Bohle iridovirus as a vector for heterologous gene expression

Available online at www.sciencedirect.com

Journal of Virological Methods 146 (2007) 419–423

Short communication

Bohle iridovirus as a vector for heterologous gene expression Jackie Pallister a,∗ , Sarah Goldie a , Barbara Coupar a , Brian Shiell a , Wojtek P. Michalski a , Nicole Siddon b , Alex Hyatt a a

CSIRO Livestock Industries, Australian Animal Health Laboratory, 5 Portarlington Road, Geelong, Victoria 3220, Australia b CSIRO Entomology, Clunies Ross Street, Black Mountain, Acton, ACT 2601, Australia Received 10 May 2007; received in revised form 13 August 2007; accepted 22 August 2007 Available online 29 September 2007

Abstract The large double-stranded DNA (ds DNA) viruses were among the first to be used to construct recombinant viruses, but to date this has not been achieved with any members of the ds DNA virus family, Iridoviridae. We identified a non-essential gene, the viral homologue of eukaryotic initiation factor 2␣ (eIF-2␣), in Bohle iridovirus (BIV, genus Ranavirus). A recombinant BIV was constructed with the neomycin resistance gene and the Bufo marinus (cane toad) adult globin gene inserted into the BIV eIF-2␣ region. Adult globin expressed by the virus was detected on western blot, demonstrating that foreign genes can be expressed by the recombinant BIV in vitro and suggesting the possibility of using a recombinant BIV in the biological control of cane toads. © 2007 Elsevier B.V. All rights reserved. Keywords: Iridovirus; Ranavirus; Recombinant virus; Bohle iridovirus; Bufo marinus

The family Iridoviridae consists of five genera. Members of the genera Iridovirus and Chloridovirus infect invertebrates while members of the genera Lymphocystivirus, Megalocytivirus and Ranavirus infect cold-blooded vertebrates (Chinchar et al., 2005). Bohle iridovirus (BIV), a member of the ranavirus genus, was isolated from Limnodynastes ornatus tadpoles from Bohle in northern Queensland (Speare and Smith, 1992). BIV is an Australian ranavirus isolate that is also capable of infecting Bufo marinus (cane toad) tadpoles (Robinson et al., 2006), it is therefore a potential candidate for viral delivery of genes to be used in biological control of cane toads in Australia. In common with the poxviruses, adenoviruses and herpesviruses, the iridoviruses have a large double-stranded DNA genome. The iridovirus genomes sequenced to date range in size from 105,057 bp (tiger frog virus, TFV, He et al., 2002) to 106,332 bp (Ambystoma tigrinum virus, ATV, Jancovich et al., 2003). Grouper iridovirus (GIV) with a genome size of 139,793 bp (Tsai et al., 2005) has been tentatively assigned to the ranavirus genus (Chinchar et al., 2005). Characterisation of herpes, pox and adenoviruses has shown these viruses encode various genes that are not essential for replication of the

∗

Corresponding author. Tel.: +61 3 5227 5215; fax: +61 3 5227 5555. E-mail address: [email protected] (J. Pallister).

0166-0934/$ – see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2007.08.016

virus. Among these is the gene encoding the nucleoside salvage pathway enzyme, thymidine kinase (TK) found in pox and herpesviruses, and recently in BIV (Coupar et al., 2005). In addition, an analogue of cellular eukaryotic initiation factor 2␣ (eIF-2␣), originally identified in poxviruses, has been identified in seven different ranaviruses (Essbauer et al., 2001). Sequencing of the eIF-2␣ homologues showed that in five of the seven viruses, including frog virus 3 (FV-3) which is the type species of the ranavirus genus, the homologue had a length of 780 nucleotides. However, Tan et al. (2004) were only able to identify 195 bp of the 3 end of the eIF-2␣ homologue when they sequenced the FV-3 genome and so the status of the eIF-2␣ homologue is still uncertain in FV-3. Cellular eIF-2␣ is involved in initiation of protein synthesis (Mouat and Manchester, 1998) and is thought to be involved in avoidance of the host interferon response and viral pathogenicity (Beattie et al., 1991). Non-essential genes have been widely used as insertion sites for foreign DNA in the construction of recombinant viruses. In this study we demonstrate that BIV carries a homologue of the eIF-2␣ gene and describe the construction of a recombinant BIV (rBIV) expressing the B. marinus adult globin gene inserted into the BIV eIF-2␣ gene. African Green Monkey Kidney cells (Vero – ATCC CCL 81) were used for growth of BIV and for transfection experiments. The cells were cultured at 37 ◦ C in growth medium (GM) consisting of Eagle’s minimal essential medium (EMEM)

