Borrelia miyamotoi is widespread in Ixodes ricinus ticks in southern Norway

G Model TTBDIS-472; No. of Pages 6

ARTICLE IN PRESS Ticks and Tick-borne Diseases xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Ticks and Tick-borne Diseases journal homepage: www.elsevier.com/locate/ttbdis

Original article

Borrelia miyamotoi is widespread in Ixodes ricinus ticks in southern Norway Vivian Kjelland a,b,∗ , Rikke Rollum a , Lars Korslund a , Audun Slettan a , Dag Tveitnes c a b c

University of Agder, Department of Engineering and Science, Kristiansand, Norway Sørlandet Hospital Health Enterprise, Research Unit, Kristiansand, Norway Stavanger University Hospital, Department of Pediatrics, Stavanger University Hospital, Stavanger, Norway

a r t i c l e

i n f o

Article history: Received 19 January 2015 Received in revised form 9 April 2015 Accepted 12 April 2015 Available online xxx Keywords: Borrelia miyamotoi Ixodes ricinus ticks Infection prevalence Real-time PCR Sequencing

a b s t r a c t From April to October 2007, host-seeking Ixodes ricinus ticks were collected from four locations in southern Norway; Farsund, Mandal, Søgne and Tromøy, respectively. Larvae (n = 210), nymphs (n = 1130) and adults (n = 449) were investigated for infection with Borrelia miyamotoi by real-time polymerase chain reaction (PCR) amplification of part of the 16S rRNA gene. Results were verified by direct sequencing of the PCR amplicon generated from the rrs (16S)–rrl (23S) intergenetic spacer. B. miyamotoi was detected at all sites and throughout the period of questing activity, with infection prevalence (≤1.26%) similar to what has been seen in other European countries. Detection of the relapsing fever spirochete at all locations indicates a wide distribution in southern Norway. This is the first report of B. miyamotoi prevalence in ticks collected from Norway. As not much is known about the spatiotemporal dynamics of this relatively recently discovered pathogen, the conclusions of this study significantly add to the knowledge regarding B. miyamotoi in this region. © 2015 Elsevier GmbH. All rights reserved.

Introduction Ticks transmit a wide range of clinically important pathogens, including Borrelia spirochetes. These bacteria are responsible for two well-defined human infections; Lyme borreliosis (LB) and relapsing fever (RF). LB, described just some decades ago, is today regarded as the most frequent human tick-borne disease in the northern hemisphere, coincident with the distribution of Ixodes ticks (Stanek et al., 2012). LB is caused by a few pathogenic genospecies in the B. burgdorferi sensu lato group, and new genotypes in this complex are still being discovered in the intensive study of LB. The pathogenetic genotypes of B. burgdorferi s.l. cause variations of LB, a multisystemic infection with mainly dermal, neural and joint manifestations. RF on the other hand, is less studied but was described as a tick-borne infection already in the beginning of the last century (Cutler, 2010). RF, caused by a different group of Borrelia genospecies transmitted through the bite of argasid and in some cases ixodid ticks, is found on every continent including Europe (Rebaudet & Parola, 2006). In West Africa the average incidence is found to be as high as 11 per 100 person-years, the

∗ Corresponding author at: Department of Engineering and Science, University of Agder, Gimlemoen 25, 4630 Kristiansand, Norway. Tel.: +47 38 14 10 00. E-mail address: [email protected] (V. Kjelland).

highest reported incidence for any bacterial infection in Africa (Vial et al., 2006). RF is also a multisystemic infection, but in contrast to LB which is rarely fatal (Centers for Disease Control and Prevention (CDC), 2013), RF may be lethal during the typical attacks of septicemia and fever (Cadavid & Barbour, 1998; Melkert, 1991). However, both LB and RF are effectively treated with antibiotics (Platonov et al., 2011; Stanek et al., 2012). The tick-borne Borrelia bacteria are traditionally divided into two major groups as described above; the RF Borrelia species, mostly transmitted by argasid ticks, and the LB group, consisting of the B. burgdorferi s.l. group (which includes the causative agents of LB) transmitted by ixodid ticks (Barbour, 2001). However, a third group of Borrelia exists. These bacteria are closer related to the RF Borrelia based on DNA sequences, but they are transmitted by ixodid ticks (Barbour, 2001; Fukunaga et al., 1995). One of these Borrelia genospecies, B. miyamotoi, was first discovered in Japan in 1995 (Fukunaga et al., 1995), and has so far been detected in I. persulcatus (Fukunaga et al., 1995), I. scapularis (Scoles et al., 2001), I. ricinus (Fraenkel et al., 2002), I. pacificus (Mun et al., 2006) and I. dentatus (Hamer et al., 2012). Recently, B. miyamotoi was reported to cause infections in humans (Chowdri et al., 2013; Gugliotta et al., 2013; Hovius et al., 2013; Krause et al., 2013; Platonov et al., 2011). The knowledge on the geographic distribution of B. miyamotoi is only fragmentary. After the first discovery in Japan, the spirochete was detected in North America (Scoles et al., 2001), followed by

http://dx.doi.org/10.1016/j.ttbdis.2015.04.004 1877-959X/© 2015 Elsevier GmbH. All rights reserved.

