryos display partially penetrant anopthalmia and fully penetrant kidney dysplasia (Dudley et al., 1995; Luo et al., 1995). These abnormalities are restricted to tissues that exclusively express BMP7, namely the lens placode and metanephric mesenchyme, while other tissues, such as the notochord, surface ectoderm and heart, that exhibit overlapping expression of BMP family members (Dudley and Robertson, 1997) develop normally. The BMP7 phenotype is greatly exacerbated in embryos lacking either BMP5 (Solloway and Robertson, 1999) or BMP6 (Kim et al., 2001). These findings demonstrate that there is considerable functional redundancy among closely related BMPs in the intact embryo. Because of the extensive documentation and characterization of BMPs in the developing kidney, this model system offers the opportunity to test whether structurally divergent BMP family members have unique signaling capabilities or share functionally interchangeable roles during development. The BMP substitution experiments described in the present report were designed to directly evaluate this possibility. Materials and methods Generation of Myc tagged BMP cDNAs An NaeI – BglI fragment corresponding to the entire proregion of BMP7, the proteolytic cleavage site and part of the N-terminus of the mature ligand, was subcloned from full length BMP7 cDNA. To facilitate detection of the targeted locus, an oligo encoding the myc epitope tag (tggagcagaagctgatatccgaggaggacctggccagtg) was annealed with its complement and ligated into the BglI site, generating the vector pBmp7 – 5V. Ligation results in the preservation of the BglI restriction site only on the 3V end of the inserted sequence. Sequence encoding the cysteine knot region of BMP7 was isolated by PCR amplification and cloned into the EcoRI – XbaI sites of pBSII KS+, generating pBmpCys. To reconstitute the BMP7 ORF containing a myc tag, pBmp7 – 5V (SpeI – BglI) and pBmpCys (BglI – XbaI) were ligated into pBSII KS+ digested with SpeI – XbaI. Following sequence verification, the modified BMP7 ORF was isolated by digestion with SpeI – XbaI and ligated into the SpeI site of pBmp7xbs. To insert the cysteine knot encoding sequence from BMP6 into pBmp7xbs, we used pBmpCys as a shuttle vector. The cysteine knot region from BMP6 was PCR amplified using a forward primer in which the 6th nucleotide of an Eco47III restriction site was the 1st nucleotide of the initial cysteine codon, and a reverse primer that placed an XbaI restriction site 3V to the stop codon. The amplicons were digested with Eco47III – XbaI and

639

ligated into pBmpCys that was previously digested with StuI – XbaI. These chimeric mature regions were ligated to pBmp7 – 5V and into pBmp7xbs as described above. The constructs were verified by sequencing. The full-length myc tagged BMP4myc4 construct was as described (Constam and Robertson, 1999).

COS-7 cell transfection and Western blot analysis cDNAs were cloned into the eukaryotic expression vector pMT1 and transfected into COS cells using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. Full-length and processed proteins were detected by Western blot analysis of COS cell supernatant and cell pellets as described previously (Constam and Robertson, 1999). Lysates of E11.5 embryonic heads were prepared by trituration of entire embryonic heads through a hypodermic needle in 1 ml of SDS-PAGE loading buffer (Harlow and Lane, 1988) containing Roche Mini protease inhibitor at the concentration recommended by the manufacturer. Equal protein loading between lanes was verified by Ponceau S staining of nitrocellulose filters (Harlow and Lane, 1988) prior to immunodetection using the 4A6 anti-myc monoclonal antibody (Upstate).

Generation of targeted alleles To generate a generic vector enabling expression of cDNA constructs from the endogenous BMP7 locus, the previously described targeting vector (Godin et al., 1998) was digested with SpeI and additional polylinker sequence introduced to give 5V-NgoMI – EcoRI – SpeI – XhoI – ClaI – SphI – PmeI – SalI – NcoI-3V. An SV40 intron/polyadenylation sequence was inserted in the PmeI site to provide a transcriptional termination signal for proper gene expression and a loxP flanked PGK-hygromycin selection cassette was inserted into the SalI site for positive selection of targeted clones, generating the vector Bmp7xbs. ORFs corresponding to BMP7myc7 and BMP7myc6 were isolated from their respective plasmids with SpeI – XbaI and ligated into SpeI digested pBmp7xbs. These targeting vectors were linearized with NotI and introduced into CCE embryonic stem cells. The lox-P flanked hygro cassette was removed from correctly targeted cells by Cre-mediated excision. ES cell clones and mice resulting from injection of these cells were genotyped as previously described (Godin et al., 1998).