420

J. Pallister et al. / Journal of Virological Methods 146 (2007) 419–423

containing 10% foetal calf serum (FCS) (v/v). BIV derived from the isolate described by Speare and Smith (1992) was used to infect cells at an MOI of 1 and incubated at 31 ◦ C in 5% CO2 . To prepare virus DNA, BIV infected cells were harvested at 24–48 h post-infection using a rubber policeman (without freeze/thaw) and pelleted at 2000 × g for 10 min. The pellet was frozen and thawed, resuspended in 1 ml of TE pH 8.0 (10 mM Tris–Cl, 1 mM EDTA pH 8.0) then homogenized using a dounce homogenizer. The suspension was centrifuged at 2000 × g for 10 min at 4 ◦ C and viral DNA extracted from the pellet using the Qiagen Genomic DNA Buffer Set and Qiagen Genomic-tip 500/G according to the manufacturer’s instructions. Generic PCR reactions were carried out using Invitrogen PCR Supermix with 40 ng DNA, 200 nM of each primer and the following cycling conditions: 94 ◦ C for 1 min, then cycle times of 94 ◦ C for 30 s, 55 ◦ C for 30 s, 72 ◦ C for 1 min for 30 cycles followed by an extension reaction at 75 ◦ C for 5 min. Annealing temperatures were adjusted as required. Reactions were electrophoresed in a 0.8% agarose gel (Bio-Rad) in TAE buffer (40 mM Tris–acetate, 1 mM EDTA) and the appropriate bands cleaned using the Qiaquick Gel Extraction Kit (Qiagen) according to the manufacturer’s instructions. Oligonucleotides for sequencing of the BIV eIF-2␣ gene were initially designed using existing sequence from epizootic haematopoietic necrosis virus (EHNV) (Yu et al., 1999; Bremont, unpublished data) with subsequent oligonucleotides designed based on the BIV sequence obtained (Table 1). Sequencing was carried out using the ABI PRISM BigDye Terminator v3.0 Cycle Sequencing Kit with either 2–3 ␮g of BIV genomic DNA or 200–500 ng of cloned DNA, and 0.5 ␮l of oligonucleotide primer diluted to 14 ␮M. Reactions were run on the ABI PRISM 377 DNA sequencer and data was analysed using the sequence analysis software LASERGENE version 5.03 (DNASTAR Inc., Madison, WI). Analysis of the sequence data revealed an open reading frame (ORF) of 777 bp encod-

Table 1 Primers used to sequence the BIV eIF-2␣ gene, to amplify products for the cloning shown in Fig. 1 and to confirm construction of the rBIV Primer

5 –3

SEQ 0001 SEQ 0015 SEQ 0039 SEQ 0040 SEQ 0045 SEQ 0046 SEQ 0057 SEQ 0065A PCR 0011 PCR 0012 PCR 0013 PCR 0014 PCR 0031 PCR 0048a PCR 0062 PCR 0063 PCR 0066 PCR 0067

ACACGTAAACGCCTTCATCC TCCGATGAGCTCGACCAGAA CCGAGACAAGGAGACGTTAC TGGTCTCTTCTGCTCGATAG TCTCGCACTTCAGACAGCAC CGTCCTGAGAGGTGTGACAA GATGCTCTTCGTCCAGATCA CTCGTCCTGCAGTTCATTCA GGAAGCCTCGAGAGGATCGTTTCGCATGATTG GGAAGCAAGCTTCGCTCAGAAGAACTCGTCAA CCGTTGAGAGTCCACCTGTC GGTTGCAGGAGCTCACATCA GGAAGCCTCGAGCCATGGTCCATTTGACAGAT GGAAGCTCTAGAACTTGTAGCTTGAGATTCTT TTAATAGTTAACAGAGGTGGACCAGGTAGAAA GGAAGCGGCCGGCCCGCTCAGAAGAACTCGTCAA TTAATAAGCGCTAGAGGTGGACCAGGTAGAGG TTAATAGGTACCCCCACCAATCAGAGGATAGT

