Boron deficiency increases the levels of cytosolic Ca2+ and expression of Ca2+-related genes in Arabidopsis thaliana roots

Plant Physiology and Biochemistry 65 (2013) 55e60

Contents lists available at SciVerse ScienceDirect

Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy

Research article

Boron deficiency increases the levels of cytosolic Ca2þ and expression of Ca2þ-related genes in Arabidopsis thaliana roots Carlos Quiles-Pando, Jesús Rexach*, M. Teresa Navarro-Gochicoa, Juan J. Camacho-Cristóbal, M. Begoña Herrera-Rodríguez, Agustín González-Fontes Departamento de Fisiología, Anatomía y Biología Celular, Universidad Pablo de Olavide, E-41013 Sevilla, Spain

a r t i c l e i n f o

a b s t r a c t

Article history: Received 22 November 2012 Accepted 9 January 2013 Available online 29 January 2013

Boron (B) deficiency affects the expressions of genes involved in major physiological processes. However, signal transduction pathway through which plants are able to sense and transmit B-deprivation signal to the nucleus is unknown. The aim of this work was to research in Arabidopsis thaliana roots whether the short-term B deficiency affects cytosolic Ca2þ levels ([Ca2þ]cyt) as well as expression of genes involved in Ca2þ signaling. To visualize in vivo changes in root [Ca2þ]cyt, Arabidopsis seedlings expressing Yellow Cameleon (YC) 3.6 were grown in a nutrient solution supplemented with 2 mM B and then transferred to a B-free medium for 24 h. Root [Ca2þ]cyt was clearly higher in B-deficient seedlings upon 6 and 24 h of B treatments when compared to controls. Transcriptome analyses showed that transcript levels of Ca2þ signaling-related genes were affected by B deprivation. Interestingly, Ca2þ channel (CNGC19, cyclic nucleotide-gated ion channel) gene was strongly upregulated as early as 6 h after B deficiency. Expression levels of Ca2þ transporter (ACA, autoinhibited Ca2þ-ATPase; CAX, cation exchanger) genes increased when seedlings were subjected to B deficiency. Gene expressions of calmodulin-like proteins (CMLs) and Ca2þ-dependent protein kinases (CPKs) were also overexpressed upon exposure to B starvation. Our results suggest that B deficiency causes early responses in the expression of CNGC19 Ca2þinflux channel, ACA- and CAX-efflux, and Ca2þ sensor genes to regulate Ca2þ homeostasis. It is the first time that changes in the levels of in vivo cytosolic Ca2þ and expression of Ca2þ channel/transporter genes are related with short-term B deficiency in Arabidopsis roots. Ó 2013 Elsevier Masson SAS. All rights reserved.

Keywords: Arabidopsis Boron deficiency Cameleon YC3.6 Ca2þ signaling Cytosolic Ca2þ Gene expression

1. Introduction Plants, which are subjected to a constantly changing environment, have to sense and process diverse stimuli such as light, temperature, water and nutrient availability for achieving a normal development. Consequently, under unfavorable environmental conditions, specific signaling pathways designed to produce an acclimation response are triggered. Calcium (Ca2þ) is a crucial second intracellular messenger that plays a major role in plant responses to stresses. Multiple abiotic and biotic cues Abbreviations: ACA, autoinhibited Ca2þ-ATPases; B, boron; CAX, cation/Hþ exchanger; [Ca2þ]cyt, cytosolic Ca2þ concentration; CM, culture medium; CML, calmodulin-like protein; CNGC, cyclic nucleotide-gated ion channel; CPK, Ca2þdependent protein kinase; FRET, fluorescence resonance energy transfer; qRT-PCR, quantitative real time-PCR. * Corresponding author. Tel.: þ34 954349135; fax: þ34 954349151. E-mail addresses: [email protected] (C. Quiles-Pando), [email protected] (J. Rexach), [email protected] (M.T. Navarro-Gochicoa), [email protected] (J.J. Camacho-Cristóbal), [email protected] (M.B. Herrera-Rodríguez), agonfon@ upo.es (A. González-Fontes). 0981-9428/$ e see front matter Ó 2013 Elsevier Masson SAS. All rights reserved. http://dx.doi.org/10.1016/j.plaphy.2013.01.004

provoke specific and distinct spatio-temporal patterns of change in the cytosolic Ca2þ concentration ([Ca2þ]cyt), named as “Ca2þ signatures”, in which signal information of particular stimuli is encoded [1,2]. Ca2þ signatures are generated from tightly regulated Ca2þ movements, performed through various Ca2þ channels, transporters and pumps, between the cytosol e wherein Ca2þ levels are kept low e and diverse cellular compartments that present higher Ca2þ concentrations such as vacuole, endoplasmic reticule and apoplast [1e3]. These Ca2þ signatures are perceived, decoded and transmitted to downstream responses by extended set of Ca2þ binding proteins functioning as Ca2þ sensors. In plants, several Ca2þ sensors proteins that play a crucial role in abiotic stress signaling such as calmodulins (CaMs), calmodulin-like proteins (CMLs), Ca2þ dependent protein kinases (CPKs, also designated as CDPKs) and calcineurin B-like (CBLs) have been described [1,4]. Thus, when Ca2þ is bound to these Ca2þ sensors, conformational changes are induced that either promote their interaction with target proteins or alter their own enzymatic activity. These adjustments of Ca2þ sensors transmit the information contained in the Ca2þ signature into