RNA analysis Total RNA was isolated from E11.0 and 6 week kidneys using Trizol (Invitrogen) according to manufacturer’s instructions. RNase protection probes were designed to span the myc tag to distinguish the wild-type and chimeric versions of the BMPs: probe A is a 225-bp StuI fragment subcloned from the BMP7myc7 cDNA. Probe B is a 370-bp PvuI – StuI fragment subcloned from the BMP4myc4 cDNA. Probe C, specific for exons 5 and 6 of BMP7 encoding the 3V untranslated region, was generated by subcloning a PCR-generated fragment consisting of nucleotides 1164 to 1618. As the inserted cDNAs do not contain 3V UTR sequence, this probe specifically detects endogenous BMP7 transcripts. Templates were transcribed using the Promega transcription kit and RNase protection analysis was performed using the Ambion RPAIII kit following manufacturer’s protocol. RT-PCR was performed as described (Oxburgh and Robertson, 2002). Oligonucleotides used were: BMP7 (Oxburgh and Robertson, 2002), 7myc7:5V-AAAACAGCAGCAGTGACCAGAGGC, 5VTAGAGGACAGAGATGGCGTTGAG, 7myc6: CAAGACGCCAAAGAAC-

Fig. 1. The bone morphogenetic proteins (BMP) represent a distinct subfamily of TGFh ligands. (A) Based on sequence and functional similarities to prototypic Drosophila members, vertebrate BMPs have been classified into two subgroups: the dpp cluster includes BMP2 and BMP4, whereas the gbb-60A cluster is comprised of BMP5, BMP6 and BMP7. (B) Structural comparisons. The conserved cysteines characteristic of all TGFh related mature ligands are marked with asterisks. BMP7 and BMP6, both members of the 60A sub class display 53% identity whereas BMP7 and BMP4 only display 29% identity. Overall within the mature ligand BMP7 and BMP6 show 69% identity, whereas BMP7 and BMP4 show 44% identity. The vertical line at nucleotide 415 denotes the junction between BMP7 and BMP6 sequences in the BMP7myc6 chimeric protein. The coding sequence is thus predominantly from BMP6 in this protein. The identity between BMP7 and BMP6 is 87%. Proteolytic cleavage sites are denoted by arrowheads. BMP7 and BMP6 contain one (shown above sequence), whereas BMP4 contains two alternative start sites (shown below sequence). Phylogenetic analysis and sequence alignment were performed using the Macvector software package (Accelrys.com).

640

L. Oxburgh et al. / Developmental Biology 286 (2005) 637 – 646

CAAGAG, GGGATTCATAAGGTGGACCAAGG, 4myc4: 5V-CCAACACTGTGAGGAGTTTCCATC, 5V-TCCAGGTCCTCCTCGGATATC A.

Histological analysis For Hematoxylin and Eosin (H&E) staining, in situ hybridization and immunohistochemistry, tissues were fixed in 4% paraformaldehyde in PBS, dehydrated, embedded in paraffin wax, and sectioned at 6 Am. H&E staining was performed using standard procedures. For X-Gal staining, whole tissues were fixed for 90 min in 0.5% glutaraldehyde/1% paraformaldehyde in PBS and staining was performed as described (Godin et al., 1998).

Results We used gene targeting to introduce full length cDNAs encoding BMP7, BMP4 or a chimeric BMP7/6 protein into the BMP7 locus (Fig. 2A). A similar strategy was used previously to create the BMP7 h-galactosidase reporter allele (Godin et al., 1998), where insertion of the LacZ cassette into the first coding exon of BMP7 resulted in deletion of 263 bases including the endogenous translational start site, while preserving the endogenous transcriptional regulatory elements, to create a null reporter allele expressing LacZ under control of the BMP7 locus. To distinguish the introduced cDNAs from the endogenous product the sequences were modified to

include a myc tag as shown in Fig. 2B. As for myc-tagged dorsalin and BMP4 (Basler et al., 1993; Constam and Robertson, 1999), the myc epitope was inserted C-terminal to the proteolytic cleavage site of the mature protein allowing detection of both mature and unprocessed forms. Recombinant myc-tagged versions of dorsalin and myc-BMP4 were previously shown to have activity in functional assays (Basler et al., 1993; Constam and Robertson, 1999). Biologically active TGF-h ligands are produced by a highly regulated process that includes synthesis of an inactive pro-protein and cleavage by prohormone convertases to generate two peptides, the Nterminal prodomain and the C-terminal ligand domain (Constam and Robertson, 1999; Cui et al., 2001). Although the prodomain is not required for signaling, it is an important component that controls the bioavailability of mature ligands (Gray and Mason, 1990; Thomsen and Melton, 1993). For example, fusion proteins comprised of the prodomain of the TGF-h family members BMP2 or Activin, and the BMP4 ligand domain are more efficiently cleaved and promote a greater accumulation of the mature signaling domain in the extracellular space than native molecules (Hammonds et al., 1991; Jones et al., 1996). In addition, the associated prodomain regulates the range of secreted ligand activity (Jones et al., 1996). These effects may be due, in part, to increased stability

Fig. 2. (A) Targeting strategy used for generation of swap alleles expressing BMP subfamily members under control of the BMP7 locus. (B) The BMP7myc7, BMP7myc6 and BMP4myc4 cDNA expression cassettes are shown in black, red and blue respectively. The position of the myc epitope tag is represented by the grey box. The arrowhead denotes the proteolytic cleavage site giving rise to the mature ligand. RNase protection probes are shown below the cDNA sequences. Probe A spans the myc epitope tag and protects both BMP7myc7 and BMP7myc6 sequences. Probe B is specific for BMP4myc4 transcripts. (C) Western blot analysis. Transfected COS cells expressing 7myc7, 7myc6 or 4myc4 produced precursor (pre) and/or mature (mat) ligands detectable in cell pellets (pel) or culture supernatants (sup) using a myc monoclonal antibody. (D) Southern blot analysis. Genomic DNA from wild-type (BMP7 +/+ ), and BMP7 +/7myc7 , BMP7 +/7myc6 or BMP7 +/4myc4 mice was digested with EcoR1 and hybridized with the 5V flanking probe.