ing 259 amino acids. Comparison of the deduced amino acid sequence of the BIV ORF and the EHNV eIF-2␣ homologue using the Align Plus program in Sci Ed Central showed 95% identity between the two with 12 amino acid substitutions and one amino acid deletion in the BIV compared with the EHNV sequence as reported by Essbauer et al. (2001). These authors showed there were 37% identity and 54% similarity between the N-terminal 100 amino acids of the EHNV sequence and the N-terminus of human eIF-2␣; together these data implied that the gene we had identified was the BIV eIF-2␣ gene homologue. The gene sequence was deposited in GenBank database, accession number EF408913. The oligonucleotides PCR0013 and PCR0014 (Table 1; annealing temperature of 50 ◦ C used for amplification) were used with genomic BIV DNA to amplify 777 bp of the eIF2␣ gene homologue along with 1035 bp of 5 eIF-2␣ flanking sequence and 737 bp of 3 eIF-2␣ flanking sequence. The 2549 bp product was cloned into pGEM-T Easy (Promega) then the B. marinus adult globin gene and the neomycin resistance gene were subsequently cloned into the BIV eIF-2␣ sequence. The adult globin gene was chosen as a prototype to test delivery of a toad gene carried by the virus, and the neomycin resistance gene as a selectable marker for use in recombinant virus selection, based on the sensitivity of wild type BIV to the antibiotic G418 (Gibco) (data not shown). The cloning strategy is shown in Fig. 1. The B. marinus adult globin gene sequence (GenBank accession number EL342145) was amplified from pSPORT/adglo (CSIRO Entomology) using primers that incorporated a 5 XhoI site, PCR 0031, and a 3 XbaI site, PCR 0048a (Table 1; annealing temperature of 58 ◦ C used for amplification), then the digested PCR product was cloned into pGL 3-Basic (Promega) carrying the BIV MCP promoter (pGL3B/MCP) (Pallister et al., 2005) resulting in the plasmid labelled pGL3-B/adglo. The neomycin resistance gene was amplified from pRevTet-On (Clontech) with a 5 XhoI site, PCR 0011, and a 3 HindIII site, PCR 0012 (Table 1; annealing temperature of 65 ◦ C used in amplification), then cloned into pGL-3 Basic carrying the BIV infected cell protein (ICP) 18 promoter (pGL3-B/ICP 18) (Pallister et al., 2005) resulting in the plasmid pGL3-B/neor . The ICP 18 promoter/neomycin resistance gene combination was amplified from pGL3-B/neor , incorporating a 5 HpaI site, PCR 0062, and a 3 FseI site, PCR 0063 (Table 1; annealing temperature of 55 ◦ C used in amplification), and the digested product was cloned into pGL-3 B/adglo resulting in the plasmid labelled pGL-3B/adglo/neor . The entire ICP 18 promoter/neomycin resistance gene/MCP/adult globin gene combination was then amplified using primers that incorporated an Eco47III site, PCR 0066, and a KpnI site, PCR 0067 (Table 1; annealing temperature of 57 ◦ C used in amplification), for insertion into the BIV eIF-2␣ gene in pGEM-T Easy resulting in the plasmid labelled pGEM-T Easy/adglo/neor . This plasmid was used in rBIV construction as follows. Approximately 90% confluent Vero cells in 25 cm2 flasks were infected with BIV for 1 h at 31 ◦ C at a multiplicity of infection (MOI) of 1–5. Transfection was carried out according to the manufacturer’s instructions using 2 ␮g of plasmid DNA linearised with NdeI and 2 ␮l of Lipofectamine 2000 (Invitrogen). Transfected cells

J. Pallister et al. / Journal of Virological Methods 146 (2007) 419–423

421

Fig. 1. Cloning strategy for insertion of the MCP promoter (MCP prom)/adult globin (adglo)/ICP 18 promoter (ICP18 prom)/neomycin resistance (neor ) genes into the BIV eIF-2␣ gene in pGEM-T Easy. Details in text.

