- Email: [email protected]
Bone Marrow–Derived Mesenchymal Stem Cells Improve Islet Graft Function in Diabetic Rats
Bone Marrow–Derived Mesenchymal Stem Cells Improve Islet Graft Function in Diabetic Rats M. Figliuzzi, R. Cornolti, N. Perico, C. Rota, M. Morigi, G. Remuzzi, A. Remuzzi, and A. Benigni ABSTRACT Type 1 diabetes is associated with a progressive loss of  cells and pancreatic islet transplantation could represent a cure for this disease. Herein we explored whether transplantation of bone marrow– derived mesenchymal stem cells (MSCs) allowed a reduced number of pancreatic islets to improve glycemic control in diabetic rats, by promoting islet vascularization. We transplanted 2000 syngenic islets alone or in combination with MSCs (106 cells) under the kidney capsules of diabetic Lewis rats. Animals transplanted with 2000 islets never reached normoglycemia. In contrast, rats transplanted with 2000 islets plus MSCs, showed a gradual fall in glycemia after transplantation, with normoglycemia maintained until killing. Comparable glycemic control was obtained with transplantation of 3000 islets alone. The MSC preparation used for in vivo experiments expressed high levels of vascular endothelial growth factor (VEGF165) and, at less extent, VEGF189, as evaluated by reverse transcriptase polymerase chain reaction (RT-PCR). In transplanted animals, vascularization was quantified by morphometric analysis of islet grafts with anti–RECA and anti-insulin antibodies. MSCs were stained with PKH-26. Mean capillary density was 1002 ⫾ 55 capillaries/mm2 in islets transplanted alone. Co-infusion of MSCs with islets significantly increased the number of capillaries to 1459 ⫾ 66 capillaries/mm2. In conclusion, our study indicated that co-transplantation of MSCs with pancreatic islets improved islet graft function by promoting graft vascularization. YPE 1 DIABETES is a chronic metabolic disorder that results from the progressive destruction of ß cells, leading to insulin insufficiency and hyperglycemia, the main determinants of chronic vascular complications. Intensive insulin therapies reduce the onset and progression of diabetic complications, but are related to an increased risk of life-threatening hypoglycemic episodes. Pancreatic islet transplantation theoretically represents a cure for type 1 diabetes.1 Recently developed protocols have enhanced the short-term success rates of islet transplantation, but there are still major limitations, including the lack of metabolic capacity of transplanted islets in the long run, which cannot be compensated by transplantation of a massive amount of islets. This phenomenon may be attributed to detrimental nutritional and inflammatory conditions against which pancreatic islets possess no significant means of protection. In particular, delayed and insufficient islet revascularization can deprive newly transplanted islets of oxygen, resulting in permanent cell death and contributing to early graft failure.2 Promotion of islet revascularization through locally
T
increased expression of growth factors, such as vascular endothelial growth factor (VEGF), may improve the efficiency of islet transplantation as a viable clinical therapy for diabetes.3 Bone marrow– derived mesenchymal stem cells (MSCs) have been shown to promote angiogenesis both in vitro4 and in vivo.5 In previous studies MSCs were shown to secrete VEGF165 and other growth factors that enhance proliferation of endothelial cells and smooth muscle cells.6 On this basis, we elected to investigate whether ex vivo
From the Mario Negri Institute for Pharmacological Research (M.F., R.C., N.P., C.R., M.M., G.R., A.R., A.B.); the Unit of Nephrology and Dialysis (G.R.), Ospedali Riuniti di Bergamo; and the Department of Industrial Engineering (A.R.), University of Bergamo, Bergamo, Italy. Supported by a research grant from “ROTRF/JDRF” (contract number 678864716). Address reprint requests to Dr Marina Figliuzzi, Department of Biomedical Engineering, Mario Negri Institute, Via Gavazzeni, 11, 24125 Bergamo, Italy. E-mail: [email protected]
© 2009 by Elsevier Inc. All rights reserved. 360 Park Avenue South, New York, NY 10010-1710
0041-1345/09/$–see front matter doi:10.1016/j.transproceed.2008.11.015
Transplantation Proceedings, 41, 1797–1800 (2009)
1797
1798
FIGLIUZZI, CORNOLTI, PERICO ET AL
Fig 1. Nonfasting blood glucose level after transplantation of 2000 islets (A) with (□) or without () MSCs or 3000 islets (B). Data are mean values ⫾ SE. *P ⬍ .01 versus islets alone.
expanded rat MSCs co-transplanted with pancreatic islets served as cell therapy to promote therapeutic angiogenesis ultimately, leading to effective metabolic activity of islet grafts.