L. Oxburgh et al. / Developmental Biology 286 (2005) 637 – 646

of the ligand in the presence of the prodomain (Constam and Robertson, 1999). Thus, another important consideration in the design of our targeting experiments was to ensure that the novel alleles could give rise to mature biologically active ligand. Therefore, we initially tested expression of each cDNA construct in transfected COS cells. As expected, we also observe here constitutive processing of myc-tagged BMPs in COS cells (Fig. 2C) except that the construct encoding myctagged BMP6 yielded only the intact precursor (data not shown). For this reason, we introduced the cDNA encoding a chimeric BMP7myc6 protein that was efficiently expressed and appropriately processed into the BMP7 locus. These cDNA cassettes along with SV40 intron/poly adenylation sequences to provide a translational stop site and a loxP flanked PGK-hygro selection vector were inserted into BMP7 exon 1. Correctly targeted ES cell clones obtained using all three vectors were Cre-excised and used to generate novel germ line alleles. Initially, as a control, we generated mice expressing BMP7myc7 cDNA from the BMP7 gene. To assess mRNA expression from the modified locus, we used an RNase protection assay that discriminates between BMP7myc7 and endogenous BMP7 transcripts. As shown in Fig. 3A, in heterozygous embryos,

641

endogenous BMP7 transcripts are present at approximately 50% of wild-type levels, whereas homozygous mice exclusively express BMP7myc7 transcripts. In addition, the level of BMP7myc7 expression in BMP7 7myc7/7myc7 kidneys is approximately equal to that of the endogenous BMP7 transcript. Homozygous animals that exclusively express myc-tagged BMP7 were indistinguishable from wild type littermates. These mutants are viable and fertile. Thus, myc-tagged BMP7 functions perfectly well in vivo. Next, we produced mice expressing BMP4myc4 or BMP7myc6 cDNAs. As shown in Fig. 3B, heterozygous BMP7 +/4myc4 and BMP7 +/7myc6 adult kidneys express unique transcripts detectable with BMP4myc4- and BMP7myc6-specific RPA probes respectively. The initial induction of the metanephric mesenchyme takes place at E11.0, and endogenous BMP7 transcripts are expressed from this stage onwards (Dudley and Robertson, 1997). To demonstrate expression of the knock-in allele at earlier stages, we also performed RT-PCR analyzing BMP7 +/7myc7 , BMP7 +/7myc6 and BMP7 +/4myc4 E11.0 embryonic kidneys, respectively (Fig. 3C). We found BMP7myc7, BMP7myc6 and BMP4myc4 transcripts were expressed in the metanephros (Fig. 3C). Thus, we conclude

Fig. 3. Characterization of transcripts arising from knock-in BMP7 alleles. (A) Probe C spanning the 3V side of the BMP7 open reading frame and untranslated region (UTR) distinguishes endogenous BMP7 transcripts (456 nt) from those arising from the introduced BMP7myc7 cDNA (233 nt). RNA from adult kidney tissues was analyzed. Homozygous BMP 7myc7/7myc7 mutants abundantly express BMP7myc7 transcripts but lack wild-type mRNA. (B) Probe A specifically protects BMP7myc7 and BMP7myc6 transcripts expressed by BMP7 +/7myc7 and BMP7 +/7myc6 kidneys, and Probe B selectively protects BMP4myc4 mRNA produced by BMP7 +/4myc4 kidneys. (C) Transcripts arising from the knock-in alleles are appropriately expressed at earlier stages in the developing kidney. RNA from wild-type (BMP7 +/+ ), BMP7 +/7myc7 , BMP7 +/7myc6 and BMP7 +/4myc4 E11.0 kidneys was subjected to RT-PCR using primer pairs specific for 7myc7, 7myc6 and 4myc4, respectively.

642

L. Oxburgh et al. / Developmental Biology 286 (2005) 637 – 646

that the BMP7 +/7myc7 , BMP7 +/7myc6 and BMP7 +/4myc4 knockin alleles appropriately express the introduced cDNAs and entirely lack endogenous BMP7 transcripts. To test the ability of BMP7myc6 and/or BMP4myc4 to rescue kidney development, we crossed the knock-in alleles to heterozygous mice carrying the BMP7 LacZ reporter allele (BMP7 +/lacZ ), and analyzed double heterozygous embryos. In these reporter mice, LacZ expression delineates the collecting duct system and nephrogenic mesenchyme of the developing kidney as well as structures of the mature nephron, such as distal tubules and glomerular podocytes. As shown in Fig. 4A, in E14.5 BMP7 +/lacZ embryos kidney development is overtly normal with appropriate branching of collecting ducts, renewal and differentiation of mesenchyme evident at the periphery of the kidney, and a variety of differentiated structures such as glomeruli present in more central regions. Homozygous null BMP7 lacZ/lacZ kidneys display developmental defects as described previously (Godin et al., 1998). The overall organ size is significantly reduced. We also observe a paucity of nephrogen-