422

J. Pallister et al. / Journal of Virological Methods 146 (2007) 419–423

were incubated at 31 ◦ C for 48 h, frozen and thawed, then clarified supernatant was passaged up to four times in Vero cells in the presence of 1 mg/ml G418 until viral cytopathic effects were observed. Potential rBIV carrying the neomycin resistance gene and the B. marinus adult globin inserted into the BIV eIF-2␣ gene (rBIV/neor /adglo) was diluted from 10−1 to 10−5 in GM and adsorbed to confluent Vero cells for 1 h at 31 ◦ C for plaque purification. The cell layer was overlaid with a 1:1 mixture of 2× EMEM and 2% low gelling temperature agarose (Sigma) containing 1 mg/ml G418 and incubated for 5 days at 31 ◦ C in 5% CO2 . Isolated plaques were randomly picked and grown in 24-well plates in the presence of G418. DNA was extracted; briefly, the virus stock was extracted with an equal volume of 1% N-lauroyl sarcosine (Sigma), in TE buffer, followed by digestion in 0.1 mg/ml Proteinase K (Sigma). The DNA was further extracted with phenol/chloroform/iso amyl alcohol (25:24:1 v/v), ethanol precipitated then amplified using SEQ 0039 + SEQ 0057 (Table 1; annealing temperature of 50 ◦ C used in amplification). SEQ 0039 binds in the BIV eIF-2␣ gene 5 of the inserted foreign genes and SEQ0057 binds in the neomycin resistance gene. When the neomycin resistance gene is present in a rBIV, amplification results in an 829 bp fragment. As shown in Fig. 2 the 829 bp fragment is present in consecutive plaque purifications of the potential rBIV confirming the presence of a rBIV/neor /adglo. The plaque purified virus was then sequenced and this data confirmed the successful insertion of the neomycin resistance gene and the adult globin gene into the BIV eIF-2␣ gene (data not shown). Insertion of the ICP 18 promoter/neomycin resistance gene/MCP promoter/adult globin DNA into the BIV eIF-2␣ gene resulted in an altered eIF-2␣ deduced amino acid sequence. The sequence of the first 68 amino acids, located 5 of the neomycin resistance gene insertion, was unaltered when compared to the wild type virus. Insertion of the neomycin resistance gene and the adult globin gene created a 100 bp deletion in the eIF-2␣ gene sequence and these alterations led to a shift one base to the right in the reading frame of the eIF-2␣ sequence downstream of the inserted DNA. This frameshift resulted in 17 stop codons in the remaining 162 codons of eIF-2␣ amino acid sequence. If the eIF-2␣ gene is

Fig. 2. Amplification of the 829 bp gene fragment spanning the neomycin resistance gene and the 5 end of the BIV eIF-2␣ gene, in consecutive plaque purifications (pp) of rBIV/adglo/neor . (Lane 1) NEB 2 log DNA markers; (2) pp1; (3) pp2; (4) pp3; (5) pp4; (6) eIF-2␣/neor /adglo in pGEM-T Easy; (7) eIF2␣ in pGEM-T Easy; (8) wild type BIV DNA; (9) no DNA; (10) NEB 2 log DNA markers.