56

C. Quiles-Pando et al. / Plant Physiology and Biochemistry 65 (2013) 55e60

phosphorylation events, changes in proteineprotein interactions or transcriptional regulation, inducing the specific stress responses to improve plant survival under unfavorable environmental conditions [5]. Boron (B) is an essential element for plant development and its adequate supply is required for achieving high yield and quality crops [6,7]. The main role of this micronutrient is its structural function in cell wall where B forms borate esters with apiose residues of rhamnogalacturonan II [8e10]. In addition, B deficiency causes multiples physiological and metabolic alterations affecting cytoskeleton and membranes [11], secondary metabolism and oxidative stress [12e14], nitrogen metabolism [15e19], and root development [20,21], among others. Interestingly, it has been described that B deficiency produces transcript level changes in processes involved in oxidative stress [14], wound response [22], B uptake and translocation [23], cell wall and membranes [24,25] and nitrogen assimilation ([18], and references cited therein [26]). It has been proposed that B could have in common with Ca2þ three physiological features, namely, a structural role in the cell wall, very low cytosolic concentration, and a hypothetical signaling function [27]. Interestingly, and adequate B and Ca2þ supply restores iron-content in salt-stressed pea nodules [28], as well as increases the germination in salt-stressed pea seeds [29]. Furthermore, recent studies support a possible interaction between the B and Ca2þ for gene expression [22,26,30], which gives to this line of research a growing interest. Although the molecular mechanism(s) through which plants are able to sense and transmit the B-deprivation signal remains unknown, it is not ruled out that Ca2þ could mediate it. Therefore, the aim of this work was to study whether B deficiency alters [Ca2þ]cyt and/or expression levels of Ca2þ-related genes. For this purpose, in vivo fluorescence measurements of [Ca2þ]cyt and a transcriptome approach were performed with Arabidopsis roots subjected to short-term B deficiency.

2. Results and discussion 2.1. Calcium cytosolic levels are modified under B deficiency Recently it has been shown that B deprivation induced the fast expression of stress-responsive genes in cultured tobacco BY-2 cells and also that B-deprived cells took up more Ca2þ than control cells [22]. To assess whether root [Ca2þ]cyt is actually affected in vivo by short-term B deficiency, fluorescence measurements in Arabidopsis seedling roots expressing YC3.6 were carried out after 6 and 24 h of B deficiency (Fig. 1). Yellow cameleons (YC) consist of a donor chromophore (CFP), calmodulin (CaM), a glycylglycine linker, the CaMbinding peptide of myosin light-chain kinase (M13), and an acceptor chromophore (YFP) [31]. Ca2þ is bound to CaM and causes an intramolecular interaction between CaM and M13 which leads to conformational changes resulting in an increased FRET-efficiency between CFP and YFP [31,32]. There was a significant increase in fluorescence levels in B-deficient roots (Fig. 1C,D), which was more marked in 24 h B-deprived roots (Fig. 1D). Since Arabidopsis expressing YC3.6 allows to visualize in vivo changes in [Ca2þ]cyt, that increased fluorescence is very probably due to the enhancement of [Ca2þ]cyt [32,33]. These results are consistent with those reported by Koshiba et al. [22] in cultures of tobacco BY-2 cells. In our knowledge, it is the first time that changes in the [Ca2þ]cyt are shown in vivo Arabidopsis roots subjected to short-term B deficiency. 2.2. Several Ca2þ channel/transporter genes are upregulated under B deficiency Cytoplasmic Ca2þ signals are a consequence of influx and efflux activities performed by specific membrane channels and transporters. Thus, the balance between Ca2þ influx and efflux determines the magnitude and duration of cytosolic Ca2þ changes. The efflux of cytosolic Ca2þ is a process that requires energy while Ca2þ influx is thermodynamically passive. Plant cyclic nucleotide-

Fig. 1. Fluorescence images of roots from Arabidopsis seedlings expressing the FRET-based Ca2þ sensor UbiQ10:YC3.6-bar#22-2. Seedlings were subjected (C, D) or not (A, B) to B deprivation for 6- (A, C) or 24-h (B, D) period. Fluorescence was monitored using settings for cpVenus excitation and emission. Increase in the FRET reflects higher [Ca2þ]cyt levels. For more details see Materials and methods. Representative images: (A) n ¼ 10 roots; (B) n ¼ 12 roots; (C) n ¼ 11 roots; (D) n ¼ 19 roots. Scale bars represent 250 mm.