Please cite this article in press as: Kjelland, V., et al., Borrelia miyamotoi is widespread in Ixodes ricinus ticks in southern Norway. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.04.004

G Model

ARTICLE IN PRESS

TTBDIS-472; No. of Pages 6

V. Kjelland et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx

2 Table 1 Borrelia miyamotoi in questing ticks in Europe. Country

Tick species

B. miyamotoi prevalence

Belgium Czech Republic

I. ricinus I. ricinus

Denmark England Estonia France

I. ricinus I. ricinus I. ricinus I. persulcatus I. ricinus

Germany

I. ricinus

Ireland Netherlands

I. ricinus I. ricinus

Poland Sweden

I. ricinus I. ricinus

1.1% (Cochez et al., 2014) 0–3.2% (Crowder et al., 2014) 0.5% (B. miyamotoi-like) (Hulinska et al., 2007) 0.2–1.3% (Michelet et al., 2014) 0.3% (Hansford et al., 2014) 0.4% (B. miyamotoi European type) 2.7% (B. miyamotoi Asian and European type) (Geller et al., 2012) 2.2% (Vayssier-Taussat et al., 2013) 3% (Cosson et al., 2014) 0.9–2.5% (Michelet et al., 2014) 3.5% (relapsing fever-like Borrelia) (Richter et al., 2003) 1.8% (Crowder et al., 2014) 1.1% (relapsing fever-like Borrelia) (Pichon et al., 2005) 3.8% (Cochez et al., 2014) 2.2–3.4% (Michelet et al., 2014) 2% (Kiewra et al., 2014) 0.7% (B. miyamotoi-like) (Fraenkel et al., 2002) 0.3% (B. miyamotoi-like)* (Wilhelmsson et al., 2010) 2%* (Wilhelmsson et al., 2013)

*

Feeding ticks removed from humans.

the first European report of a B. miyamotoi-like Borrelia in I. ricinus in Sweden (Fraenkel et al., 2002). Subsequently, B. miyamotoi or B. miyamotoi-like Borrelia or RF-like Borrelia has been detected in low prevalence throughout Europe (Table 1). In Norway, as in most of Europe, I. ricinus is the main tick vector of human tick-borne infections (Jore et al., 2011; Stanek et al., 2012). I. ricinus has four developmental stages; egg, larva, nymph and adult, and it is a three-host tick with each stage feeding on a different host from a wide range of animals (Stanek et al., 2012). B. miyamotoi has previously been detected in I. ricinus larvae (Richter et al., 2012), nymphs and adults (Geller et al., 2012). The coastal region of southern Norway is an area where I. ricinus density is at its highest in this country (Jore et al., 2011). The aim of this study was to investigate the distribution of B. miyamotoi infection in host-seeking I. ricinus ticks at separate locations and throughout the period of questing activity in this high tick density area. Furthermore, we aimed to establish the prevalence of B. miyamotoi in all stages of I. ricinus, and finally we wanted to study the co-infection of B. miyamotoi and B. burgdorferi s.l. in host-seeking ticks, in order to uncover endemic properties of an unexplored human pathogen in Norway. Materials and methods Study area and tick collection Host-seeking I. ricinus ticks were collected from four locations in coastal southern Norway; Farsund (58◦ 09 N; 06◦ 80 E), Mandal (58◦ 10 N; 07◦ 54 E), Søgne (58◦ 09 N; 07◦ 76 E) and Tromøy (58◦ 44 N; 08◦ 84 E) (Fig. 1) by flagging the undergrowth with a flannel cloth. Sampling was performed once each April, June, August and October of 2007, and at least 100 ticks were collected from each location at every sampling. Further description of sites and collection method is previously reported (Kjelland et al., 2010). Ticks were identified to species according to Arthur (1963) and Hillyard (1996). DNA extraction

Fig. 1. Host-seeking I. ricinus ticks were collected from four locations in coastal southern Norway; Farsund (1), Mandal (2), Søgne (3) and Tromøy (4) (Map data © 2015 GeoBasis-DE/BKG (© 2009), Google).

Adult and nymphal ticks were processed individually as previously described (Kjelland et al., 2010). Briefly, each tick was cleansed in 70% ethanol and in phosphate buffered saline (PBS), and lightly dried of at a tissue paper. Adult and nymphal ticks were cut longitudinally in two halves using a sterile blade, and larvae

were pooled in groups of ten, before DNA extraction. DNA was extracted by using DNeasy Blood and Tissue Kit (Qiagen) according to manufacturers’ description, with the following modifications; samples were incubated at 56 ◦ C overnight with proteinase K, and

Please cite this article in press as: Kjelland, V., et al., Borrelia miyamotoi is widespread in Ixodes ricinus ticks in southern Norway. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.04.004

G Model

ARTICLE IN PRESS

TTBDIS-472; No. of Pages 6

V. Kjelland et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx

3

Table 2 Sequences for probes and primers used in this study.

a

RF probe RF forward primera RF reverse primera IGS 1 forward primerb IGS 1 reverse primerb IGS 2 forward primerb IGS 2 reverse primerb a b

Sequence (5 –3 )

Reference

6FAM-CGGTACTAACCTTTCGATTA-MGBNFQ 5 GCTGTAAACGATGCACACTTGGT 5 GGCGGCACACTTAACACGTTAG 5 -GTATGTTTAGTGAGGGGGGTG 5 -GGATCATAGCTCAGGTGGTTAG 5 -AGGGGGGTGAAGTCGTAACAAG 5 -GTCTGATAAACCTGAGGTCGGA