esis at the periphery of the kidney, and noticeable cyst formation (Fig. 4B). In contrast (Fig. 4C), the BMP7 lacZ/7myc7 kidneys display wild-type kidney morphogenesis. Expression of the closely related BMP7/6 ligand similarly rescues kidney development (Fig. 4D). Surprisingly, BMP7 lacZ/4myc4 kidneys exclusively expressing the divergent dpp-like ligand BMP4 also develop normally (Fig. 4E). Extensive histological analysis of E14.5 BMP7 lacZ/4myc4 kidneys failed to reveal any tissue abnormalities. We therefore conclude that structurally divergent BMP family members function interchangeably during kidney organogenesis. BMP7, normally expressed in both the surface ectoderm and neuroepithelium of the optic cup, is also required to promote lens placode development and eye morphogenesis. BMP7deficient embryos show a range of eye phenotypes according to genetic background, from complete deterioration of the forming eye structure, to a small percentage of cases of microopthalmia (Dudley et al., 1995; Luo et al., 1995; Wawersik et al., 1999). We found that eye development proceeds normally in

Fig. 4. BMP4 and BMP6 substitute for loss of BMP7 during kidney development. To more readily visualize the collecting ducts, nephrogenic mesenchyme and glomerular podocytes at E14.5, BMP7 +/7myc7 , BMP7 +/7myc6 and BMP7 +/4myc4 mice were crossed to BMP7 lacZ/+ animals. Whole mounts and histological sections were photographed at the same magnification. (A) Heterozygous BMP7 +/lacZ h-galactosidase reporter mice display normal kidney development. (B) Homozygous BMP7 lacZ/lacZ mutants display characteristic loss of function phenotype, namely dysplasia with associated hydroureter. (BV) Histological sections reveal characteristic premature depletion of nephrogenic mesenchyme. Mature structures such as glomeruli and associated tubules are however still formed. Expression of BMP7myc7 (C, CV), BMP7myc6 (D, DV) or BMP4myc4 (E, EV) efficiently rescues kidney development. CD: Collecting duct, G: Glomerulus, NM: Nephrogenic mesenchyme.

L. Oxburgh et al. / Developmental Biology 286 (2005) 637 – 646

643

Fig. 5. The BMP7 4myc4 allele does not rescue eye development in BMP7 null animals BMP7 +/7myc7 , BMP7 +/7myc6 and BMP7 +/4myc4 mice were crossed to BMP7 +/lacZ animals and embryonic eyes were photographed at E14.5. (A) Wild-type eye. (B) BMP7 null mice display variable uni- or bilateral eye defects ranging from agenesis to microphthalmia. (C) BMP4myc4 does not rescue eye development whereas BMP7myc7 and BMP7myc6 do (D, E). (F) Western blot using an antibody specific for the myc tag to detect the expression of BMP4myc4, BMP7myc7 and BMP7myc6 in lysates of E11.5 embryonic heads. Expression of myc-tagged protein is detected in BMP7 +/7myc7 and BMP7 +/7myc6 heads, whereas no tagged protein is detectable in BMP7 +/4myc4 heads.

BMP7 lacZ/7myc7 and BMP7 lacZ/7myc6 embryos but in striking contrast BMP7 lacZ/4myc4 embryos display bilateral microopthalmia at day 14.5 (Fig. 5). In seeking to explain why the BMP7 +/4myc4 allele fails to reconstitute BMP7 signaling during eye morphogenesis we found the simplest explanation to be that ligand expression levels from the novel knock-in allele might be sub-optimal. To test this, lysates prepared from 11.5 dpc embryonic heads were analyzed by Western blot using an anti-myc antibody. As shown in Fig. 5F, BMP7myc7 and BMP7myc6 precursor proteins were expressed but there was no detectable BMP4myc4 protein produced by the BMP7 4myc4 allele. The lack of normal lens placode formation thus probably reflects reduced expression levels. Discussion BMP7 signaling is specifically required during nephrogenesis for renewal of the mesenchyme progenitor population. By E12.5 loss of BMP7 expression results in ectopic cell death at the periphery of the kidney and premature depletion of nephrogenic mesenchyme (Dudley et al., 1995; Dudley and Robertson, 1997; Luo et al., 1995). Conditional inactivation of Smad4, a central intracellular effector of BMP/TGFh signaling, in BMP7 expressing cells using a BMP7.Cre deleter strain similarly leads to disorganization of the nephrogenic mesenchyme and impairment of mesenchyme induction (Oxburgh et