MATERIALS AND METHODS Co-transplantation of MSCs and Pancreatic Islets Lewis rats purchased from Charles River (Charles River Italia S.p.A., Calco, LC, Italy) were used as donors and recipients. Pancreatic islets were isolated from adult male Lewis rats after intraductal collagenase injection (Type P, Roche Diagnostic, Mannheim, Germany), followed by automated digestion and purification by centrifugation on Histopaque (1.077 g/mL; Sigma, St Louis, MO) as previously described.7 MSCs isolated from femurs and tibiae of Lewis rats were maintained in growth medium containing ␣-Modified Eagle’s Medium (Gibco) supplemented with 20% fetal calf serum (EuroClone s.p.a., Pavia, Italy) and penicillin-streptomycin (100 U/mL; Gibco, Grand Island, NY). Before transplantation adherent cells were trypsinized and labelled with PKH-26 red fluorescence cell linker (Sigma). Rats were made diabetic with 65 mg/kg streptozotocin (Sigma). Pancreatic islets with or without MSCs were injected into diabetic Lewis rats under the renal capsule. Briefly, islets and MSCs were centrifuged in a polyethylene catheter and slowly injected under the capsule of the kidney. Blood samples were obtained from the tail vein for blood glucose determinations. Nephrectomies of the kidney with the islets were performed at 1 month after transplantation.
Reverse Transcriptase Polymerase Chain Reaction Gene expression of VEGF in MSCs was evaluated by reverse transcriptase polymerase chain reaction (RT-PCR). Total RNA was extracted using TRIzol from cultured fresh MSCs and from frozen MSCs. Contaminating genomic DNA was removed by RNase-free DNase for 1 hour at 37°C. The purified RNA (2 g) was reverse transcribed using random examers oligonucleotides and 50 U of SuperScript II RT for 1 hour at 42°C. No enzyme was added for reverse transcriptase-negative controls. The amplification profile consisted of 94°C for 4 minutes, 35 cycles of 94°C for 1 minute, 55°C for 1 minute, and 72°C for 1 minute with the final extension at 72°C for 10 minutes. We used the following oligonucleotide primers, specific for isoforms 165 (amplicon 230 bp) and 189 (amplicon 300 bp) of rat VEGF; forward, ATGCAGATCATGCGGATCAA and reverse TTAACTCAAGCTGCCTCGCC.
Morphometric Analysis To estimate islet vascularization, 5-m-thick sections of frozen kidneys were stained with mouse anti-rat endothelial cell antigen (RECA)-1 (1:100; Santa Cruz Biotechnology, Inc. Santa Cruz, Calif) followed by goat anti-mouse Cy5 (1:100; Jackson Immunoresearch Laboratories, West Grove, Penn), and rabbit anti-rat insulin (1:100; Santa Cruz Biotechnology) followed by anti-rabbit fluoroscein isothyocyanate (1:25, Jackson Immunoresearch Laboratories). Counterstaining was performed with 4=,6-diamidino-2-phenylindole (DAPI; Sigma). To estimate the capillary number in the pericapsular region, 20 renal sections per rat were digitalized using an inverted confocal laser microscopy (LSM 510 Meta; Zeiss, Jena, Germany). The number of capillaries per section field was counted using digital
Fig 2. RT-PCR analysis of mRNA isolated from rat MSCs. VEGF165 transcript (230 bp) and VEGF189 transcript (300 bp) were detected in kidney (lane 2 positive control), in fresh MSCs (lane 3), and frozen MSCs (lane 4). No transcript was observed in negative controls (lane 5, 6, 7 RT-) and in H2O (lane 1).