Modified from Tsao et al. (2004) Tsao et al. (2004) Tsao et al. (2004) Bunikis et al. (2004) Bunikis et al. (2004) Bunikis et al. (2004) Bunikis et al. (2004)

PCR target: part of the 16S rRNA gene specific for Borrelia miyamotoi. PCR target: part of the rrs (16S)–rrl (23S) intergenetic spacer.

eluted from column in 50 ␮l preheated elution buffer after 5 min incubation. Purified DNA was stored at −20 ◦ C until further analysis. Detection of Borrelia miyamotoi DNA extracts were examined for B. miyamotoi by using a realtime PCR assay with probe and primers specific for a section of the 16S rRNA gene (Tsao et al., 2004) (Table 2). Real-time PCR was performed using StepOnePlus Real Time PCR System (Applied Biosystems Inc. (ABI)). Briefly, the 20 ␮l PCR mixture included 1X ready-to-use reaction mixture (TaqMan Universal PCR Master Mix, ABI) containing reaction buffer, AmpliTaq Gold DNA polymerase, deoxynucleoside triphosphates (dNTPs) and MgCl2 . The final concentration of the primers and probe was 1.25 and 0.25 ␮M, respectively. Finally, 4.5 ␮l of template DNA was added. The PCR conditions were as follows: 50 ◦ C for 2 min and 95 ◦ C for 10 min, followed by 55 cycles of 94 ◦ C for 30 s, 53 ◦ C for 30 s, and 72 ◦ C for 30 s. Optical detection of fluorescence intensity was done after each cycle. A sample containing B. miyamotoi from INSTAND-Proficiency Test in Bacterial Genome Detection (Institute für Medizinische Mikrobiologie und Hygiene, Universitätsklinik Regensburg, Germany) was used as positive control. DNA from cultured B. afzelii, B. garinii, B. burgdorferi sensu stricto and B. valaisiana was used as negative controls, and ddH2 O was used as blank control. Positive, negative and blank controls were included in all runs. To avoid PCR contamination, pre-PCR sample processing and PCR amplification were performed in separate rooms.

Sequencing The presence of B. miyamotoi, detected by real-time PCR, was confirmed by direct sequencing of the chromosome located rrs (16S)–rrlA (23S) intergenic spacer (IGS) as previously described (Kjelland et al., 2010). Briefly, the locus was amplified by a nested PCR procedure, comprising 35 cycles for the first reaction (IGS1) and 39 cycles for the second reaction (IGS2). Assays were performed using 6 ␮l template DNA in the first reaction and 3 ␮l of the PCR product in the second reaction. The 25 ␮l reaction mixtures consisted of GeneAmp® 1X PCR Gold buffer (ABI), 1 unit AmpliTaq® Gold DNA Polymerase (ABI), 1 mM GeneAmp® dNTP (deoxynucleoside triphosphate) Blend (ABI), 2.5 mM MgCl2 (ABI) and 0.8 ␮M of each primer (primer sequences are listed in Table 2). The reaction conditions used were as follows: 95 ◦ C for 5 min, 94 ◦ C for 30 s, 52 ◦ C for the first reaction (IGS1) and 57 ◦ C for the second reaction (IGS2) for 30 s, and 74 ◦ C for 3 min. Positive, negative and blank controls were included in all runs. PCR products were sequenced directly in reverse or both directions on a 3130 Genetic Analyzer automated capillary sequencer (ABI). The sequences were analyzed with NCBI BLAST (http://blast.ncbi.nlm.nih.gov/ Blast.cgi) against the nucleotide database to determine the species. Sequence alignment and phylogenetic analyses were performed using ClustalW (European Bioinformatics Institute, Cambridge,

United Kingdom) and the phylogenetic tree was constructed by MEGA version 6 (Tamura et al., 2013). Statistical analyses Due to generally low prevalences, Fisher’s Exact Test was used to examine differences in the prevalence of B. miyamotoi in the I. ricinus ticks accounting for tick stage (two groups) and adult tick sex (two groups), whereas Pearson Chi-Square Test was used to examine differences accounting for location (four groups) and time of sampling (four groups). Calculations were performed using SPSS statistical software, version 22. A probability of P < 0.05 was regarded as statistically significant. Nucleotide sequence accession number Sequences obtained in this investigation have been deposited in GenBank with accession numbers KP988315–KP988324. Results A total of 1789 host-seeking I. ricinus, larvae (n = 210), nymphs (n = 1130) and adults (n = 449), were investigated for infection of B. miyamotoi by real-time PCR. In total, 11 (0.62%) out of all investigated ticks were infected with the spirochete. Due to the 16S sequence conservation across species, the possibility to yield false positive results when using PCRs targeting this region exists. Therefore, the results were confirmed by another method. Identity was verified by direct sequencing of the PCR amplicon generated from the rrs (16S)–rrl (23S) intergenetic spacer (IGS) of 10/11 positive samples, and a BLAST search showed that the obtained sequences matched 97–100% to B. miyamotoi sequences deposited in GenBank. The 10 sequences were identical and were deposited in GenBank (Accession numbers KP988315–KP988324). The sequences were identical to the corresponding sequence in all B. miyamotoi isolates from Åland and Sweden reported in GenBank, except for JX910071 from Sweden, which had a T in position 191, while all other isolates from Sweden, Åland and Norway (this study) had a G at the same site. A phylogenetic tree was constructed based on the 16S–23S rRNA IGS sequence derived in the present study with reference sequences retrieved from GenBank (Fig. 2). 1/11 samples did not yield a satisfying IGS sequence, possibly due to the presence of amplicon derived from more than one Borrelia genospecies in the PCR product. This sample was previously found to be infected by B. afzelii by using a different genotyping method (Kjelland et al., 2010). However, in the present study, B. afzelii was one of several Borrelia species used as negative controls in the real-time PCR targeting the 16S rRNA, and this strain was not detected by this method, suggesting that in the sample in question, B. afzelii infection did not yield a false positive result for B. miyamotoi. The mean infection rate of B. miyamotoi in adult and nymphal I. ricinus ticks was 0.22% (1/449) and 0.89% (10/1130), respectively. However the difference was not statistically significant (P = 0.196).