still expressed the protein product is unlikely to resemble the original eIF-2␣. In addition, the 100 bp deletion in the eIF-2␣ sequence removed a KGYxD motif. This motif has been shown to be important in mammalian systems for binding of the doublestranded RNA-activated protein kinase (PKR). In response to the double-stranded RNA generated during virus infection, PKR phosphorylates eIF-2␣ to inhibit initiation of protein synthesis (Sharp et al., 1997). A number of viruses produce homologues of eIF-2␣ that inhibit the action of PKR and therefore maintain protein synthesis during infection (Kawagishi-Kobayashi et al., 2000, 1997; Sharp et al., 1997). The maintenance of an eIF-2␣ homologue in viruses that infect amphibians raises the possibility that PKR dependent anti-viral mechanisms may also exist in amphibians. A western blot analysis was carried out to confirm the expression of B. marinus adult ␤-globin by the recombinant BIV. To provide a positive control in the western blot as well as antigen for polyclonal serum production in rabbits, globin was extracted from heparinised adult B. marinus blood. Red blood cells were pelleted at 13,000 × g for 5 min, washed with PBS then lysed by resuspending in an equal volume of distilled water. Following centrifugation at 13,000 × g for 5 min the supernatant containing globin was aliquotted and stored at −80◦ C. This material was analysed by polyacrylamide gel electrophoresis in the presence of SDS (SDS PAGE) on 12% Bis/Tris precast gradient gels (Invitrogen) and proteins were visualized by staining with silver nitrate, according to the procedure of Heukeshoven and Dernick (1985). The stained gels showed two bands at approximately 14 kDa and 28 kDa (data not shown). These proteins were electrotransferred onto PVDF membranes, excised following brief staining with Coomassie Brilliant blue and subjected to N-terminal protein sequencing by Edman degradation on a Procise Sequanator (Model 492, Applied Biosystems). The sequence of the first 17 amino acids, VHLTDHELKSINAIWSK, was identical in both bands, and this sequence was the same as the deduced sequence for the first 17 amino acids of the B. marinus adult ␤-globin gene (EL342145). Furthermore, the sequence showed 82% identity at the amino acid level with the haemoglobin beta-2 chain from Telmatobius peruvianus (P83114). These results indicated that both bands are indeed ␤globin and is consistent with the 28 kDa band containing the dimeric form of the protein. Antibody to B. marinus globin was produced by injecting two rabbits with three doses containing 50 ␮g each of the red blood cell lysate protein at 2-week intervals. Each dose was prepared in CSIRO triple adjuvant (60%, v/v Montanide; 40%, v/v B. marinus red blood cell lysate [combined with Quil A, 3 mg/ml, and DEAE-dextran, 30 mg/ml], in water). Virus for western blot analysis was prepared by infecting Vero cells with rBIV/neor /adglo or wild type BIV at an MOI of 1 and incubating at 31 ◦ C for 24–48 h. Infected cells were harvested, washed in PBS and resuspended in lysis buffer (100 mM Tris–Cl pH 8.0; 100 mM NaCl; 0.5%, v/v Triton-X-100). The lysed cells were vortexed, incubated on ice for 10 min, centrifuged for 10 min at 13,000 × g after which the cytoplasm (supernatant) and nuclei (pellet) were separated. The resuspended pellet and the supernatant were sonicated and this material was analysed by

J. Pallister et al. / Journal of Virological Methods 146 (2007) 419–423

423

Heritage) for their ongoing funding of this project, ID # 56832; Tony Pye for sequencing data and Gary Beddome for protein sequence data. References

Fig. 3. Western blot showing expression of Bufo marinus adult ␤-globin in rBIV/adglo/neor infected Vero cells. (Lane 1) B. marinus adult ␤-globin extracted from blood; (2) MagicMark XP western markers (Invitrogen); (3) pellet, rBIV/adglo/neor infected cells; (4) supernatant, rBIV/adglo/neor infected cells; (5) pellet, wild type BIV infected cells; (6) supernatant, wild type BIV infected cells.

SDS PAGE on a 4–12% Bis/Tris gel (Invitrogen) then transferred to Hybond N (Amersham). The transferred membrane was blocked overnight at 4 ◦ C in blocking solution (PBS/0.05%, v/v Tween 20 plus 5% w/v, skim milk powder) then incubated for 1 h at room temperature (RT) in blocking solution containing a 1/1000 dilution of serum from rabbits inoculated with the B. marinus red blood cell lysate. After three washes the membrane was incubated for 1 h at RT in horse-radish peroxidase conjugated sheep anti-rabbit Ig G (Millipore, MA, USA) diluted 1/1000. The membrane was washed and adult globin detected using enhanced chemiluminescence (ECL) according to the manufacturer’s instructions (Amersham, UK). Adult globin was detected in both the pellet and supernatant fractions from lysed infected cells, but was not detected in cells infected with wild type BIV (Fig. 3). Some higher molecular weight material was detected in the pellet fraction from both recombinant and wild type BIV and therefore does not appear to be specific for the rBIV expressing adult globin (Fig. 3). The data indicate that the BIV eIF-2␣ gene is not necessary for virus replication in vitro, and that insertion of foreign DNA into the eIF-2␣ gene did not interrupt the expression of any essential genes on the complementary DNA strand. Therefore, the BIV eIF-2␣ gene can be used as a site for insertion and expression of foreign DNA. Having established the ability of a recombinant BIV to express foreign genes in vitro, future work will centre around the delivery of foreign genes in vivo, and the ability of a recombinant BIV to interfere with the development of the cane toad tadpole. Acknowledgements We would like to thank the Department of Environment and Water Resources (formerly the Department of Environment and