Table 1 Expression levels of Ca2þ-related genes in roots of Arabidopsis seedlings subjected () or not (þ) to B deficiency for 24 h. Differential expression levels were expressed on a fold change basis (FC, signal from B deficiency/signal from B sufficiency). Background correction and normalization of expression data were performed as explained in Materials and methods. p-Values for all FC shown were lower than 0.05 and considered statistically significant according to Student’s t-test. Gene description

FC(B/þB)

TAIR ID

24 h Calcium transport genes Cyclic nucleotide-gated ion channel 19 (CNGC19) Plastid envelope PIIB-type Ca2þ-ATPase (ACA1) Plasma membrane PIIB-type Ca2þ-ATPase 10 (ACA10) Plasma membrane PIIB-type Ca2þ-ATPase 12 (ACA12) Putative plasma membrane PIIB-Ca2þ-ATPase 13 (ACA13) Vacuolar cation/proton exchanger 3 (CAX3)

2.74 1.43 1.28

At3g17690 At1g27770 At4g29900

1.32

At3g63380

1.48

At3g22910

1.48

At3g51860

Ca sensor relay Calmodulin-like protein 11 (CML11) Calmodulin-like protein 12 (CML12) Calmodulin-like protein 23 (CML23) Calmodulin-like protein 24 (CML24) Calmodulin-like protein 30 (CML30) Calmodulin-like protein 37 (CML37) Probable Ca2þ-binding protein CML45 (CML45) Probable Ca2þ-binding protein CML47 (CML47)

1.66 4.51 2.07 1.92 1.87 1.84 2.59 2.36

At3g22930 At2g41100 At1g66400 At5g37770 At3g29000 At5g42380 At5g39670 At3g47480

Ca2þ sensor responder Calcium-dependent protein kinase 1 (CPK1) Calcium-dependent protein kinase 28 (CPK28) Calcium-dependent protein kinase 29 (CPK29)

1.38 1.64 1.63

At5g04870 At5g66210 At1g76040

2þ

1.0

Relative units Relative units

A

CNGC19

B

ACA1

C

ACA10

D

ACA13

E

CAX3

0.6 0.4 0.2 1.0 0.8 0.6 0.4 0.2 0.0 1.0 0.8 0.6 0.4 0.2 0.0

Relative units

57

0.8

0.0

1.0 0.8 0.6 0.4 0.2 0.0

Relative units

gated ion channels (CNGCs) have been proposed as a Ca2þ influx channel [1,34,35]. CNGCs in heterologous systems show permeability to monovalent ions and to Ca2þ as well [36]. Interestingly, our microarray data showed an increased expression of root CNGC19 gene in Arabidopsis seedlings subjected to B starvation for 24 h (Table 1). Furthermore, these results were corroborated by qRT-PCR where CNGC19 mRNA levels were strongly upregulated after 6 h of B deficiency (Fig. 2A). Remarkably, several CNGCs have been implicated in biotic responses to pathogens and regulating ion homeostasis during salt stress, and its interaction with calmodulin has also been reported [37]. Ca2þ pumps and Ca2þ/Hþ antiporters e two types of Ca2þ efflux proteins e transfer Ca2þ out of the cytosol, either to intracellular compartments or to apoplast, after a Ca2þ release [35]. ACAs (autoinhibited Ca2þ-ATPases) are a class of Ca2þ pumps that transport this cation out of cytosol against its electrochemical potential gradient using the energy from ATP hydrolysis [38]. As shown in Table 1, the root expression of four Arabidopsis thaliana ACA genes increased after 24 h of B deficiency. Data from qRT-PCR confirmed a significant upregulation of ACA1, ACA10, and ACA13 genes at 24 h of B deprivation (Fig. 2BeD), being this last gene the most affected one (Fig. 2D). The expression of several ACA genes is also altered by other stresses. For instance, ACA12 and ACA13 genes are dramatically induced upon exposure to pathogens and ACA10 expression responds to cold [36]. These findings suggest that ACA pumps could potentially be involved in B-deficiency tolerance mechanisms. Other type of Ca2þ efflux proteins are Ca2þ/Hþ antiporters. These transporters utilize the pH gradient established by proton pumps e such as Hþ-ATPase or Hþ-pyrophosphatase e to export Ca2þ from the cytosol [39]. Six Ca2þ/Hþ exchangers, known as CAX (cation/Hþ exchanger), have been identified in A. thaliana genome. Root CAX3 transcript levels were higher in B-deficient plants than in B-sufficient ones (Table 1 and Fig. 2E). Interestingly, CAX3 expression is significantly enhanced during Naþ stress [40], and

Relative units

C. Quiles-Pando et al. / Plant Physiology and Biochemistry 65 (2013) 55e60

1.0 0.8 0.6 0.4 0.2 0.0

0

6

24

Time after B treatments (h) Fig. 2. Quantitative real-time PCR analysis of transcript levels in Arabidopsis roots for genes involved in Ca2þ transport: CNGC19 (A), ACA1 (B), ACA10 (C), ACA13 (D) and CAX3 (E) genes. Seedlings were subjected (open bars) or not (filled bars) to B deprivation for a 24-h period. For more details see Materials and methods. The results are given as means  SD (n ¼ 4 pools of 14 separate roots). Asterisks indicate statistically significant differences between plants treated or not with B at the indicated times according to Student’s t-test (P < 0.05).