BONE MARROW–DERIVED MSC
1799
Fig 3. Representative micrographs of transplanted islets alone (A, B) or in combination with MSCs (C, D). Islets were stained for insulin content with anti-insulin antibody (green). Endothelial cells were labeled (white) with antiRECA-1 antibody (B, D). MSCs were PKH26 positive (red). All cell nuclei were stained with DAPI (blue). Original magnification, ⫻400. (E) Quantification of the number of capillaries/mm2 in islets transplanted alone or in combination with MSCs by morphometric analysis. Data are mean values ⫾ SE. *P ⬍ .01 versus islets alone. morphometry and the mean number of capillary sections/mm2 calculated using exact enlargment.
Statistical Analysis All results are expressed as mean values ⫾ SE. The Student t-test for unpaired data was used for statistical analysis with significance assumed for P ⬍ .05.
RESULTS
Diabetic Lewis rats were transplanted with 2000 syngeneic islets alone or in combination with MSCs (1 ⫻ 106). Animals transplanted with islets alone never reached normoglycemia conditions (Fig 1A). In contrast, rats transplanted with 2000 islets in combination with MSCs showed
a gradual fall in glycemia after transplantation with normoglycemia maintained until nephrectomy. Co-transplantation of 2000 islets with MSCs yielded glycemic control comparable to transplantation of 3000 islets alone (Fig 1B). Next, we explored the potential of MSCs to stimulate angiogenesis by studying VEGF expression by cultured MSCs and the vascularization of islet grafts in diabetic rats. As shown in Figure 2, the MSCs preparation expressed high levels of VEGF165 and, to a lesser extent, of VEGF189, as evaluated by RT-PCR. We also tested whether freezing affected VEGF165 gene expression by MSCs compared with fresh preparation, observing that frozen MSCs expressed VEGF165 to a comparable extent as freshly isolated MSCs (Fig 2). Then, we determined whether MSCs enhanced islet
1800
FIGLIUZZI, CORNOLTI, PERICO ET AL
graft vascularization by performing immunofluorescence studies on renal tissue collected 30 days after transplantation. Representative images (Fig 3A–D) showed RECA-1 labeled endothelium in graft islets stained with anti-insulin antibody and MSCs-PKH-26 positive. The density of capillaries quantified by morphometric analysis averaged 1002 ⫾ 55 capillaries/mm2 in islet transplants alone. At variance, co-infusion of MSCs with islets significantly increased the number of capillaries, reaching 1459 ⫾ 66 capillaries/mm2 with 38 ⫾ 6% increase (Fig 3E).
which intravenous infusion of human MSCs resulted in partial repair of pancreatic islets and renal glomeruli associated with reduced blood glucose levels.12 These results suggested that MSCs co-infused with pancreatic islets improved islet graft function by promoting vascularization. This procedure reduced the need for transplanting large numbers of islets and may have future applications in human islet transplantation programs.
DISCUSSION
The authors thank Dr Lorena Longaretti for assistance with RT-PCR analysis and Dr Matteo Trudu for assistance with histology. Cinzia Rota is a recipient of the fellowship “Fondazione Aiuti per la Ricerca sulle malattie Rare, ARMR, Delegazione di Pisa.”