al., 2004). The Smad4-deficient mesenchyme fails to tightly aggregate around the tips of the ureteric buds, and instead remains intermixed with stromal cells at the periphery of the kidney. These findings strongly suggest that BMP7 acts in an autocrine fashion to promote survival of the nephrogenic mesenchyme. The present experiments demonstrate that BMP6, a gbb family member, as well as BMP4 belonging to the dpp sub-group, can functionally substitute for BMP7. Thus structurally divergent BMP family members can activate a Smad4-dependent signaling pathways that control proliferation and induction of the mesenchyme. Previous studies in vertebrates suggested that functional interchangeability between the dpp and 60A sub-groups depends on the experimental system employed. For example, BMP7 but not BMP2 could rescue isolated metanephric mesenchyme from apoptosis and induce expression of specific genes (Vukicevic et al., 1996) whereas both BMP7 and BMP4 induced expression of msx, slug and hnk-1 in chick neural plate explant cultures (Liem et al., 1995). On the other hand, genetic analysis argues that closely related BMPs are functionally redundant in vivo. Strikingly, BMP5 and BMP6 are both expressed from early post-implantation stages onwards (Solloway and Robertson, 1999). Loss of either gene fails to disrupt development (Kingsley et al., 1992; Solloway et al., 1998). Similarly BMP7 is widely expressed in the early embryo but is essential only at later stages to promote kidney and eye

644

L. Oxburgh et al. / Developmental Biology 286 (2005) 637 – 646

morphogenesis (Dudley et al., 1995; Luo et al., 1995). Compound mutant embryos lacking BMP5 and BMP7 (Solloway and Robertson, 1999), or BMP6 and BMP7 (Kim et al., 2001) exhibit greatly exacerbated phenotypes and die by midgestation. Here, we demonstrate that BMP6 signaling fully substitutes for BMP7 during development of the kidney. BMP7 and BMP6 are so closely related that this outcome was expected. However, we also found that BMP4 can substitute for BMP7 in the developing kidney. The present results demonstrate unequivocally that these structurally divergent BMP family members, sharing only minimal sequence similarity can function interchangeably to activate all the essential signaling pathways for growth and morphogenesis of the kidney. However, in contrast to the kidney, BMP4 fails to rescue the eye defects associated with loss of BMP7. BMP4 and BMP7 are expressed in overlapping domains in the developing eye (Dudley and Robertson, 1997), with BMP7 being uniquely expressed in the surface ectoderm that gives rise to the lens placode. Loss of either ligand leads to defects in eye morphogenesis (Dudley et al., 1995; Furuta and Hogan, 1998; Luo et al., 1995). The variable penetrance of the eye defects in BMP7-deficient mice (Dudley et al., 1995; Wawersik et al., 1999) suggests that lens placode induction and maintenance is acutely dependent on BMP7 levels. Thus, in (129x C57/BL6)F1 embryos, the majority of animals (60%) display bilateral anophthalmia due to early loss of the lens vesicle that forms normally from the surface ectoderm overlying the optic cup but is not maintained. The remaining animals are microphthalmic. In a C3H background, the mutant phenotype is more severe and the lens placode fails to invaginate (Wawersik et al., 1999). Previous studies have shown that BMP7 signaling is required to maintain expression of the transcription factor Pax6 in the lens placode (Wawersik et al., 1999). Significantly Pax6 gene dosage is also critical for proper eye development (Glaser et al., 1994; Schedl et al., 1996). Sub-optimal expression of BMP4 within the BMP7 domain is probably insufficient to maintain Pax6 and/or other target gene levels necessary to sustain lens development. The structurally divergent Drosophila ligands signal via distinct intracellular pathways that synergistically pattern the developing embryo (reviewed Podos and Ferguson, 1999). Thus, DPP acts via both the TVK or SAX type I receptor, while GBB signals predominantly via the SAX receptor (reviewed Podos and Ferguson, 1999). Moreover, genetic experiments provide important insights into the action of a single ligand, DPP, in patterning fields of cells. The requirement for synergistic signaling requires interactions between two distinct ligand receptor pairs, namely those comprised of TKV or SAX, to specify the full range of positional values (Haerry et al., 1998; Neul and Ferguson, 1998; Nguyen et al., 1998). These observations suggest that TKV and SAX activate distinct pathways at selected tissue sites. By contrast in another setting, the wing disc, cooperative signaling between DPP and GBB appears to result by the engagement of similar receptor complexes, that act additively (Ray and Wharton, 2001). Recent evidence also suggests that heterodimers between DPP