also, cax3 mutants show increased sensitivity to salt stress compared to wild-type Arabidopsis seedlings [41]. Genetic approaches using knockout mutants of Ca2þ efflux systems suggest that these Ca2þ transporters can change the magnitude and duration of Ca2þ signal in plants [35]. In fact, it has been proposed that these efflux systems play an important role in restoration of [Ca2þ]cyt to prestimulus levels [2,42]. In A. thaliana, ACA1 is localized to the plastid inner envelope membrane, ACA10 and ACA13 are likely placed at the plasma membrane [39], and CAX3 is localized to the tonoplast [43]. Hence, an upregulation of these genes under B starvation could enhance the ability to transport Ca2þ from the cytosol to plastids, apoplast and vacuole. These results suggest that increased expressions of ACA1, ACA10, ACA13 and CAX3 genes could be a response to B deficiency (Fig. 2BeE), thereby generating transient changes in [Ca2þ]cyt through ACA and CAX3 efflux proteins.

C. Quiles-Pando et al. / Plant Physiology and Biochemistry 65 (2013) 55e60

1.0

Relative units

CPK28

B

CPK29

0.8 0.6 0.4 0.2 0.0 1.0 0.8 0.6 0.4 0.2 0.0

0

6

Fig. 4. Quantitative real-time PCR analysis of transcript levels in Arabidopsis roots for genes encoding Ca2þ-dependent protein kinases: CPK28 (A) and CPK29 (B) genes. Seedlings were subjected (open bars) or not (filled bars) to B deprivation for a 24-h period. For more details see Materials and methods. The results are given as means  SD (n ¼ 4 pools of 14 separate roots). Asterisks indicate statistically significant differences between plants treated or not with B at the indicated times according to Student’s t-test (P < 0.05).

reveals the complexity of the Ca2þ signaling pathway and homeostasis [3]. Thus Popescu et al. [49] have reported that CML12, whose gene expression is highly upregulated under short-term B deficiency (Table 1 and Fig. 3A), is bound to CAX2. Furthermore, other protein interactions between CPKs (CPK6 and CPK30) and CaMs/ CMLs (CML12) have been also described by these authors. In addition, ACA pumps have an N-terminal cytosolic domain that binds CaM, so that upon binding of Ca2þ ions, CaM is bound to this ACA domain and activates Ca2þ transport [50]. Therefore, our results showing an increased expression of Ca2þ channel/transporter and sensor genes under B deficiency suggest changes in Ca2þ homeostasis as a response to this nutrition stress.

CML24

1.0 0.8

0.6

0.6

0.4

0.4

0.2

0.2

1.0

C

0.0

CML24 CML47

D

CML45

1.0

0.8

0.8

0.6

0.6

0.4

0.4

0.2

0.2

0.0

0

6

24

24

Time after B treatments (h)

B

CML12

A

0.8

0.0

Relative units

A

1.0

0

6

Relative units

Relative units

Changes in [Ca2þ]cyt are perceived by a large number of Ca2þ binding proteins that act as Ca2þ sensors. In plants, these sensors are classified into two groups, namely, Ca2þ sensor relay and sensor responder [1,3]. Ca2þ relay proteins contain Ca2þ-binding motifs but lack domains with catalytic activity. These proteins must interact with target molecules and regulate their activity to transfer the Ca2þ signal. Calmodulins (CaMs), calmodulin-like proteins (CMLs), and calcineurin B-like (CBLs) proteins belong to this group. Ca2þ sensor responder proteins also bind Ca2þ however, unlike sensor relay ones, they have an effector domain with enzymatic activity (e.g., kinase domain). Calcium-dependent protein kinases (CPKs) are the best characterized protein family inside of this last category [4,36]. Our microarray data showed that the root expressions of various CML genes were significantly affected by B deprivation (Table 1). Quantitative RT-PCR technique was carried out to check the reproducibility of the microarray studies. Root CML12, CML24, CML45 and CML47 transcript levels were overexpressed under B deficiency, this increase being more marked at 24 h after the onset of B starvation (Fig. 3AeD). A variety of abiotic stresses can stimulate a transient [Ca2þ]cyt increase and CaM/CML sensors are frequently induced in response to these stresses [5]. Thus, the expression of CML genes is often induced in response to various abiotic stresses in A. thaliana [44,45]. As above mentioned, a type of Ca2þ sensor are Ca2þ-dependent protein kinases (CPKs). These Ca2þ sensors are able to alter gene expressions by modulating transcription factor activity [46,47], and some of them are activated in response to abiotic stresses [48]. Microarray and qRT-PCR analyses showed that root CPK28 and CPK29 gene expressions were increased under B deficiency, this upregulation being more marked after 24 h (Table 1 and Fig. 4), which could indicate the possible involvement of these CPKs in the early response to this nutrition stress. Recent studies have shown that CaMs/CMLs are involved in the activity regulation of Ca2þ channel/transport systems, which

Relative units

2.3. Several calcium sensor genes are upregulated under B deficiency

24

Relative units

58

0.0

Time after B treatments (h) Fig. 3. Quantitative real-time PCR analysis of transcript levels in Arabidopsis roots for genes encoding calmodulins: CML12 (A), CML24 (B), CML45 (C) and CML47 (D) genes. Seedlings were subjected (open bars) or not (filled bars) to B deprivation for a 24-h period. For more details see Materials and methods. The results are given as means  SD (n ¼ 4 pools of 14 separate roots). Asterisks indicate statistically significant differences between plants treated or not with B at the indicated times according to Student’s t-test (P < 0.05).