Please cite this article in press as: Kjelland, V., et al., Borrelia miyamotoi is widespread in Ixodes ricinus ticks in southern Norway. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.04.004

G Model TTBDIS-472; No. of Pages 6

ARTICLE IN PRESS V. Kjelland et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx

4

Fig. 2. Phylogenetic tree based on the DNA sequence of the 16S-23S ribosomal RNA intergenic spacer region of selected Borrelia miyamotoi strains, constructed by the Maximum Likelihood method based on the Kimura 2-parameter model, with a bootstrap value of 500 replicates. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site, as indicated by the scale bar. All reference sequences were retrieved from GenBank and source is given by the accession number followed by the place of origin. Since all 10 isolates from Norway (this study) gave identical sequence, only one is shown here. For the same reason, only one sequence from the isolates from Sweden and Åland is shown.

Furthermore, no difference in the overall prevalence of infection in male and female adult ticks was found, with 0.44% (1/230) infected females and no infected males (N = 219) (P = 1). B. miyamotoi infection was not detected in any of the pools of larvae. The total percentage of nymphal and adult ticks infected with B. miyamotoi was determined as 0.51% (2/390), 0.25% (1/397), 0.76% (3/394) and 1.26% (5/398) in Farsund, Mandal, Søgne, and Tromøy, respectively, giving no significant difference in prevalence between different locations (P = 0.369). B. miyamotoi was detected in ticks throughout the period of questing activity, with 1.25% (5/400) infected ticks in April, 0.20% (1/490) in June, 0.24% (1/418) in August and 0.83% (4/481) in October. The spirochete was detected in nymphal ticks at all times of collection, and in one adult tick collected in October. No significant differences in infection prevalence were seen when comparing time of tick collection (P = 0.149). Mixed infection of B. burgdorferi s.l. and B. miyamotoi was found in one I. ricinus tick; a nymph was co-infected with B. afzelii. Discussion Distribution of Borrelia miyamotoi in questing ticks The present study is the first to describe the prevalence of B. miyamotoi in questing nymphal and adult I. ricinus in Norway. In accordance with other European studies (Table 1), a widespread prevalence of B. miyamotoi was detected in southern Norway. Furthermore, the spirochete was detected at all times of tick collection in the period April - October. Previously, the distribution and prevalence of B. burgdorferi s.l. in the 1789 I. ricinus ticks analyzed in the present study were reported (Kjelland et al., 2010), and variations in infection prevalence were seen between locations. Furthermore, a peak in infection prevalence was seen in late summer. However, no significant difference was found in B. miyamotoi infection prevalence between locations, or when comparing time of tick collection. The findings indicate that the prevalence of B. miyamotoi is endemic in the study area. The distance between the two locations farthest apart in the present study is 170 km, however, the spirochete has been detected also in geographical locations 250 km outside of the study area (data not shown), and we hypothesize that B. miyamotoi is found in the entire tick endemic coastal region of Norway up to the polar circle, however this needs further studies. Prevalence of Borrelia miyamotoi in questing ticks The prevalence of B. miyamotoi in ticks was similar to that reported for I. ricinus collected from other European countries,

which ranged from 0.2% in Denmark to 3.8% in the Netherlands (Table 1). I. ricinus ticks acquire Borrelia bacteria primarily through blood meals, and the risk of infection increases with the number of blood hosts. Consequently, a higher Borrelia infection prevalence may be expected in adults compared to nymphal ticks. However, if the nymphal ticks feed mainly on incompetent reservoir hosts such as deer a dilution effect of B. burgdorferi s.l. infection in the ticks may be seen (Kurtenbach et al., 2006). Whether this is true also for B. miyamotoi is so far unknown. The overall percentage of B. miyamotoi in nymphal and adult I. ricinus ticks was determined as 0.89% and 0.22%, respectively, however the difference was not statistically significant. Due to the low number of infected ticks (10/1130 nymphs and 1/449 adults), a higher number of samples may be necessary to find any significant difference in B. miyamotoi infection prevalence between tick stages. However, also a previous study reported no significant difference in infection prevalence between nymphal and adult I. ricinus ticks (Geller et al., 2012). B. miyamotoi infection was not detected in any pools (N = 21) of larvae in present study. The larvae in an egg batch tend to cluster after hatching, and due to the low prevalence in adult females, larvae from a high number of females are needed to predict prevalence of infection in questing larvae collected from the vegetation. In present study the analyzed larvae were collected from all four locations, ensuring that they derived from several females. However, as a low number of larvae (N = 210) were analyzed, we cannot exclude that transovarial transmission may occur. Previous studies have shown that B. miyamotoi, like several RF Borrelia, is often transmitted transovarily from the infected I. scapularis female to her offspring (Scoles et al., 2001; Barbour et al., 2009) and transovarial transmission of the spirochete has been demonstrated also in I. ricinus ticks (Richter et al., 2012). Lack of positive larvae in our study might suggest that transovarial transmission is low in I. ricinus. Dibernardo et al. (2014) suggested that the low B. miyamotoi prevalence in Canada (<1%) compared to in eastern USA (1–5%) may be due to the spirochete being in an early state of establishment among resident ticks and rodent populations in Canada. As Norway is part of the northern distribution limit for I. ricinus, with an increasing tick abundance (Jore et al., 2011) and the present widespread detection of a so far unknown pathogen in the region, the same explanation may be proposed for our region; however, as the prevalence of B. miyamotoi is low in ticks throughout Europe, other (or additional) explanations may be more likely. The observed (small) differences between countries may be due to different sample preparation and different PCR protocols; however it is well known that the infection prevalence of B. burgdorferi s.l. spirochetes in I. ricinus ticks varies between geographical regions, and seems to be influenced by the nature of the habitat, in particular which tick