and the more divergent BMP-type ligand SCREW signal synergistically and robustly via TVK and SAX to pattern the D –V axis of the blastoderm (Shimmi et al., 2005). Tissue specific rescue described in the present study may partly reflect the distribution of the various type I ALK receptors. ALK2, ALK3 and ALK6 dimerize with the BMPR2 type II receptor to mediate signaling by BMPs, but complexes appear to display varying affinities for different BMP ligands (ten Dijke et al., 1994). Thus, biochemical experiments suggest that BMP4 binds with high affinity to ALK3 while BMP7 binds preferentially to ALK2. One possibility is that the type I receptors may work interchangeably. However, functional loss of either ALK2 (Gu et al., 1999; Mishina et al., 1999) or ALK 3 (Mishina et al., 1995) leads to early but distinct embryonic lethal phenotypes suggesting that these surface receptors transduce the activities of unique combinations of ligands during early development. The inability of BMP4 to rescue BMP7-dependent eye morphogenesis may also depend on the repertoire and stoichiometry of the receptor complexes. Expression of ALK3 the preferred BMP4 type I receptor in the lens placode progenitor population has been characterized (Furuta and Hogan, 1998). Both ALK2 and ALK3 are known to be expressed in the developing kidney (Oxburgh et al., 2004) but their distribution within the various cell populations including the mesenchyme population has yet to be described. Our work establishes that receptor occupancy by either BMP4 or BMP7 activates the same signaling pathways in the kidney. TGFh-related ligands have been shown to activate Smad effectors and consequently target gene expression in a dosedependent fashion. Thus, activin signaling thresholds in Xenopus result from varying degrees of receptor occupancy at the cell surface (Dyson and Gurdon, 1998). Dose-dependent Smad2 phosphorylation in turn differentially modulates target gene expression; thus low levels of activin are sufficient to activate Xbra while higher levels are required to induce Xgsc. Similarly in Drosophila a gradient of phospho-MAD levels generated via DPP signalling differentially activates BMP responsive genes. We have previously shown that genetically altering Smad2 and Smad3 expression levels in the mouse embryo results in dose-dependent patterning defects during gastrulation (Dunn et al., 2005; Dunn et al., 2004). In osteoclast differentiation assays, ALK2 and ALK3 act synergistically to induce higher transcriptional activity than either receptor alone (Aoki et al., 2001). Similarly, kidney explant cultures treated with increasing concentrations of recombinant BMPs display distinctive cell growth characteristics (Piscione et al., 1997). Recent studies have also shown that BMP ligands regulate mitogen activated protein kinase pathways. Differing concentrations of BMP7 ligand can influence activation of the non-canonical MAPK mediated versus the canonical Smaddependent pathways in cultured kidney cells (Hu et al., 2004). BMP4 maintains self-renewal properties of embryonic stem cells via inhibition of p38 and ERK-activated MAPK responses (Qi et al., 2004). Differential expression of target genes probably depends on the spatial organization and different affinities of multiple Smad binding sites, acting cooperatively.

L. Oxburgh et al. / Developmental Biology 286 (2005) 637 – 646

Indeed, analysis of the promoter region of mouse Msx1, a gene regulated by BMP signaling, reveals multiple Smad binding sites comprised of Mad-type sites (consensus GCCGnCG) and Smad-binding elements (SBE; consensus GTCTAGAC) (Alvarez Martinez et al., 2002). Mutational analysis of the SBE consensus sequence revealed that single nucleotide changes dramatically affect Smad binding. Moreover, Smad5 binds more strongly to this sequence than either Smad1 or Smad8. Smads show distinctive tissue specific expression patterns in the developing embryo (Dick et al., 1998; Flanders et al., 2001). Thus, both the repertoire and relative abundance of Smad proteins may serve to amplify and refine cellular responses to divergent BMPs. It will be interesting to learn more about how shifting ratios of Smad1, 5 and 8 activities can differentially regulate discrete target genes in various cell populations during early mouse development. Acknowledgments We would like to thank Debbie Pelusi for genotyping assistance and Drs Daniel Constam and Ray Dunn for insightful comments on the work. L. O. was supported by a fellowship from the Wenner-Gren Foundation. This work was supported by a grant from the NIH to E. J. R. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.ydbio.2005.08.024. References Alvarez Martinez, C.E., Binato, R., Gonzalez, S., Pereira, M., Robert, B., Abdelhay, E., 2002. Characterization of a Smad motif similar to Drosophila mad in the mouse Msx 1 promoter. Biochem. Biophys. Res. Commun. 291, 655 – 662. Aoki, H., Fujii, M., Imamura, T., Yagi, K., Takehara, K., Kato, M., Miyazono, K., 2001. Synergistic effects of different bone morphogenetic protein type I receptors on alkaline phosphatase induction. J. Cell Sci. 114, 1483 – 1489. Basler, K., Edlund, T., Jessell, T.M., Yamada, T., 1993. Control of cell pattern in the neural tube: regulation of cell differentiation by dorsalin-1, a novel TGF beta family member. Cell 73, 687 – 702. Chang, H., Lau, A.L., Matzuk, M.M., 2001. Studying TGF-beta superfamily signaling by knockouts and knockins. Mol. Cell. Endocrinol. 180, 39 – 46. Constam, D.B., Robertson, E.J., 1999. Regulation of bone morphogenetic protein activity by pro domains and proprotein convertases. J. Cell Biol. 144, 139 – 149. Cui, Y., Hackenmiller, R., Berg, L., Jean, F., Nakayama, T., Thomas, G., Christian, J.L., 2001. The activity and signaling range of mature BMP-4 is regulated by sequential cleavage at two sites within the prodomain of the precursor. Genes Dev. 15, 2797 – 2802. Dick, A., Risau, W., Drexler, H., 1998. Expression of Smad1 and Smad2 during embryogenesis suggests a role in organ development. Dev. Dyn. 211, 293 – 305. Dudley, A.T., Robertson, E.J., 1997. Overlapping expression domains of bone morphogenetic protein family members potentially account for limited tissue defects in BMP7 deficient embryos. Dev. Dyn. 208, 349 – 362. Dudley, A.T., Lyons, K.M., Robertson, E.J., 1995. A requirement for bone morphogenetic protein-7 during development of the mammalian kidney and eye. Genes Dev. 9, 2795 – 2807. Dunn, N.R., Vincent, S.D., Oxburgh, L., Robertson, E.J., Bikoff, E.K., 2004.