C. Quiles-Pando et al. / Plant Physiology and Biochemistry 65 (2013) 55e60

Nevertheless, the possible involvement of hormones [21] or the interaction of B with transcription factors [27] are complementary mechanisms that could be involved in the way of sensing and transmitting B-deprivation signal to the nucleus. 3. Conclusion Taking together all these results, we propose a hypothetical mechanism to explain how Ca2þ could mediate the Arabidopsis response to B-deprivation signal. Firstly, B deficiency would overexpress CNGC19 gene leading to an increased [Ca2þ]cyt (Figs. 1 and 2A; Table 1). This is consistent with the recent proposal that B deprivation facilitates the opening of a certain type of Ca2þ channel in cultured tobacco BY-2 cells [22]. Subsequently, the response of Arabidopsis roots would be an enhancement in the expression of Ca2þ-efflux genes (ACAs and CAXs) (Fig. 2BeE; Table 1). An upregulation of these genes under B starvation could enhance the ability to transport Ca2þ from the cytosol to plastids, apoplast and vacuole and thus restoring the cytosolic Ca2þ homeostasis [1,37]. Further research will be necessary to establish the complex Ca2þ signaling pathway involved in sensing and transferring the response to B deficiency. Therefore, our results suggest that Ca2þ-related genes and [Ca2þ]cyt could be involved in the early response of Arabidopsis roots to B starvation. 4. Materials and methods 4.1. Plant material and growth conditions Seeds of A. thaliana expressing the fluorescence resonance energy transfer (FRET)-based Ca2þ sensor UbiQ10:YC3.6-bar#22-2 [32] were kindly gifted by Prof. Dr. Jörg Kudla (Institut für Biologie und Biotechnologie der Pflanzen, Universität Münster, Germany). These seeds and those of A. thaliana ecotype Col-0 were surfacesterilized as previously described by Camacho-Cristóbal et al. [24]. Sterile seeds were sown in a single horizontal line at 1-cm mark from the top of square (12 cm  12 cm) Petri dishes with a culture medium (CM) containing 1 mM CaCl2, 3 mM KNO3, 0.5 mM MgSO4, 0.75 mM KH2PO4, 12.5 mM NaCl, 12.5 mM FeNaEDTA, 2.5 mM MnCl2, 0.5 mM ZnSO4, 0.25 mM CuSO4, 0.125 mM Na2MoO4, 0.05 mM CoCl2, 2.5 mM 2-(N-morpholino)ethanesulfonic acid (MES), 0.5% (w/v) sucrose. This CM was supplemented with 2 mM H3BO3, its pH adjusted to 5.7 with KOH, and solidified with 1% (w/v) Phytagel. After sowing, the plates were cold-treated at 4  C for 48 h and subsequently placed in vertical position in a growth chamber under a 16 h light/8 h dark regime (120e150 mmol m2 s1 of photosynthetically active radiation), a day/night regime of 25/ 22  C temperature, and 75% relative humidity. Seedlings were grown under this condition for 5e6 days and then sets of seedlings were transferred to fresh CM without adding B (B-deficient plants) and other sets were grown with the respective identical medium but supplemented with 2 mM H3BO3 (control plants for each experiment). Seedlings from each treatment were harvested randomly 0, 6, and 24 h after the onset of the both treatments (zero time corresponded to 1 h after the beginning of the photoperiod) and used for Ca2þ imaging by fluorescence microscopy and gene expression measurements. Analytical-grade compounds were always used to prepare nutrient solutions and reagents. Purified water was obtained by a system consisting of three units (active charcoal, ion exchanger, and reverse osmosis) connected in series to an ELGA water purification system (PURELAB ultra), which supplied water with an electrical resistivity of 18.2 MU cm.