Please cite this article in press as: Kjelland, V., et al., Borrelia miyamotoi is widespread in Ixodes ricinus ticks in southern Norway. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.04.004

G Model TTBDIS-472; No. of Pages 6

ARTICLE IN PRESS V. Kjelland et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx

hosts that are found in the area (Kurtenbach et al., 2006). So far, few studies have examined the biological, geographical and other intrinsic factors that may influence the survival and spread of B. miyamotoi in ticks and host animals. Further research, for instance determination of the identity of reservoir hosts, the length of survival in ticks and in reservoir hosts, the efficiency of transovarial and transstadial transmission, as well as the mechanisms and efficiency of transmission from infected ticks to their blood hosts during feeding, is necessary to elucidate the ecological cycle of this spirochete. Co-infections The overall percentage of B. burgdorferi s.l. in the 1789 I. ricinus ticks analyzed in the present study was previously determined to be 24.5% in nymphal I. ricinus ticks and 26.9% in adult I. ricinus ticks (Kjelland et al., 2010). The most prevalent B. burgdorferi genospecies identified was B. afzelii (61.6%), followed by B. garinii (23.4%), B. burgdorferi sensu stricto (10.6%) and B. valaisiana (4.5%). The remaining DNA extracts from these ticks were used to investigate the possible presence of RF group Borrelia. As expected due to the low B. miyamotoi prevalence in ticks, mixed infection of B. burgdorferi s.l. and B. miyamotoi was rare. Co-infection was found in one I. ricinus tick; a nymph was co-infected with B. afzelii. Mixed infection of B. burgdorferi s.l. in these ticks was earlier reported and only found in 0.3% (1/399) Borrelia-infected I. ricinus tick (Kjelland et al., 2010). In Europe, co-infection with two or more B. burgdorferi s.l. genotypes in the same tick is well documented (Rauter & Hartung, 2005), and may affect the presentation of clinical manifestations in infected individuals as the various genotypes are associated with various symptoms (Balmelli & Piffaretti, 1995). However, little is known about the co-existence of B. burgdorferi s.l. and B. miyamotoi, and how co-infection may develop in patients. Our results demonstrate that ticks may be simultaneously infected with B. miyamotoi and LB spirochetes, demonstrating the importance of awareness regarding possible co-infection in humans.

5

possibly due to serological cross-reactions with the B. burgdorferi group and/or due to the low prevalence leading to few human cases overall. However, the recent report of human infection in the Netherlands (Hovius et al., 2013) suggests that surveillance needs to be improved. During the last decades, the abundance of I. ricinus ticks seems to have increased in northern Europe partly due to climatic changes, increased roe deer abundance and changes in habitat structure, and it is possible that this will cause a continued increase in incidence of tick-borne diseases (Randolph, 2004). The implications of the seemingly wide geographic range of B. miyamotoi in I. ricinus for human disease are at present unknown and require further investigation. Conclusion Knowledge of the distribution of pathogens within the tick vector, in Norway mainly I. ricinus, may provide important information on risk of various clinical manifestations of tick-borne diseases. In the present study, B. miyamotoi was detected at all locations and seems to be widespread in southern Norway. Furthermore, the spirochete was detected at all times of collection (April–October). Despite the low prevalence reported (total 0.62%), RF-causing bacteria transmitted by I. ricinus ticks should be considered as a potential diagnosis for patients who present with fever after a tick bite in Norway. Acknowledgments This work was supported by Regional research fund Agder (RFF Agder). We are grateful to Dr. Eva Ruzic-Sabljic and her group at the Institute of Microbiology and Immunology, Faculty of Medicine, University of Ljubljana, for providing Borrelia strains. We also thank the two anonymous reviewers for their time and valuable comments.