One of the limiting factors of islet transplantation is the infusion of an adequate mass of freshly prepared islets. Actually, 2 to 4 pancreata are needed to retrieve the number of islets (⬎10,000 islet/kg body weight) required to achieve insulin independence in a single recipient.8 In addition to obvious concerns about the cost/effectiveness of the procedure, this problem raises ethical issues since these organs are subtracted from the already limited pool of tissues potentially suitable for whole pancreas transplantation. This renders the procedure difficult to perform on a large scale given the donor shortage. Strategies that may reduce the number of transplanted islets and, at the same time, substain normoglycemia are therefore warranted. Herein we have documented that co-transplantation of pancreatic islets with bone marrow– derived MSCs under the kidney capsule of syngeneic diabetic rats resulted in efficient control of blood glucose levels comparable to those obtained with a greater number of pancreatic islets transplanted alone. Thus, MSCs may allow us to reduce the number of transplanted islets by 30%. MSCs can be regarded as an attractive strategy to improve diabetes care, because they are easily taken from the patient who needs the islet transplant and rapidly expanded in vitro. Moreover, cultured MSCs used in early clinical testing have provided successful results without apparent toxicity for patients with genetic disorders,9 ischemic cardiomyopathies,10 or hematologic pathologies.11 Consistent with previous studies, cultured MSCs in this work expressed high levels of the angiogenic factor VEGF165. Transplantation of those MSCs elicited a robust host angiogenic response leading to neovascularization of islet grafts in diabetic rats. This effect may serve to increase local perfusion of the islets and ameliorate their metabolic activity. These data were reminiscent of previous results in a rat model of myocardial infarction showing that transplantation of autologous MSCs induced elevated VEGF levels accompanied by increased vascular density and regional blood flow.5 The effectiveness of MSC was also described in diabetic NOD/SCID mice in
ACKNOWLEDGMENTS
REFERENCES 1. Balamurugan AN, Bottino R, Giannoukakis N, et al: Prospective and challenges of islet transplantation for the therapy of autoimmune diabetes. Pancreas 32:231, 2006 2. Linn T, Schmitz J, Hauck-Schmalenberger I, et al: Ischaemia is linked to inflammation and induction of angiogenesis in pancreatic islets. Clin Exp Immunol 144:179, 2006 3. Cheng Y, Liu YF, Zhang JL, et al: Elevation of vascular endothelial growth factor production and its effect on revascularization and function of graft islets in diabetic rats. World J Gastroenterol 13:2862, 2007 4. Jiang Y, Jahagirdar BN, Reinhardt RL, et al: Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 418:41, 2002 5. Tang YL, Zhao Q, Zhang YC, et al: Autologous mesenchymal stem cell transplantation induce VEGF and neovascularization in ischemic myocardium. Regul Pept 117:3, 2004 6. Kinnaird T, Stabile E, Burnett MS, et al: Local delivery of marrow-derived stromal cells augments collateral perfusion through paracrine mechanisms. Circulation 109:1543, 2004 7. Figliuzzi M, Cornolti R, Plati T, et al: Subcutaneous xenotransplantation of bovine pancreatic islets. Biomaterials 26:5640, 2005 8. Senior PA, Zeman M, Paty BW, et al: Changes in renal function after clinical islet transplantation: four-year observational study. Am J Transplant 7:91, 2007 9. Picinich SC, Mishra PJ, Glod J, et al: The therapeutic potential of mesenchymal stem cells. Cell- & tissue-based therapy. Expert Opin Biol Ther 7:965, 2007 10. Gnecchi M, He H, Noiseux N, et al: Evidence supporting paracrine hypothesis for Akt-modified mesenchymal stem cellmediated cardiac protection and functional improvement. FASEB J 20:661, 2006 11. Iba O, Matsubara H, Nozawa Y, et al: Angiogenesis by implantation of peripheral blood mononuclear cells and platelets into ischemic limbs. Circulation 106:2019, 2002 12. Lee RH, Seo MJ, Reger RL, et al: Multipotent stromal cells from human marrow home to and promote repair of pancreatic islets and renal glomeruli in diabetic NOD/scid mice. Proc Natl Acad Sci USA 103:17438, 2006
T
increased expression of growth factors, such as vascular endothelial growth factor (VEGF), may improve the efficiency of islet transplantation as a viable clinical therapy for diabetes.3 Bone marrow– derived mesenchymal stem cells (MSCs) have been shown to promote angiogenesis both in vitro4 and in vivo.5 In previous studies MSCs were shown to secrete VEGF165 and other growth factors that enhance proliferation of endothelial cells and smooth muscle cells.6 On this basis, we elected to investigate whether ex vivo
From the Mario Negri Institute for Pharmacological Research (M.F., R.C., N.P., C.R., M.M., G.R., A.R., A.B.); the Unit of Nephrology and Dialysis (G.R.), Ospedali Riuniti di Bergamo; and the Department of Industrial Engineering (A.R.), University of Bergamo, Bergamo, Italy. Supported by a research grant from “ROTRF/JDRF” (contract number 678864716). Address reprint requests to Dr Marina Figliuzzi, Department of Biomedical Engineering, Mario Negri Institute, Via Gavazzeni, 11, 24125 Bergamo, Italy. E-mail: [email protected]
© 2009 by Elsevier Inc. All rights reserved. 360 Park Avenue South, New York, NY 10010-1710
0041-1345/09/$–see front matter doi:10.1016/j.transproceed.2008.11.015
Transplantation Proceedings, 41, 1797–1800 (2009)
1797
1798
FIGLIUZZI, CORNOLTI, PERICO ET AL
Fig 1. Nonfasting blood glucose level after transplantation of 2000 islets (A) with (□) or without () MSCs or 3000 islets (B). Data are mean values ⫾ SE. *P ⬍ .01 versus islets alone.