59

4.2. Imaging of cytosolic Ca2þ levels For imaging, Arabidopsis seedlings expressing Yellow Cameleon 3.6 were grown in CM supplemented with 2 mM H3BO3 and then transferred randomly to a fresh CM supplemented with (2 mM, control) and without B as previously described. In vivo root Ca2þ measurements were performed at 6 and 24 h after the onset of the both treatments on an inverted fluorescence microscope (DMI6000B; Leica) equipped with an emission filter wheel (Ludl Electronic Products) and an Orca ER CCD camera (Hamamatsu, http://www. hamamatsu.com) according to Krebs et al. [32]. Excitation was provided by a xenon lamp through a 436/20 nm filter and emission filters were 485/30 nm (ECFP) and 535/40 nm (cpVenus). Image acquisition and ratio calculations were performed using OPENLAB 5.2 software (Perkin Elmer, http://www.cellularimaging.com). To hold the roots in position, each seedling was submerged in CM, with (2 mM, control) or without B, between a slide and a cover slip to create a sandwich to fix the root and proceed with the Ca2þ measurements. 4.3. Microarray, RNA isolation, cDNA synthesis and quantitative real-time PCR analyses For these determinations, Arabidopsis ecotype Col-0 seedlings were grown in CM supplemented with 2 mM H3BO3 and then transferred randomly to a fresh CM supplemented with (2 mM, control) and without B as previously described. Four pools of fourteen roots from each treatment were harvested randomly 0, 6, and 24 h after the onset of the both treatments. Roots were quickly separated, dried with paper towel, frozen in liquid N2 and stored at 80  C until further analyses. Microarray analyses were performed as reported by CamachoCristóbal et al. [24]. Total RNA extraction, cDNA synthesis and quantitative real-time PCR (qRT-PCR) reactions were carried out following [17]. The amplicon of TON1A gene (GenBank ID: AF280058.1) (forward primer: TGTGAGGGATGGAACAAATG; reverse primer: AACGCAGTTGCAAATAAAGGA) was used as an internal control to normalize all data. Gene-specific primers used for the qRT-PCR analysis are shown in supplementary data (Supplementary Table). Efficiency of qRTPCR reactions for all these Arabidopsis genes was higher than 94%. 4.4. Statistical analysis Quantitative RT-PCR reactions were carried out with cDNA synthesized from four pools of fourteen roots harvested randomly. Data are from a representative experiment that was repeated twice with very similar results. The data shown are mean values  SD. Results were statistically analyzed using the Student’s t-test. Regarding Ca2þ imaging by fluorescence microscopy, representative images from 10 to 19 primary roots for each B treatment are shown. Acknowledgments This work was supported by the Ministerio de Ciencia e Innovación (BFU2009-08397) and Junta de Andalucía (BIO-266 and P09CVI-4721), Spain. The authors are deeply grateful to Prof. Dr. Jörg Kudla by useful criticisms and suggestions of the manuscript, as well as by allowing us to perform calcium imaging measurements in his laboratory. C.Q.-P. and A.G.-F. thank Ministerio de Economía y Competitividad (Spain) and Alexander von Humboldt Foundation (Germany), respectively, for granting their research stays in J. Kudla’s lab (University of Münster). The authors thank Dr. Katrin Held for assistance in fluorescence microscopy and Marta Fernández García for skillful technical assistance.