Beattie, E., Tartaglia, J., Paoletti, E., 1991. Vaccinia virus-encoded eif-2␣ homolog abrogates the antiviral effect of interferon. Virology 183, 419–422. Chinchar, V.G., Essbauer, S., He, J.G., Hyatt, A., Miyazaki, T., Seligy, V., Williams, T., 2005. Family Iridoviridae. In: Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U., Ball, L.A. (Eds.), Virus Taxonomy. Eighth report of the International Committee on Taxonomy of Viruses. Academic Press, San Diego, pp. 145–162. Coupar, B.E.H., Goldie, S.G., Hyatt, A.D., Pallister, J.A., 2005. Identification of a Bohle iridovirus thymidine kinase gene and demonstration of activity using vaccinia virus. Arch. Virol. 150, 1797–1812. Essbauer, S., Bremont, M., Ahne, W., 2001. Comparison of the eIF-2␣ homologous proteins of seven ranaviruses (Iridoviridae). Virus Genes 23, 347–359. He, J.G., Lu, L., Deng, M., He, H.H., Weng, S.P., Wang, X.H., Zhou, S.Y., Long, Q.X., Wang, X.Z., Chan, S.M., 2002. SEQuence analysis of the complete genome of an iridovirus isolated from the tiger frog. Virology 292, 185–197. Heukeshoven, J., Dernick, R., 1985. Simplified method for silver staining of proteins in polyacrylamide gels and the mechanism of silver staining. Electrophoresis 6, 103–112. Jancovich, J.K., Mao, J., Chinchar, V.G., Wyatt, C., Case, S.T., Kumar, S., Valente, G., Subramanian, S., Davidson, E., Collins, J., Jacobs, B., 2003. Genomic sequence of a ranavirus (family Iridoviridae) associated with salamander mortalities in North America. Virology 316, 90–103. Kawagishi-Kobayashi, M., Silverman, J.B., Ung, T.L., Dever, T.E., 1997. Regulation of the protein kinase PKR by the vaccinia virus pseudosubstrate inhibitor K3L is dependent on residues conserved between the K3L protein and the PKR substrate eIF2 ␣. Mol. Cell. Biol. 17, 4146–4158. Kawagishi-Kobayashi, M., Cao, C., Lu Jianming, Ozato, K., Dever, T.E., 2000. Pseudosubstrate inhibition of protein kinase PKR by swine pox virus C8L gene product. Virology 276, 424–434. Mouat, M.F., Manchester, K., 1998. An ␣ subunit-deficient form of eukaryotic protein synthesis initiation factor eIF-2␣ from rabbit reticulocyte lysate and its activity in ternary complex formation. Mol. Cell. Biol. 183, 69–78. Pallister, J., Goldie, S., Coupar, B., Hyatt, A., 2005. Promoter activity in the 5 flanking regions of the Bohle iridovirus ICP18, ICP46 and major capsid protein genes. Arch. Virol. 150, 1911–1919. Robinson, T., Hyatt, A., Pallister, J. 2006. Developing a cane toad biological control. Project report for the period January 2003 to June 2004. http://www.environment.gov.au/biodiversity/invasive/publications/canetoad-2004/index.html. Sharp, T.V., Witzel, J.E., Jagus, R., 1997. Homologous regions of the ␣ subunit of eukaryotic translational initiation factor 2 (eIF-2␣) and the vaccinia K3L product interact with the same domain within the dsRNA-activated protein kinase (PKR). Eur. J. Biochem. 250, 85–91. Speare, R., Smith, J.R., 1992. An iridovirus-like agent isolated from the ornate burrowing frog Limnodynastes ornatus in northern Australia. Dis. Aquat. Organ. 14, 51–57. Tan, W.G.H., Barkman, T.J., Chinchar, V.G., Essani, K., 2004. Comparative genomic analyses of frog virus 3, type species of the genus Ranavirus (family Iridoviridae). Virology 323, 70–84. Tsai, C.-T., Ting, J.-W., Wu, M.-H., Wu, M.-F., Guo, I.-C., Chang, C.-Y., 2005. Complete genome sequence of the grouper iridovirus and comparison of genomic organization with those of other iridoviruses. J. Virol. 79, 2010–2023. Yu, Y.X., Bearzotti, M., Vende, P., Ahne, W., Bremont, M., 1999. Partial mapping and sequencing of a fish iridovirus genome reveals genes homologous to the frog virus 3 p31, p40 and human eIF-2 alpha. Virus Res. 63, 53–63.