- Email: [email protected]
Boule gene expression underpins the meiotic arrest in spermatogenesis in male rainbow trout (Oncorhynchus mykiss) exposed to DEHP and butachlor
General and Comparative Endocrinology xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen
Boule gene expression underpins the meiotic arrest in spermatogenesis in male rainbow trout (Oncorhynchus mykiss) exposed to DEHP and butachlor Sohrab Ahmadivand a,⇑, Hamid Farahmand b, Ladan Teimoori-Toolabi c, Alireza Mirvaghefi b, Soheil Eagderi b, Tom Geerinckx d, Sara Shokrpoor e, Hooman Rahmati-Holasoo a a
Department of Aquatic Animal Health, Faculty of Veterinary Medicine, University of Tehran, P.O. Box: 14155-6453, Tehran, Iran Department of Fisheries, Faculty of Natural Resources, University of Tehran, P.O. Box 4314, Karaj, Iran c Molecular Medicine Department, Biotechnology Research Center, Pasteur Institute of Iran, P.O. Box: 13169-43551, Tehran, Iran d Department of Biology, Evolutionary Morphology of Vertebrates, Ghent University (UGent), 9000 Ghent, Belgium e Department of Pathology, Faculty of Veterinary Medicine, University of Tehran, P.O. Box: 14155-6453, Tehran, Iran b
a r t i c l e
i n f o
Article history: Received 14 February 2015 Revised 25 April 2015 Accepted 7 May 2015 Available online xxxx Keywords: Boule Azoospermia Testes DEHP Butachlor Trout
a b s t r a c t Boule, the ancestor of the DAZ (Deleted in AZoospermia) gene family, in most organisms is mainly involved in male meiosis. The present study investigates the effects of the plasticizer DEHP (50 mg/kg body weight) and herbicide butachlor (0.39 mg/L) on male rainbow trout (Oncorhynchus mykiss) for a 10-day period in two independent experiments. The results showed that plasma testosterone (T) concentrations were significantly lower in fish exposed to either DEHP or butachlor compared to the control fish (P < 0.05). Fish showed a significantly elevated hepatosomatic index (HSI) in the butachlor treatment (P < 0.05). However, no significant difference was observed in HSI values in the DEHP treatment (P > 0.05). In addition, no significant differences were found in the gonadosomatic index (GSI) in both DEHP and butachlor treatments (P > 0.05). Histologically, testes of male trout in the control groups were well differentiated and filled with large numbers of cystic structures containing spermatozoa. In contrast, the testes of male trout contained mostly spermatocytes with few spermatozoa in both treated group, suggesting that DEHP and butachlor may inhibit the progression of meiosis. Also, boule gene expression was significantly lower in the testes of male trout affected by DEHP and butachlor in comparison with their control groups (P < 0.05), which confirmed the meiotic arrest in affected trout. Based on the results, the present study demonstrated that DEHP and butachlor can inhibit the progression of spermatogenesis in male trout, potentially by causing an arrest of meiosis, maybe due to down-regulation of boule gene expression through T and/or IGF1 via ERK1/2 signaling in T-independent pathways. In addition, these results confirmed that boule can be considered as a predictive marker to assess meiotic efficiency. Ó 2015 Elsevier Inc. All rights reserved.
1. Introduction Spermatogenesis is a complex physiological process in which a series of mitotic and meiotic divisions of diploid spermatogonia results in mature spermatozoa carrying a haploid, recombined genome, with a complex regulation at the levels of transcription and translation of many genes (Urano et al., 2005). The meiosis alone may require expression of more than 900 genes in zebrafish (Schulz et al., 2010). Some of these genes are highly conserved, and, when suffering a mutation, can lead to an arrest of spermatogenesis at a specific stage (Xu et al., 2003). ⇑ Corresponding author. Fax: +982166933222. E-mail address: [email protected] (S. Ahmadivand).