60

C. Quiles-Pando et al. / Plant Physiology and Biochemistry 65 (2013) 55e60

Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.plaphy.2013.01.004. References [1] D. Sanders, J. Pelloux, C. Brownlee, J.F. Harper, Calcium at the crossroads of signaling, Plant Cell 14 (2002) 401e417. [2] A.M. Hetherington, C. Brownlee, The generation of Ca2þ signals in plants, Annu. Rev. Plant Biol. 55 (2004) 401e427. [3] O. Batistic, J. Kudla, Analysis of calcium signaling pathways in plants, Biochim. Biophys. Acta e Gen. Subj. 1820 (2012) 1283e1293. [4] K. Hashimoto, J. Kudla, Calcium decoding mechanisms in plants, Biochimie 93 (2011) 2054e2059. [5] A. Perochon, D. Aldon, J.-P. Galaud, B. Ranty, Calmodulin and calmodulin-like proteins in plant calcium signaling, Biochimie 93 (2011) 2048e2053. [6] P.H. Brown, N. Bellaloui, M.A. Wimmer, E.S. Bassil, J. Ruiz, H. Hu, H. Pfeffer, F. Dannel, V. Römheld, Boron in plant biology, Plant Biol. 4 (2002) 205e223. [7] H.E. Goldbach, M. Wimmer, Boron in plants and animals: is there a role beyond cell-wall structure? J. Plant Nutr. Soil Sci. 170 (2007) 39e48. [8] M. Kobayashi, T. Matoh, J. Azuma, Two chains of rhamnogalacturonan II are cross-linked by borate-diol ester bonds in higher plant cell walls, Plant Physiol. 110 (1996) 1017e1020. [9] J.J. Camacho-Cristóbal, J. Rexach, A. González-Fontes, Boron in plants: deficiency and toxicity, J. Integr. Plant Biol. 50 (2008) 1247e1255. [10] M.B. Herrera-Rodríguez, A. González-Fontes, J. Rexach, J.J. Camacho-Cristóbal, J.M. Maldonado, M.T. Navarro-Gochicoa, Role of boron in vascular plants and response mechanisms to boron stress, Plant Stress 4 (2010) 115e122. [11] Q. Yu, F. Baluska, F. Jasper, D. Menzel, H.E. Goldbach, Short-term boron deprivation enhances levels of cytoskeletal proteins in maize, but not zucchini, root apices, Physiol. Plant. 117 (2003) 270e278. [12] H. Pfeffer, F. Dannel, V. Römheld, Are there connections between phenol metabolism, ascorbate metabolism and membrane integrity in leaves of boron-deficient sunflower plants? Physiol. Plant. 104 (1998) 479e485. [13] J.J. Camacho-Cristóbal, D. Anzellotti, A. González-Fontes, Changes in phenolic metabolism of tobacco plants during short-term boron deficiency, Plant Physiol. Biochem. 40 (2002) 997e1002. [14] M. Kobayashi, T. Mutoh, T. Matoh, Boron nutrition of cultured tobacco BY-2 cells. IV. Genes induced under low boron supply, J. Exp. Bot. 55 (2004) 1441e1443. [15] J.J. Camacho-Cristóbal, A. González-Fontes, Boron deficiency causes a drastic decrease in nitrate content and nitrate reductase activity, and increases the content of carbohydrates in leaves from tobacco plants, Planta 209 (1999) 528e536. [16] J.J. Camacho-Cristóbal, A. González-Fontes, Boron deficiency decreases plasmalemma Hþ-ATPase expression and nitrate uptake, and promotes ammonium assimilation into asparagine in tobacco roots, Planta 226 (2007) 443e451. [17] V.M. Beato, J. Rexach, M.T. Navarro-Gochicoa, J.J. Camacho-Cristóbal, M.B. Herrera-Rodríguez, J.M. Maldonado, A. González-Fontes, A tobacco asparagine synthetase gene responds to carbon and nitrogen status and its root expression is affected under boron stress, Plant Sci. 178 (2010) 289e298. [18] V.M. Beato, M.T. Navarro-Gochicoa, J. Rexach, M.B. Herrera-Rodríguez, J.J. Camacho-Cristóbal, S. Kempa, W. Weckwerth, A. González-Fontes, Expression of root glutamate dehydrogenase genes in tobacco plants subjected to boron deprivation, Plant Physiol. Biochem. 49 (2011) 1350e1354. [19] M. Reguera, M. Wimmer, P. Bustos, H.E. Goldbach, L. Bolaños, I. Bonilla, Ligands of boron in Pisum sativum nodules are involved in regulation of oxygen concentration and rhizobial infection, Plant Cell. Environ. 33 (2010) 1039e1048. [20] W.M. Dugger, Boron in plant metabolism, in: A. Läuchli, R.L. Bieleski (Eds.), Encyclopedia of Plant Physiology, Springer, Berlin, 1983, pp. 626e650. [21] E.M. Martín-Rejano, J.J. Camacho-Cristóbal, M.B. Herrera-Rodríguez, J. Rexach, M.T. Navarro-Gochicoa, A. González-Fontes, Auxin and ethylene are involved in the responses of root system architecture to low boron supply in Arabidopsis seedlings, Physiol. Plant. 142 (2011) 170e178. [22] T. Koshiba, M. Kobayashi, A. Ishihara, T. Matoh, Boron nutrition of cultured tobacco BY-2 cells. VI. Calcium is involved in early responses to boron deprivation, Plant Cell. Physiol. 51 (2010) 323e327. [23] K. Miwa, T. Fujiwara, Boron transport in plants: co-ordinated regulation of transporters, Ann. Bot. 105 (2010) 1103e1108. [24] J.J. Camacho-Cristóbal, M.B. Herrera-Rodríguez, V.M. Beato, J. Rexach, M.T. Navarro-Gochicoa, J.M. Maldonado, A. González-Fontes, The expression of several cell wall-related genes in Arabidopsis roots is downregulated under boron deficiency, Environ. Exp. Bot. 63 (2008) 351e358. [25] J.J. Camacho-Cristóbal, J. Rexach, M.B. Herrera-Rodríguez, M.T. NavarroGochicoa, A. González-Fontes, Boron deficiency and transcript level changes, Plant Sci. 181 (2011) 85e89.