Human Borrelia miyamotoi infection

References

Since 2011 there have been several reports concluding that B. miyamotoi may be a new pathogen of human infections (Chowdri et al., 2013; Gugliotta et al., 2013; Hovius et al., 2013; Krause et al., 2013; Platonov et al., 2011). The symptoms of RF are typically characterized by recurrent febrile episodes and spirochetemia, and severity of disease depending on infecting Borrelia genospecies (Rebaudet & Parola, 2006). Case reports from Russia, the United States and Europe describe the clinical picture of B. miyamotoi infection as influenza-like illness with fever (Platonov et al., 2011), viral-like illness (Krause et al., 2013), or symptoms similar to those arising from anaplasmosis (Chowdri et al., 2013). In immunocompromised patients, severe illness with meningoencephalitis is reported from the United States and Europe (Gugliotta et al., 2013; Hovius et al., 2013). However, the clinical picture of a B. miyamotoi infection has yet to be properly described in humans. Furthermore, validated diagnostic tools to verify human infection of B. miyamotoi are still missing. It is uncertain whether the lack of disease reports from the northern parts of Europe, despite the detection of the pathogen in questing ticks, is due to lack of diagnosing or reporting of the disease, or the presence of a less pathogenic subspecies. Three distinct genotypes of B. miyamotoi have been identified in the United States, Europe, and Japan (Crowder et al., 2014). So far, most reported B. miyamotoi sequences from patients belong to the Asian group of the spirochete (Platonov et al., 2011). This is most often detected in I. persulcatus, however it has also been detected in I. ricinus (Geller et al., 2012). It is unclear whether the European group is non-pathogenic or if there is an underreporting of human cases,

Arthur, D.A., 1963. British Ticks. Butterworths, London. Balmelli, T., Piffaretti, J.C., 1995. Association between different clinical manifestations of Lyme disease and different species of Borrelia burgdorferi sensu lato. Res. Microbiol. 146 (4), 329–340. Barbour, A., 2001. Borrelia: A Diverse and Ubiquitous Genus of Tick-Borne Pathogens (Vol. 5). American Society for Microbiology Press, Washington, DC. Barbour, A.G., Bunikis, J., Travinsky, B., Hoen, A.G., Diuk-Wasser, M.A., Fish, D., Tsao, J.I., 2009. Niche partitioning of Borrelia burgdorferi and Borrelia miyamotoi in the same tick vector and mammalian reservoir species. Am. J. Trop. Med. Hyg. 81 (6), 1120–1131, http://dx.doi.org/10.4269/ajtmh.2009.09-0208 Bunikis, J., Garpmo, U., Tsao, J., Berglund, J., Fish, D., Barbour, A.G., 2004. Sequence typing reveals extensive strain diversity of the Lyme borreliosis agents Borrelia burgdorferi in North America and Borrelia afzelii in Europe. Microbiology 150 (Pt 6), 1741–1755, http://dx.doi.org/10.1099/mic.0.26944-0 Cadavid, D., Barbour, A.G., 1998. Neuroborreliosis during relapsing fever: review of the clinical manifestations, pathology, and treatment of infections in humans and experimental animals. Clin. Infect. Dis. 26 (1), 151–164. Centers for Disease Control Prevention (CDC), 2013. Three sudden cardiac deaths associated with Lyme carditis – United States, November 2012–July 2013. MMWR 62 (49), 993–996. Chowdri, H.R., Gugliotta, J.L., Berardi, V.P., Goethert, H.K., Molloy, P.J., Sterling, S.L., Telford, S.R., 2013. Borrelia miyamotoi infection presenting as human granulocytic anaplasmosis: a case report. Ann. Intern. Med. 159 (1), 21–27, http://dx. doi.org/10.7326/0003-4819-159-1-201307020-00005 Cochez, C., Heyman, P., Heylen, D., Fonville, M., Hengeveld, P., Takken, W., Simons, L., Sprong, H., 2014. The Presence of Borrelia miyamotoi, A Relapsing Fever Spirochaete, in Questing Ixodes ricinus in Belgium and in The Netherlands. Zoonoses Public Health, http://dx.doi.org/10.1111/zph.12154 Cosson, J.F., Michelet, L., Chotte, J., Le Naour, E., Cote, M., Devillers, E., Poulle, M.-L., Huet, D., Galan, M., Geller, J., Moutailler, S., Vayssier-Taussat, M., 2014. Genetic characterization of the human relapsing fever spirochete Borrelia miyamotoi in vectors and animal reservoirs of Lyme disease spirochetes in France. Parasit. Vectors 7, 233, http://dx.doi.org/10.1186/1756-3305-7-233 Crowder, C.D., Carolan, H.E., Rounds, M.A., Honig, V., Mothes, B., Haag, H., Nolte, O., Luft, B.J., Grubhoffer, L., Ecker, D.J., Schutzer, A.E., Eshoo, M.W., 2014. Prevalence of Borrelia miyamotoi in Ixodes ticks in Europe and the United States. Emerg. Infect. Dis. 20 (10), 1678–1682, http://dx.doi.org/10.3201/eid2010.131583

Please cite this article in press as: Kjelland, V., et al., Borrelia miyamotoi is widespread in Ixodes ricinus ticks in southern Norway. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.04.004

G Model TTBDIS-472; No. of Pages 6 6

ARTICLE IN PRESS V. Kjelland et al. / Ticks and Tick-borne Diseases xxx (2015) xxx–xxx