expanded rat MSCs co-transplanted with pancreatic islets served as cell therapy to promote therapeutic angiogenesis ultimately, leading to effective metabolic activity of islet grafts.
MATERIALS AND METHODS Co-transplantation of MSCs and Pancreatic Islets Lewis rats purchased from Charles River (Charles River Italia S.p.A., Calco, LC, Italy) were used as donors and recipients. Pancreatic islets were isolated from adult male Lewis rats after intraductal collagenase injection (Type P, Roche Diagnostic, Mannheim, Germany), followed by automated digestion and purification by centrifugation on Histopaque (1.077 g/mL; Sigma, St Louis, MO) as previously described.7 MSCs isolated from femurs and tibiae of Lewis rats were maintained in growth medium containing ␣-Modified Eagle’s Medium (Gibco) supplemented with 20% fetal calf serum (EuroClone s.p.a., Pavia, Italy) and penicillin-streptomycin (100 U/mL; Gibco, Grand Island, NY). Before transplantation adherent cells were trypsinized and labelled with PKH-26 red fluorescence cell linker (Sigma). Rats were made diabetic with 65 mg/kg streptozotocin (Sigma). Pancreatic islets with or without MSCs were injected into diabetic Lewis rats under the renal capsule. Briefly, islets and MSCs were centrifuged in a polyethylene catheter and slowly injected under the capsule of the kidney. Blood samples were obtained from the tail vein for blood glucose determinations. Nephrectomies of the kidney with the islets were performed at 1 month after transplantation.
Reverse Transcriptase Polymerase Chain Reaction Gene expression of VEGF in MSCs was evaluated by reverse transcriptase polymerase chain reaction (RT-PCR). Total RNA was extracted using TRIzol from cultured fresh MSCs and from frozen MSCs. Contaminating genomic DNA was removed by RNase-free DNase for 1 hour at 37°C. The purified RNA (2 g) was reverse transcribed using random examers oligonucleotides and 50 U of SuperScript II RT for 1 hour at 42°C. No enzyme was added for reverse transcriptase-negative controls. The amplification profile consisted of 94°C for 4 minutes, 35 cycles of 94°C for 1 minute, 55°C for 1 minute, and 72°C for 1 minute with the final extension at 72°C for 10 minutes. We used the following oligonucleotide primers, specific for isoforms 165 (amplicon 230 bp) and 189 (amplicon 300 bp) of rat VEGF; forward, ATGCAGATCATGCGGATCAA and reverse TTAACTCAAGCTGCCTCGCC.