[26] M. Redondo-Nieto, N. Maunoury, P. Mergaert, E. Kondorosi, I. Bonilla, L. Bolaños, Boron and calcium induce major changes in gene expression during legume nodule organogenesis. Does boron have a role in signalling? New Phytol. 195 (2012) 14e19. [27] A. González-Fontes, J. Rexach, M.T. Navarro-Gochicoa, M.B. Herrera-Rodríguez, V.M. Beato, J.M. Maldonado, J.J. Camacho-Cristóbal, Is boron involved solely in structural roles in vascular plants? Plant Signal. Behav. 3 (2008) 24e26. [28] L. Bolaños, M. Martín, A. El-Hamdaoui, R. Rivilla, I. Bonilla, Nitrogenase inhibition in nodules from pea plants grown under salt stress occurs at the physiological level and can be alleviated by B and Ca, Plant Soil 280 (2006) 135e142. [29] I. Bonilla, A. El-Hamdaouia, L. Bolaños, Boron and calcium increase Pisum sativum seed germination and seedling development under salt stress, Plant Soil 267 (2004) 97e107. [30] Y.L. Yu, Y.Z. Li, J.X. Lin, C. Zheng, L.Y. Zhang, Overexpression of PwTUA1, a pollen-specific tubulin gene, increases pollen tube elongation by altering the distribution of a-tubulin and promoting vesicle transport, J. Exp. Bot. 60 (2009) 2737e2749. [31] A. Miyawaki, J. Llopis, R. Heim, J.M. McCaffery, J.A. Adams, M. Ikura, R.Y. Tsien, Fluorescent indicators for Ca2þ based on green fluorescent proteins and calmodulin, Nature 388 (1997) 882e887. [32] M. Krebs, K. Held, A. Binder, K. Hashimoto, G. Den Herder, M. Parniske, J. Kudla, K. Schumacher, FRET-based genetically encoded sensors allow highresolution live cell imaging of Ca2þ dynamics, Plant J. 69 (2012) 181e192. [33] G.B. Monshausen, M.A. Messerli, S. Gilroy, Imaging of the yellow cameleon 3.6 indicator reveals that elevations in cytosolic Ca2þ follow oscillating increases in growth in root hairs of Arabidopsis, Plant Physiol. 147 (2008) 1690e1698. [34] W. Ma, G.A. Berkowitz, Ca2þ conduction by plant cyclic nucleotide gated channels and associated signaling components in pathogen defense signal transduction cascades, New Phytol. 190 (2011) 566e572. [35] E.P. Spalding, J.F. Harper, The ins and outs of cellular Ca2þ transport, Curr. Opin. Plant Biol. 14 (2011) 1e6. [36] A.N. Dodd, J. Kudla, D. Sanders, The language of calcium signaling, Annu. Rev. Plant Biol. 61 (2010) 593e620. [37] J. Kudla, O. Batistic, K. Hashimoto, Calcium signals: the lead currency of plant information processing, Plant Cell 22 (2010) 541e563. [38] I. Baxter, J. Tchieu, M.R. Sussman, M. Boutry, M.G. Palmgren, M. Gribskov, J.F. Harper, K.B. Axelsen, Genomic comparison of P-type ATPase ion pumps in Arabidopsis and rice, Plant Physiol. 132 (2003) 618e628. [39] J.K. Pittman, M.C. Bonza, M.I. De Michelis, Ca2þ pumps and Ca2þ antiporters in plant development, in: M. Geisler, K. Venema (Eds.), Transporters and Pumps in Plant Signaling, Springer-Verlag, Berlin, Heidelberg, 2011, pp. 133e161. [40] N.-H. Cheng, J.K. Pittman, B.J. Barkla, T. Shigaki, K.D. Hirschi, The Arabidopsis cax1 mutant exhibits impaired ion homeostasis, development, and hormonal responses, and reveals interplay among vacuolar transporters, Plant Cell 15 (2003) 347e364. [41] J. Zhao, B.J. Barkla, J. Marshall, J.K. Pittman, K.D. Hirschi, The Arabidopsis cax3 mutants display altered salt tolerance, pH sensitivity and reduced plasma membrane Hþ-ATPase activity, Planta 227 (2008) 659e669. [42] E. Qudeimat, W. Frank, Ca2þ signatures. The role of Ca2þ-ATPases, Plant Signal. Behav. 4 (2009) 350e352. [43] N.-H. Cheng, J.K. Pittman, T. Shigaki, J. Lachmansingh, S. LeClere, B. Lahner, D.E. Salt, K.D. Hirschi, Functional association of Arabidopsis CAX1 and CAX3 is required for normal growth and ion homeostasis, Plant Physiol. 138 (2005) 2048e2060. [44] N. Bouché, A. Yellin, W.A. Snedden, H. Fromm, Plant-specific calmodulinbinding proteins, Annu. Rev. Plant Biol. 56 (2005) 435e466. [45] E. McCormack, Y.-C. Tsai, J. Braam, Handling calcium signaling: Arabidopsis CaMs and CMLs, Trends Plant Sci. 10 (2005) 383e389. [46] H.-I. Choi, H.-J. Park, J.H. Park, S. Kim, M.-Y. Im, H.-H. Seo, Y.-W. Kim, I. Hwang, S.Y. Kim, Arabidopsis calcium-dependent protein kinase AtCPK32 interacts with ABF4, a transcriptional regulator of abscisic acid-responsive gene expression, and modulates its activity, Plant Physiol. 139 (2005) 1750e1761. [47] S.Y. Zhu, X.C. Yu, X.J. Wang, R. Zhao, Y. Li, R.C. Fan, Y. Shang, S.Y. Du, X.F. Wang, F.Q. Wu, Y.H. Xu, X.Y. Zhang, D.P. Zhang, Two calcium-dependent protein kinases, CPK4 and CPK11, regulate abscisic acid signal transduction in Arabidopsis, Plant Cell 19 (2007) 3019e3036. [48] Y. Galon, A. Finklerm, H. Fromm, Calcium-regulated transcription in plants, Mol. Plant 3 (2010) 653e669. [49] S.C. Popescu, G.V. Popescu, S. Bachan, Z. Zhang, M. Seay, M. Gerstein, M. Snyder, S.P. Dinesh-Kumar, Differential binding of calmodulin-related proteins to their targets revealed through high-density Arabidopsis protein microarrays, Proc. Natl. Acad. Sci. U.S.A. 104 (2007) 4730e4735. [50] L. Baekgaard, A.T. Fuglsang, M.G. Palmgren, Regulation of plant plasma membrane Hþ- and Ca2þ-ATPases by terminal domains, J. Bioenerg. Biomembr. 37 (2005) 369e374.