Cutler, S.J., 2010. Relapsing fever-a forgotten disease revealed. J. Appl. Microbiol. 108 (4), 1115–1122, http://dx.doi.org/10.1111/j. 1365-2672.2009.04598.x Dibernardo, A., Cote, T., Ogden, N.H., Lindsay, L.R., 2014. The prevalence of Borrelia miyamotoi infection, and co-infections with other Borrelia spp. in Ixodes scapularis ticks collected in Canada. Parasit. Vectors 7, 183, http://dx.doi.org/10.1186/ 1756-3305-7-183 Fraenkel, C.J., Garpmo, U., Berglund, J., 2002. Determination of novel Borrelia genospecies in Swedish Ixodes ricinus ticks. J. Clin. Microbiol. 40 (9), 3308–3312. Fukunaga, M., Takahashi, Y., Tsuruta, Y., Matsushita, O., Ralph, D., McClelland, M., Nakao, M., 1995. Genetic and phenotypic analysis of Borrelia miyamotoi sp. nov., isolated from the ixodid tick Ixodes persulcatus, the vector for Lyme disease in Japan. Int. J. Syst. Bacteriol. 45 (4), 804–810. Geller, J., Nazarova, L., Katargina, O., Jarvekulg, L., Fomenko, N., Golovljova, I., 2012. Detection and genetic characterization of relapsing fever spirochete Borrelia miyamotoi in Estonian ticks. PLoS ONE 7 (12), e51914, http://dx.doi.org/10.1371/ journal.pone.0051914 Gugliotta, J.L., Goethert, H.K., Berardi, V.P., Telford 3rd., S.R., 2013. Meningoencephalitis from Borrelia miyamotoi in an immunocompromised patient. N. Engl. J. Med. 368 (3), 240–245, http://dx.doi.org/10.1056/NEJMoa1209039 Hamer, S.A., Hickling, G.J., Keith, R., Sidge, J.L., Walker, E.D., Tsao, J.I., 2012. Associations of passerine birds, rabbits, and ticks with Borrelia miyamotoi and Borrelia andersonii in Michigan, U.S.A. Parasit. Vectors 5, 231, http://dx.doi.org/10.1186/ 1756-3305-5-231 Hansford, K.M., Fonville, M., Jahfari, S., Sprong, H., Medlock, J.M., 2014. Borrelia miyamotoi in host-seeking Ixodes ricinus ticks in England. Epidemiol. Infect., 1–9, http://dx.doi.org/10.1017/S0950268814001691 Hillyard, P.D., 1996. Ticks of North-West Europe. In: Barnes, R.S.K., Chrothers, J.H. (Eds.), Synopsis of the British Fauna (New Series), Vol. 52. Field Studies Council, Shrewsbury. Hovius, J.W., de Wever, B., Sohne, M., Brouwer, M.C., Coumou, J., Wagemakers, A., Oei, A., Knol, H., Narasimhan, S., Hodiamont, C.J., Jahfari, S., Pals, S.T., Horlings, H.M., Fikrig, E., Sprong, H., van Oers, M.H., 2013. A case of meningoencephalitis by the relapsing fever spirochaete Borrelia miyamotoi in Europe. Lancet 382 (9892), 658, http://dx.doi.org/10.1016/S0140-6736(13)61644-X Hulinska, D., Votypka, J., Kriz, B., Holinkova, N., Novakova, J., Hulinsky, V., 2007. Phenotypic and genotypic analysis of Borrelia spp. isolated from Ixodes ricinus ticks by using electrophoretic chips and real-time polymerase chain reaction. Folia Microbiol. (Praha) 52 (4), 315–324. Jore, S., Viljugrein, H., Hofshagen, M., Brun-Hansen, H., Kristoffersen, A.B., Nygard, K., Brun, E., Ottesen, P., Saevik, B.K., Ytrehus, B., 2011. Multi-source analysis reveals latitudinal and altitudinal shifts in range of Ixodes ricinus at its northern distribution limit. Parasit. Vectors 4, 84, http://dx.doi.org/10.1186/1756-3305-484 Kiewra, D., Stanczak, J., Richter, M., 2014. Ixodes ricinus ticks (Acari, Ixodidae) as a vector of Borrelia burgdorferi sensu lato and Borrelia miyamotoi in Lower Silesia, Poland-preliminary study. Ticks Tick Borne Dis. 5 (6), 892–897, http://dx.doi. org/10.1016/j.ttbdis.2014.07.004 Kjelland, V., Stuen, S., Skarpaas, T., Slettan, A., 2010. Prevalence and genotypes of Borrelia burgdorferi sensu lato infection in Ixodes ricinus ticks in southern Norway. Scand. J. Infect. Dis. 42 (8), 579–585, http://dx.doi.org/10.3109/ 00365541003716526 Krause, P.J., Narasimhan, S., Wormser, G.P., Rollend, L., Fikrig, E., Lepore, T., Barbour, A., Fish, D., 2013. Human Borrelia miyamotoi infection in the United States. N. Engl. J. Med. 368 (3), 291–293, http://dx.doi.org/10.1056/NEJMc1215469 Kurtenbach, K., Hanincova, K., Tsao, J.I., Margos, G., Fish, D., Ogden, N.H., 2006. Fundamental processes in the evolutionary ecology of Lyme borreliosis. Nat. Rev. Microbiol. 4 (9), 660–669, http://dx.doi.org/10.1038/nrmicro1475