Morphometric Analysis To estimate islet vascularization, 5-m-thick sections of frozen kidneys were stained with mouse anti-rat endothelial cell antigen (RECA)-1 (1:100; Santa Cruz Biotechnology, Inc. Santa Cruz, Calif) followed by goat anti-mouse Cy5 (1:100; Jackson Immunoresearch Laboratories, West Grove, Penn), and rabbit anti-rat insulin (1:100; Santa Cruz Biotechnology) followed by anti-rabbit fluoroscein isothyocyanate (1:25, Jackson Immunoresearch Laboratories). Counterstaining was performed with 4=,6-diamidino-2-phenylindole (DAPI; Sigma). To estimate the capillary number in the pericapsular region, 20 renal sections per rat were digitalized using an inverted confocal laser microscopy (LSM 510 Meta; Zeiss, Jena, Germany). The number of capillaries per section field was counted using digital
Fig 2. RT-PCR analysis of mRNA isolated from rat MSCs. VEGF165 transcript (230 bp) and VEGF189 transcript (300 bp) were detected in kidney (lane 2 positive control), in fresh MSCs (lane 3), and frozen MSCs (lane 4). No transcript was observed in negative controls (lane 5, 6, 7 RT-) and in H2O (lane 1).
BONE MARROW–DERIVED MSC
1799
Fig 3. Representative micrographs of transplanted islets alone (A, B) or in combination with MSCs (C, D). Islets were stained for insulin content with anti-insulin antibody (green). Endothelial cells were labeled (white) with antiRECA-1 antibody (B, D). MSCs were PKH26 positive (red). All cell nuclei were stained with DAPI (blue). Original magnification, ⫻400. (E) Quantification of the number of capillaries/mm2 in islets transplanted alone or in combination with MSCs by morphometric analysis. Data are mean values ⫾ SE. *P ⬍ .01 versus islets alone. morphometry and the mean number of capillary sections/mm2 calculated using exact enlargment.
Statistical Analysis All results are expressed as mean values ⫾ SE. The Student t-test for unpaired data was used for statistical analysis with significance assumed for P ⬍ .05.
RESULTS
Diabetic Lewis rats were transplanted with 2000 syngeneic islets alone or in combination with MSCs (1 ⫻ 106). Animals transplanted with islets alone never reached normoglycemia conditions (Fig 1A). In contrast, rats transplanted with 2000 islets in combination with MSCs showed
a gradual fall in glycemia after transplantation with normoglycemia maintained until nephrectomy. Co-transplantation of 2000 islets with MSCs yielded glycemic control comparable to transplantation of 3000 islets alone (Fig 1B). Next, we explored the potential of MSCs to stimulate angiogenesis by studying VEGF expression by cultured MSCs and the vascularization of islet grafts in diabetic rats. As shown in Figure 2, the MSCs preparation expressed high levels of VEGF165 and, to a lesser extent, of VEGF189, as evaluated by RT-PCR. We also tested whether freezing affected VEGF165 gene expression by MSCs compared with fresh preparation, observing that frozen MSCs expressed VEGF165 to a comparable extent as freshly isolated MSCs (Fig 2). Then, we determined whether MSCs enhanced islet
1800
FIGLIUZZI, CORNOLTI, PERICO ET AL
graft vascularization by performing immunofluorescence studies on renal tissue collected 30 days after transplantation. Representative images (Fig 3A–D) showed RECA-1 labeled endothelium in graft islets stained with anti-insulin antibody and MSCs-PKH-26 positive. The density of capillaries quantified by morphometric analysis averaged 1002 ⫾ 55 capillaries/mm2 in islet transplants alone. At variance, co-infusion of MSCs with islets significantly increased the number of capillaries, reaching 1459 ⫾ 66 capillaries/mm2 with 38 ⫾ 6% increase (Fig 3E).
which intravenous infusion of human MSCs resulted in partial repair of pancreatic islets and renal glomeruli associated with reduced blood glucose levels.12 These results suggested that MSCs co-infused with pancreatic islets improved islet graft function by promoting vascularization. This procedure reduced the need for transplanting large numbers of islets and may have future applications in human islet transplantation programs.
DISCUSSION
The authors thank Dr Lorena Longaretti for assistance with RT-PCR analysis and Dr Matteo Trudu for assistance with histology. Cinzia Rota is a recipient of the fellowship “Fondazione Aiuti per la Ricerca sulle malattie Rare, ARMR, Delegazione di Pisa.”