645

Combinatorial activities of Smad2 and Smad3 regulate mesoderm formation and patterning in the mouse embryo. Development 131, 1717 – 1728. Dunn, N.R., Koonce, C.H., Anderson, D.C., Islam, A., Bikoff, E.K., Robertson, E.J., 2005. Mice exclusively expressing the short isoform of Smad2 develop normally and are viable and fertile. Genes Dev. 19, 152 – 163. Dyson, S., Gurdon, J.B., 1998. The interpretation of position in a morphogen gradient as revealed by occupancy of activin receptors. Cell 93, 557 – 568. Flanders, K., Kim, E.S., Roberts, A.B., 2001. Immunohistochemical expression of smads 1 – 6 in the 15-day gestation mouse embryo: signaling by BMPs and TGF-bs. Dev. Dyn. 220, 141 – 154. Furuta, Y., Hogan, B.L.M., 1998. BMP4 is essential for lens induction in the mouse embryo. Genes Dev. 12, 3764 – 3775. Glaser, T., Jepeal, L., Edwards, J.G., Young, S.R., Favor, J., Maas, R.L., 1994. PAX6 gene dosage effect in a family with congenital cataracts, aniridia, anophthalmia and central nervous system defects. Nat. Genet. 7, 463 – 471. Godin, R.E., Takaesu, N.T., Robertson, E.J., Dudley, A.T., 1998. Regulation of BMP7 expression during kidney development. Development 125, 3473 – 3482. Gray, A.M., Mason, A.J., 1990. Requirement for activin A and transforming growth factor beta 1 pro-regions in homodimer assembly. Science 247, 1328 – 1330. Gu, Z., Reynolds, E.M., Song, J., Lei, H., Feijen, A., Yu, L., He, W., MacLaughlin, D.T., van den Eijnden-van Raaij, J., Donahoe, P.K., Li, E., 1999. The type I serine/threonine kinase receptor ActRIA (ALK2) is required for gastrulation of the mouse embryo. Development 126, 2551 – 2561. Haerry, T.E., Khalsa, O., O’Connor, M.B., Wharton, K.A., 1998. Synergistic signaling by two BMP ligands through the SAX and TKV receptors controls wing growth and patterning in Drosophila. Development 125, 3977 – 3987. Hammonds, R.J., Schwall, R., Dudley, A., Berkemeier, L., Lai, C., Lee, J., Cunningham, N., Reddi, A.H., Wood, W.I., Mason, A.J., 1991. Boneinducing activity of mature BMP-2b produced from a hybrid BMP-2a/2b precursor. Mol. Endocrinol. 5, 149 – 155. Harlow, E., Lane, D., 1988. Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory, New York. Hogan, B.L.M., 1996. Bone morphogenetic proteins: multifunctional regulators of vertebrate development. Genes Dev. 10, 1580 – 1594. Hu, M.C., Wasserman, D., Hartwig, S., Rosenblum, N.D., 2004. p38MAPK acts in the BMP7-dependent stimulatory pathway during epithelial cell morphogenesis and is regulated by Smad1. J. Biol. Chem. 279, 12051 – 12059. Jones, C.M., Armes, N., Smith, J.C., 1996. Signalling by TGF-beta family members: short-range effects of Xnr-2 and BMP-4 contrast with the longrange effects of activin. Curr. Biol. 6, 1468 – 1475. Khalsa, O., Yoon, J.W., Torres-Schumann, S., Wharton, K.A., 1998. TGFbeta/BMP superfamily members, Gbb-60A and Dpp, cooperate to provide pattern information and establish cell identity in the Drosophila wing. Development 125, 2723 – 2734. Kim, R.Y., Robertson, E.J., Solloway, M.J., 2001. Bmp6 and Bmp7 are required for cushion formation and septation in the developing mouse heart. Dev. Biol. 235, 449 – 466. Kingsley, D.M., 1994. The TGF-beta superfamily: new members, new receptors, and new genetic tests of function in different organisms. Genes Dev. 8, 133 – 146. Kingsley, D.M., Bland, A.E., Grubber, J.M., Marker, P.C., Russell, L.B., Copeland, N.G., Jenkins, N., 1992. The mouse short ear skeletal morphogenesis locus is associated with defects in a bone morphogenetic member of the TGFb Superfamily. Cell 71, 399 – 410. Liem, K.F., Tremml, G., Roelink, H., Jessel, T.M., 1995. Dorsal differentiation of neural plate cells induced by BMP-mediated signals from epidermal ectoderm. Cell 82, 969 – 979. Luo, G., Hofmann, C., Bronckers, A.L.J.J., Sohocki, M., Bradley, A., Karsenty, G., 1995. BMP-7 is an inducer of nephrogenesis, and is also required for eye development and skeletal patterning. Genes Dev. 9, 2808 – 2820. Massague´, J., 1998. TGF-beta signal transduction. Annu. Rev. Biochem. 67, 753 – 791. Mishina, Y., Suzuki, A., Ueno, N., Behringer, R.R., 1995. Bmpr encodes a type