Melkert, P.W., 1991. Mortality in high risk patients with tick-borne relapsing fever analysed by the Borrelia-index. East Afr. Med. J. 68 (11), 875–879. Michelet, L., Delannoy, S., Devillers, E., Umhang, G., Aspan, A., Juremalm, M., Chirico, J., van der Wal, F.J., Sprong, H., Boye Phil, T.P., Klitgaard, K., Bodker, R., Fach, P., Moutailler, S., 2014. High-throughput screening of tick-borne pathogens in Europe. Front. Cell. Infect. Microbiol. 4, 103, http://dx.doi.org/10.3389/fcimb. 2014.00103 Mun, J., Eisen, R.J., Eisen, L., Lane, R.S., 2006. Detection of a Borrelia miyamotoi sensu lato relapsing-fever group spirochete from Ixodes pacificus in California. J. Med. Entomol. 43 (1), 120–123. Pichon, B., Rogers, M., Egan, D., Gray, J., 2005. Blood-meal analysis for the identification of reservoir hosts of tick-borne pathogens in Ireland. Vector Borne Zoonotic Dis. 5 (2), 172–180, http://dx.doi.org/10.1089/vbz.2005.5.172 Platonov, A.E., Karan, L.S., Kolyasnikova, N.M., Makhneva, N.A., Toporkova, M.G., Maleev, V.V., Fish, D., Krause, P.J., 2011. Humans infected with relapsing fever spirochete Borrelia miyamotoi, Russia. Emerg. Infect. Dis. 17 (10), 1816–1823, http://dx.doi.org/10.3201/eid1710.101474 Randolph, S.E., 2004. Evidence that climate change has caused ‘emergence’ of tickborne diseases in Europe? Int. J. Med. Microbiol. 293 (Suppl. 37), 5–15. Rauter, C., Hartung, T., 2005. Prevalence of Borrelia burgdorferi sensu lato genospecies in Ixodes ricinus ticks in Europe: a metaanalysis. Appl. Environ. Microbiol. 71 (11), 7203–7216, http://dx.doi.org/10.1128/AEM.71.11. 7203-7216.2005 Rebaudet, S., Parola, P., 2006. Epidemiology of relapsing fever borreliosis in Europe. FEMS Immunol. Med. Microbiol. 48 (1), 11–15, http://dx.doi.org/10.1111/j.157495X.2006.00104.x Richter, D., Schlee, D.B., Matuschka, F.R., 2003. Relapsing fever-like spirochetes infecting European vector tick of Lyme disease agent. Emerg. Infect. Dis. 9 (6), 697–701, http://dx.doi.org/10.3201/eid0906.020459 Richter, D., Debski, A., Hubalek, Z., Matuschka, F.R., 2012. Absence of Lyme disease spirochetes in larval Ixodes ricinus ticks. Vector Borne Zoonotic Dis. 12 (1), 21–27, http://dx.doi.org/10.1089/vbz.2011.0668 Scoles, G.A., Papero, M., Beati, L., Fish, D., 2001. A relapsing fever group spirochete transmitted by Ixodes scapularis ticks. Vector Borne Zoonotic Dis. 1 (1), 21–34. Stanek, G., Wormser, G.P., Gray, J., Strle, F., 2012. Lyme borreliosis. Lancet 379 (9814), 461–473, http://dx.doi.org/10.1016/S0140-6736(11)60103-7 Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729. Tsao, J.I., Wootton, J.T., Bunikis, J., Luna, M.G., Fish, D., Barbour, A.G., 2004. An ecological approach to preventing human infection: vaccinating wild mouse reservoirs intervenes in the Lyme disease cycle. Proc. Natl. Acad. Sci. U. S. A. 101 (52), 18159–18164, http://dx.doi.org/10.1073/pnas.0405763102 Vayssier-Taussat, M., Moutailler, S., Michelet, L., Devillers, E., Bonnet, S., Cheval, J., Hebert, C., Eloit, M., 2013. Next generation sequencing uncovers unexpected bacterial pathogens in ticks in western Europe. PLoS ONE 8 (11), e81439, http:// dx.doi.org/10.1371/journal.pone.0081439 Vial, L., Diatta, G., Tall, A., Ba el, H., Bouganali, H., Durand, P., Sokhna, C., Rogier, C., Renaud, F., Trape, J.F., 2006. Incidence of tick-borne relapsing fever in west Africa: longitudinal study. Lancet 368 (9529), 37–43, http://dx.doi.org/10.1016/ S0140-6736(06)68968-X Wilhelmsson, P., Fryland, L., Borjesson, S., Nordgren, J., Bergstrom, S., Ernerudh, J., Forsberg, P., Lindgren, P.E., 2010. Prevalence and diversity of Borrelia species in ticks that have bitten humans in Sweden. J. Clin. Microbiol. 48 (11), 4169–4176, http://dx.doi.org/10.1128/JCM. 01061-10 Wilhelmsson, P., Lindblom, P., Fryland, L., Ernerudh, J., Forsberg, P., Lindgren, P.E., 2013. Prevalence, diversity, and load of Borrelia species in ticks that have fed on humans in regions of Sweden and Aland Islands, Finland with different Lyme borreliosis incidences. PLoS ONE 8 (11), e81433, http://dx.doi.org/10. 1371/journal.pone.0081433.

Please cite this article in press as: Kjelland, V., et al., Borrelia miyamotoi is widespread in Ixodes ricinus ticks in southern Norway. Ticks Tick-borne Dis. (2015), http://dx.doi.org/10.1016/j.ttbdis.2015.04.004