DAZ (Deleted in AZoospermia) gene family members are the most commonly defined cause of spermatogenic failure (Reijo et al., 1995; Foresta et al., 1997). The boule gene, the ancestor of the DAZ gene family, has an origin going back to 600 million years ago (Hedges, 2002; Knoll and Carroll, 1999). It is, besides its additional function in the nervous system (Joiner and Wu, 2004; Hoopfer et al., 2008), mainly involved in male meiosis in most organisms. Its loss or reduced expression is associated with male infertility resulting from the meiotic arrest in spermatogenesis (Eberhart et al., 1996; Xu et al., 2001; Luetjens et al., 2004; Zhang et al., 2009; Kleiman et al., 2011). Testosterone (T), the primary male steroid hormone, is produced almost exclusively by leydig cells in the interstitial space of the testis. Sertoli cell is the major cellular target and translator
http://dx.doi.org/10.1016/j.ygcen.2015.05.011 0016-6480/Ó 2015 Elsevier Inc. All rights reserved.
Please cite this article in press as: Ahmadivand, S., et al. Boule gene expression underpins the meiotic arrest in spermatogenesis in male rainbow trout (Oncorhynchus mykiss) exposed to DEHP and butachlor. Gen. Comp. Endocrinol. (2015), http://dx.doi.org/10.1016/j.ygcen.2015.05.011
2
S. Ahmadivand et al. / General and Comparative Endocrinology xxx (2015) xxx–xxx
of testosterone signals (via classical and non-classical pathways) to develop germ cells (Walker, 2009, 2010), as, in vivo, survive of germ cells depend on close and continuous interaction with this cell (Matta et al., 2002). In the absence of the testosterone or androgen receptor (AR), expressed in the sertoli and leydig cells (Ikeuchi et al., 2001), spermatogenesis does not proceed beyond the meiosis stage (Yeh et al., 2002; De Gendt et al., 2004; Chang et al., 2004). Therefore, it can be suggested that absence or disrupting in both of boule gene and/or testosterone signaling in germ, and somatic cells cause meiotic arrest in spermatogenesis. However, whether testosterone or boule gene acts on the spermatogenesis in parallel? Or is the boule downstream (dependent) on testosterone, also, its pathway needs to be clarified. Recently, health concerns regarding the adverse effects of endocrine disrupting contaminants (EDC’s) on the development and reproduction of humans and wildlife – especially aquatic species – has increased, due to their interference with the endocrine system (Mills and Chichester, 2005; Harrad et al., 2009). Therefore, further research to evaluate their effects and mechanisms of action in aquatic animals has been suggested (Jin et al., 2010). DEHP and butachlor are two anti-androgenic EDC’s (Jobling et al., 1995; Tu et al., 2013) and both potentially reproductive toxicants in fish. Di-(2-ethylhexyl)-phthalate (DEHP) is a phthalate commonly used as a plasticizer to promote plastic productions such as food packaging, infant toys, electrical devices and medical equipments such as tubing, blood bags and dialysis equipment (Heudorf et al., 2007; Hernández-Díaz et al., 2009). This compound is found up to 100 lg/L in surface water and up to 200 mg/kg in sediment (Petrovic et al., 2001; Fromme et al., 2002). DEHP is found in fish tissue ranging from 1 to 2.6 mg/kg (European Commission, 2003). Butachlor [2-chloro-2,6-diethyl-N-(butoxyme thyl)-acetanilide] is a common herbicide to control weeds in rice fields (Yu et al., 2003). LC50 (96 h) of butachlor in fishes has been reported to range from 0.14 to 0.52 mg/L (0.52 mg/L in rainbow trout, Oncorhynchus mykiss (Tomlin, 1994). Many adverse effects of this herbicide on fish species have been reported (Lasheidani et al., 2008; Guo et al., 2010; Tu et al., 2013; Zhu et al., 2014; Xu et al., 2015). Hence, the current study was conducted to investigate the effects of DEHP and butachlor on plasma testosterone, testicular histology, gonadosomatic index (GSI), hepatosomatic index (HSI) and boule expression, as a predictive marker to assess the meiotic efficiency (Kostova et al., 2007; Kleiman et al., 2011), in male rainbow trout. Recently, boule was identified, and its RNA expression at different stages of gametogenesis, was examined in rainbow trout, as, it has been revealed that boule in spermatogonia phase is expressed weakly, whereas, it shows a strong expression in spermatocyte phase, and in spermatid/sperm phase is rapidly disappeared, suggesting that boule has evolved meiosis-preferential expression in male trout (Li et al., 2011).