One of the limiting factors of islet transplantation is the infusion of an adequate mass of freshly prepared islets. Actually, 2 to 4 pancreata are needed to retrieve the number of islets (⬎10,000 islet/kg body weight) required to achieve insulin independence in a single recipient.8 In addition to obvious concerns about the cost/effectiveness of the procedure, this problem raises ethical issues since these organs are subtracted from the already limited pool of tissues potentially suitable for whole pancreas transplantation. This renders the procedure difficult to perform on a large scale given the donor shortage. Strategies that may reduce the number of transplanted islets and, at the same time, substain normoglycemia are therefore warranted. Herein we have documented that co-transplantation of pancreatic islets with bone marrow– derived MSCs under the kidney capsule of syngeneic diabetic rats resulted in efficient control of blood glucose levels comparable to those obtained with a greater number of pancreatic islets transplanted alone. Thus, MSCs may allow us to reduce the number of transplanted islets by 30%. MSCs can be regarded as an attractive strategy to improve diabetes care, because they are easily taken from the patient who needs the islet transplant and rapidly expanded in vitro. Moreover, cultured MSCs used in early clinical testing have provided successful results without apparent toxicity for patients with genetic disorders,9 ischemic cardiomyopathies,10 or hematologic pathologies.11 Consistent with previous studies, cultured MSCs in this work expressed high levels of the angiogenic factor VEGF165. Transplantation of those MSCs elicited a robust host angiogenic response leading to neovascularization of islet grafts in diabetic rats. This effect may serve to increase local perfusion of the islets and ameliorate their metabolic activity. These data were reminiscent of previous results in a rat model of myocardial infarction showing that transplantation of autologous MSCs induced elevated VEGF levels accompanied by increased vascular density and regional blood flow.5 The effectiveness of MSC was also described in diabetic NOD/SCID mice in
ACKNOWLEDGMENTS
REFERENCES 1. Balamurugan AN, Bottino R, Giannoukakis N, et al: Prospective and challenges of islet transplantation for the therapy of autoimmune diabetes. Pancreas 32:231, 2006 2. Linn T, Schmitz J, Hauck-Schmalenberger I, et al: Ischaemia is linked to inflammation and induction of angiogenesis in pancreatic islets. Clin Exp Immunol 144:179, 2006 3. Cheng Y, Liu YF, Zhang JL, et al: Elevation of vascular endothelial growth factor production and its effect on revascularization and function of graft islets in diabetic rats. World J Gastroenterol 13:2862, 2007 4. Jiang Y, Jahagirdar BN, Reinhardt RL, et al: Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 418:41, 2002 5. Tang YL, Zhao Q, Zhang YC, et al: Autologous mesenchymal stem cell transplantation induce VEGF and neovascularization in ischemic myocardium. Regul Pept 117:3, 2004 6. Kinnaird T, Stabile E, Burnett MS, et al: Local delivery of marrow-derived stromal cells augments collateral perfusion through paracrine mechanisms. Circulation 109:1543, 2004 7. Figliuzzi M, Cornolti R, Plati T, et al: Subcutaneous xenotransplantation of bovine pancreatic islets. Biomaterials 26:5640, 2005 8. Senior PA, Zeman M, Paty BW, et al: Changes in renal function after clinical islet transplantation: four-year observational study. Am J Transplant 7:91, 2007 9. Picinich SC, Mishra PJ, Glod J, et al: The therapeutic potential of mesenchymal stem cells. Cell- & tissue-based therapy. Expert Opin Biol Ther 7:965, 2007 10. Gnecchi M, He H, Noiseux N, et al: Evidence supporting paracrine hypothesis for Akt-modified mesenchymal stem cellmediated cardiac protection and functional improvement. FASEB J 20:661, 2006 11. Iba O, Matsubara H, Nozawa Y, et al: Angiogenesis by implantation of peripheral blood mononuclear cells and platelets into ischemic limbs. Circulation 106:2019, 2002 12. Lee RH, Seo MJ, Reger RL, et al: Multipotent stromal cells from human marrow home to and promote repair of pancreatic islets and renal glomeruli in diabetic NOD/scid mice. Proc Natl Acad Sci USA 103:17438, 2006