646

L. Oxburgh et al. / Developmental Biology 286 (2005) 637 – 646

I Bone morphogenetic protein receptor that is essential for gastrulation during mouse embryogenesis. Genes Dev. 9, 3027 – 3037. Mishina, Y., Crombie, R., Bradley, A., Behringer, R.R., 1999. Multiple roles for activin-like kinase-2 signaling during mouse embryogenesis. Dev. Biol. 213, 314 – 326. Neul, J.L., Ferguson, E.L., 1998. Spatially restricted activation of the SAX receptor by SCW modulates DPP/TKV signaling in Drosophila dorsal – ventral patterning. Cell 95, 483 – 494. Nguyen, M., Park, S., Marques, G., Arora, K., 1998. Interpretation of a BMP activity gradient in Drosophila embryos depends on synergistic signaling by two type I receptors, SAX and TKV. Cell 95, 495 – 506. Oxburgh, L., Robertson, E.J., 2002. Dynamic regulation of Smad expression during mesenchyme to epithelium transition in the metanephric kidney. Mech. Dev. 112, 207 – 211. Oxburgh, L., Chu, G.C., Michael, S.K., Robertson, E.J., 2004. TGFb superfamily signals are required for morphogenesis of the kidney mesenchyme progenitor population. Development 131, 4593 – 4605. Padgett, R.W., Wozney, J.M., Gelbart, W.M., 1993. Human BMP sequences can confer normal dorsal – ventral patterning in the Drosophila embryo. Proc. Natl. Acad. Sci. 90, 2905 – 2909. Piscione, T.D., Yager, T.D., Gupta, I.R., Grinfeld, B., Pei, Y., Attisano, L., Wrana, J.L., Rosenblum, N.D., 1997. BMP-2 and OP-1 exert direct and opposite effects on renal branching morphogenesis. Am. J. Physiol. 273, F961 – F975. Podos, S.D., Ferguson, E.L., 1999. Morphogen gradients: new insights from DPP. Trends Genet. 15, 396 – 402. Qi, X., Li, T.-G., Hao, J., Hu, J., Wang, J., Simmons, H., Miura, S., Mishina, Y., Zhao, G.-Q., 2004. BMP4 supports self-renewal of embryonic stem cells by inhibiting mitogen-activated protein kinase pathways. Proc. Natl. Acad. Sci. U. S. A. 101, 6027 – 6032. Ray, R.P., Wharton, K.A., 2001. Context-dependent relationships between the BMPs gbb and dpp during development of the Drosophila wing imaginal disk. Development 128, 3913 – 3925.

Sampath, T.K., Rashka, K.E., Doctor, J.S., Tucker, R.F., Hoffmann, F.M., 1993. Drosophila transforming growth factor beta superfamily proteins induce endochondral bone formation in mammals. Proc. Natl. Acad. Sci. 90, 6004 – 6008. Schedl, A., Ross, A., Lee, M., Engelkamp, D., Rashbass, P., van Heyningen, V., Hastie, N.D., 1996. Influence of PAX6 gene dosage on development: overexpression causes severe eye abnormalities. Cell 86, 71 – 82. Shimmi, O., Ralston, A., Blair, S.S., O’Connor, M.B., 2005. The crossveinless gene encodes a new member of the Twisted gastrulation family of BMPbinding proteins which, with Short gastrulation, promotes BMP signaling in the crossveins of the Drosophila wing. Dev. Biol. 282, 70 – 83. Solloway, M.J., Robertson, E.J., 1999. Early embryonic lethality in Bmp5;Bmp7 double mutant mice suggests functional redundancy within the 60A subgroup. Development 126, 1753 – 1768. Solloway, M.J., Dudley, A.T., Bikoff, E.K., Lyons, K.M., Hogan, B.L., Robertson, E.J., 1998. Mice lacking Bmp6 function. Dev. Genet. 22, 321 – 339. ten Dijke, P., Yamashita, H., Sampath, T.K., Reddi, A.H., Estevez, M., Riddle, D.L., Ichijo, H., Heldin, C.H., Miyazono, K., 1994. Identification of type I receptors for osteogenic protein-1 and bone morphogenetic protein-4. J. Biol. Chem. 269, 16985 – 16988. Thomsen, G.H., Melton, D.A., 1993. Processed Vg1 protein is an axial mesoderm inducer in Xenopus. Cell 74, 433 – 441. Vukicevic, S., Kopp, J.B., Luyten, F.P., Sampath, T.K., 1996. Induction of nephrogenic mesenchyme by osteogenic protein 1 (bone morphogenetic protein 7). Proc. Natl. Acad. Sci. 93, 9021 – 9026. Wawersik, S., Purcell, P., Rauchman, M., Dudley, A.T., Robertson, E.J., Maas, R., 1999. BMP7 acts in murine lens placode development. Dev. Biol. 207, 176 – 188. Wharton, K.A., Cook, J.M., Torres-Schumann, S., de Castro, K., Borod, E., Phillips, D.A., 1999. Genetic analysis of the bone morphogenetic proteinrelated gene, gbb, identifies multiple requirements during Drosophila development. Genetics 152, 629 – 640.