2. Materials and methods
fishes were randomly introduced into four 1000 L tanks, each containing 20 fishes.
2.2. Chemicals and treatment procedures The effects of butachlor and DEHP were investigated in two independent experiments. The applied dosages of chemical compounds were determined based on previous studies on male fish (Cravedi and Perdu-Durand, 2002; Lasheidani et al., 2008; Uren-Webster et al., 2010). The duration of both experiments was 10 days. The fishes were not fed during the experiment. Two tanks were used for the DEHP experiment, including group A as control and group B as treatment. After anesthetizing fish with MS-222 (100 mg/L), 500 ll of a carrier, i.e. olive oil, was administered to fishes of group A intraperitoneally. The fishes of the group B were injected with the same volume of carrier containing 50 mg/kg (body weight) DEHP (Merck, Germany) on the first and fifth days of the experiment. The other experiment was carried out with butachlor in two tanks, including group C and D as control and treatment groups, respectively. Based on Tomlin (1994), LC50 96 h of the butachlor acute toxicity for rainbow trout is 0.52 mg/L. Hence, this study was performed using 75% of the above-mentioned concentration, i.e. 0.39 mg/L (Purity 60%, H.P.C, Iran). To ensure consistency of prepared concentration of butachlor in the exposure water, we validated it using a HPLC system (Junghans et al., 2003; Del Buano et al., 2005). During the experiment, the dead fish were counted and removed. Water containing the experimental concentration of butachlor in group D, was renewed daily. Water physiochemical characteristics were monitored twice daily (before and after water exchange). During the experiment, the water parameters, including water temperature (°C), pH, oxygen (mg/L), ammonia (ng/L) and nitrite (lg/L) were 16.3 ± 0.9, 7.9 ± 0.1, 7.5–9.0, 23 ± 2.3 and 33.4 ± 0.6, respectively. Also, the photoperiod was held at 12:12 (L:D).
2.3. Sampling On days 1, 5 and 10 of the experiment fish were sampled from each group (n = 6–8) and anesthetized immediately by MS-222 (100 mg/L). Wet weight was measured. Then, the blood samples were taken from the caudal vasculature using a heparinized syringe and quickly centrifuged (5000 rpm, 10 min at 4 °C), and the obtained plasma samples were stored at 20 °C until subsequent analysis. Also, the liver and testes were dissected and weighed for determination of the hepatosomatic index; HSI = (liver weight (mg)/total weight (mg)) 100)) and gonadosomatic index; GSI = (testes weight (mg)/total weight (mg)) 100)), respectively. Finally, the gonad tissue samples were removed for histopathological studies, and the remaining samples, immediately snap-frozen in liquid nitrogen and stored at 80 °C until analysis of transcript profiles.
2.1. Study specimens In total, 90 male specimens of rainbow trout (with mean body weight and length of 410 ± 10.5 g and 30 ± 3.5 cm, respectively) were obtained from a local farm (Mazandaran Province, North Iran). Fishes were kept in two well-aerated 1000 L tanks for acclimatization to laboratory condition (pH = 7.9 ± 0.1, hardness 180 mg/L (as CaCO3) and total alkalinity 150 mg/L) for 10 days. The water was supplied from dechlorinated tap water filtered by cationic resin. After checking the health status, ten fish without any exposure were sampled as an initial control. The 80 remaining
2.4. Histology The testes samples were fixed into Bouin’s solution and then transferred into 70% alcohol after 48 h. The histological sections were prepared based on Hewitson et al. (2010). They were sectioned into 6 lm semi-thin sections and stained with hematoxylin-eosin staining according to Hewitson et al. (2010). The mounted slides were observed and photographed using a Leica microscope equipped with a digital Dino camera.
Please cite this article in press as: Ahmadivand, S., et al. Boule gene expression underpins the meiotic arrest in spermatogenesis in male rainbow trout (Oncorhynchus mykiss) exposed to DEHP and butachlor. Gen. Comp. Endocrinol. (2015), http://dx.doi.org/10.1016/j.ygcen.2015.05.011
3
S. Ahmadivand et al. / General and Comparative Endocrinology xxx (2015) xxx–xxx
2.5. Plasma testosterone (T) Plasma testosterone (T) concentrations were measured using a gamma counter and Immunotech radioimmunoassay (RIA) kit (Beckman Coulter, France).
butachlor was significantly higher than that of the control (P < 0.05), despite the short-term duration of this study (Fig. 1B). Regarding the gonadosomatic index (GSI), no significant difference was found between DEHP (Fig. 1C) or butachlor (Fig. 1D) treatments and control groups (P > 0.05). 3.2. Histological analysis of testes of trout affected by DEHP and butachlor
2.6. Quantitative real-time PCR (qPCR) RNA was extracted from gonad samples using RNX-Plus Solution (SinaClon, Iran), following the instruction of the manufacturer. RNA was then dissolved in 50 lL of water, and stored at 80 °C. RNA concentrations (ng/lL) were measured using a Nanodrop spectrophotometer (Implen NanoPhotometer™, Germany). To eliminate genomic DNA contamination, RNA samples were treated with RNase-free DNase (Promega) prior to cDNA creation. For each tissue sample, cDNA was synthesized according to manufacturer’s instructions from 200 ng/lL of testes RNA using M-MLV RT (Invitrogen). The qPCR primers for boule were designed using Primer Express 3.0 software (ABI), and then ordered from their site. b actin gene was used as reference gene for standardization of expression levels. Primer efficiencies were confirmed on serial dilutions of testis cDNA (results not shown), (Hoebeeck et al., 2007). Primers are listed in Table 1. Relative expression of boule was quantified in triplicate for each cDNA sample on the Real-Time PCR detection system (Applied Biosystems) using SYBR Green qPCR Master Mix (2x) (Fermentas). Each qPCR reaction comprised 12.5 ll 2xSYBR Green PCR Master Mix, 200 nM of each primer 100 ng cDNA template and nuclease-free water up to final volume of 25 ll. The procedure of the Real-time PCR was performed following the methods described: one cycle at 95 °C for 15 min and 40 cycles at 95 °C for 15 s, 59 °C for 1 min. The fold change in boule relative mRNA expression was calculated by the 2DDCt method (Livak and Schmittgen, 2001).
Histopathologically, testes of male trout in the control group were well-differentiated and filled with large numbers of cystic structures containing spermatozoa (Fig. 2A and C). In contrast, in the testis of male injected by olive oil containing 50 mg DEHP/kg body weight (b.w.), mostly spermatocytes with few spermatids and spermatozoa were observed (Fig 2B). Also, there was a significant increase in spermatocytes and decrease in spermatozoa in the testes of fish exposed to 0.39 mg/L butachlor (Fig. 2D) compared to those of the control group. 3.3. Effects of butachlor and DEHP on Plasma testosterone (T) levels of trout The results of effects of butachlor and DEHP on plasma testosterone (T) levels of rainbow trout are shown in Fig. 3. The testosterone concentration in the initial control was 1.18 ± 0.6 ng/ml. The T levels reached 4.33 ± 0.61 and 3.76 ± 0.94 ng/ml in the control group of DEHP and butachlor experiments, respectively, on day 10. These increase in testosterone that occurred in the control fish were not shown in either DEHP or butachlor treatments. At the end of the experiment, plasma testosterone in injected fish with DEHP and exposed to butachlor was as low as 1.90 ± 0.1 and 1.14 ± 0.78 ng/ml, respectively. These levels were significantly lower than those of control groups (P < 0.05). 3.4. Effects of butachlor and DEHP on boule expression in the testes of trout
2.7. Statistical analysis Data were statistically analyzed using the SPSS package (SPSS 1998). A t-test was used to compare the means. P < 0.05 was set as the criterion for statistical significance. Prior to statistical analysis, normality and homogeneity of variance were checked and percentage data were subjected to arcsine transformation. All data are expressed as mean ± SE. 3. Results 3.1. Effects of butachlor and DEHP on gonadosomatic index (GSI) and hepatosomatic index (HSI) of rainbow trout The water quality of each treatment did not change during the experiment due to controlled, daily renewing of the water. Also, during the experiment, 1 and 2 mortalities were recorded in group A and D, respectively. In group A, a fish died during injection. The concentrations of butachlor in the water in Group D ranged from 0.37 to 0.39 mg/L. DEHP did not affect the hepatosomatic index (HSI) of male rainbow trout (Fig. 1A). In contrast, HSI of the fish exposed to 0.39 mg/L
To confirm how meiosis is affected by DEHP and butachlor treatment in male rainbow trout, the expression of boule was evaluated in all groups using Quantitative real-time PCR. The results revealed that injection of 50 mg DEHP kg1 (day 10) results in a significant decrease in the expression of boule compared with the group injected with olive oil alone, at the end of experiment (P < 0.05). However, no significant (P > 0.05) differences were observed in other times of sampling, i.e., days 1 and 5 (Fig. 4A). Also, treatment with 0.39 mg/l butachlor resulted in a significant decrease of boule expression compared with that of the control group on days 5 and 10 of the experiment (P < 0.05) (Fig. 4B), while not affected on day 1. 4. Discussion In the present study, there was a significant increase in HSI in fish exposed to butachlor, compared to the control group, despite the short-term duration of this study. This effect has been attributed to the function of butachlor as a peroxisome proliferator (PP) compound associated with an increased cell proliferation via the PPAR signaling pathway (Reddy et al., 1980; Ou et al., 2000; Xu
Table 1 The primer information for the real-time quantitative RT-PCR. Gene
Accession number
Forward primer (50 -30 )
Reverse primer (50 -30 )
Product length (bp)
Boule b actin
HQ696915.1 NM_001124235.1
CTGTTAAGCACGGTGTCCAC ACACCCGACTACCACTTCAG
CCACAAAGATGCGGTTAGGG GCTGTTTCACCGTTCCAGTT
175 192
Please cite this article in press as: Ahmadivand, S., et al. Boule gene expression underpins the meiotic arrest in spermatogenesis in male rainbow trout (Oncorhynchus mykiss) exposed to DEHP and butachlor. Gen. Comp. Endocrinol. (2015), http://dx.doi.org/10.1016/j.ygcen.2015.05.011
4
S. Ahmadivand et al. / General and Comparative Endocrinology xxx (2015) xxx–xxx
Fig. 1. Biometric parameters of male rainbow trout affected by DEHP (Control = Fish injected with 500 ll olive oil; DEHP = Fish injected with 500 ll olive oil containing 50 mg/kg b.w. DEHP) and butachlor exposure (Control = fish without butachlor exposure; butachlor = fish with 0.39 mg/L butachlor exposure). (A and B) Hepatosomatic index (HSI) and (C and D) gonadosomatic index (GSI) at three different sampling times (On days 1, 5 and 10). Data are shown as means ± SEM (n = 6–8). The asterisk indicates significant differences between the treatment and control groups (P < 0.05).
et al., 2015). Moreover, enhanced HSI can be normally due to increases in detoxification activities in response to the presence of toxic substance (Pereira et al., 1993). The plasma testosterone (T) level in fish treated with butachlor or DEHP was lower than that of controls. It has been shown that testosterone concentrations can be influenced by hepatic biotransformation through several mechanisms such as direct conjugation and oxidoreduction pathways (de Bethizy and Hayes, 1994; Guillette and Gunderson, 2001). Therefore, lower plasma testosterone in male trout exposed to butachlor or DEHP might be associated with these pathways. Furthermore, EDC’s can competitively bind to steroid-binding proteins (Tollefsen, 2002). Chang et al. (2013) suggested that butachlor inhibits the gonadal steroidogenesis. Thus, inhibition of the gonadal steroidogenesis and binding to steroid-binding proteins might be another reason for lower plasma testosterone in male rainbow trout exposed to butachlor. Furthermore, Crago and Klaper (2012) suggested that lower plasma testosterone of the male fathead minnow exposed to a mixture of
DEHP and linuron may be linked to increasing steroid catabolism. Hence, similarly, increasing testosterone catabolism may result in lower plasma testosterone in male rainbow trout affected by DEHP. The results showed that treatment of male trout with 0.39 mg/L butachlor or 50 mg/kg b.w. DEHP results in the production of fewer spermatozoa and more spermatocytes in the testes compared to controls. These results are in agreement with other studies on mammalian and non-mammalian vertebrates showing that exposure to DEHP results in meiotic arrest in spermatogenesis and production of fewer spermatozoa (Sharpe et al., 1995; Uren-Webster et al., 2010). However, many works have shown that the adverse effects due to exposure to DEHP and butachlor likely occur preferentially via PPAR signalling pathways by oxidative stress in the testis and oestrogen signalling pathways in the liver (Onorato et al., 2008; Uren-Webster et al., 2010; Zhu et al., 2014). We measured the transcript profiles of the boule gene in the testes of rainbow trout, to investigate the molecular mechanisms underpinning the meiotic arrest in spermatogenesis. The boule
Please cite this article in press as: Ahmadivand, S., et al. Boule gene expression underpins the meiotic arrest in spermatogenesis in male rainbow trout (Oncorhynchus mykiss) exposed to DEHP and butachlor. Gen. Comp. Endocrinol. (2015), http://dx.doi.org/10.1016/j.ygcen.2015.05.011
S. Ahmadivand et al. / General and Comparative Endocrinology xxx (2015) xxx–xxx
5
Fig. 2. Histological section of testes of male rainbow trout affected by butachlor exposure and DEHP (A = Fish injected with 500 ll olive oil; B = Fish injected with 500 ll olive oil containing 50 mg/kg b.w. DEHP; C = fish without butachlor exposure (Control); D = fish with 0.39 mg/L butachlor exposure) at the end of the experiment (day 10), (n = 6– 8). The testes contained mostly spermatocytes with few spermatozoa in figures B and especially D are seen. (Sg) spermatogonia, (Sc) spermatocytes, (Sz) spermatozoa. H&E.
Fig. 3. Plasma testosterone (T) levels of male rainbow trout affected by (A) DEHP (Control = Fish injected with 500 ll olive oil; DEHP = Fish injected with 500 ll olive oil containing 50 mg/kg b.w. DEHP) and (B) butachlor exposure (Control = fish without butachlor exposure; butachlor = fish with 0.39 mg/L butachlor exposure) at three different sampling times (On days 1, 5 and 10). Data are shown as means ± SEM (n = 6–8). The asterisk indicates significant differences between the treatment and control groups at (P < 0.05).
ancestor of the DAZ family is mainly involved in male meiosis in most studied organisms and a mutation or lack of boule protein is associated with meiotic arrest (Eberhart et al., 1996; Xu et al., 2001; Luetjens et al., 2004; Zhang et al., 2009). It has also been shown that boule functions in spermatogenesis by controlling the translation of the meiotic CDC25 cell cycle regulators, especially CDC25A (Xu et al., 2001; VanGompel and Xu, 2010), which is expressed in the testes and might play a role in the mitotic or meiotic regulation via G1/S transition and M-phase exit (Jinno et al., 1995; Luetjens et al., 2004; Cheng et al., 2006). In addition, the insulin-like growth factor 1 (IGF1) regulates germ cell proliferation and testosterone (T) production by the Leydig cells, and induces
the activity of the Sertoli cells (Baker et al., 1996; Froment et al., 2007). Furthermore, androgen signaling via androgen receptors (ARs) localized in the Leydig, Sertoli and peritubular cells regulates proliferation and differentiation of the male germs. However, its mechanism is still not fully understood and only a few direct androgen-target genes have been identified (Tsai et al., 2006; Wang et al., 2009). Therefore, a coordinated interaction between T, IGF1, CDC25A and the boule gene may lead to success of the spermatogenesis. This notion was confirmed by Gonzalez et al. (2015) showing that testosterone increased boule expression and IGF1 increased boule and CDC25A genes expression via ERK1/2 signaling in a
Please cite this article in press as: Ahmadivand, S., et al. Boule gene expression underpins the meiotic arrest in spermatogenesis in male rainbow trout (Oncorhynchus mykiss) exposed to DEHP and butachlor. Gen. Comp. Endocrinol. (2015), http://dx.doi.org/10.1016/j.ygcen.2015.05.011
6
S. Ahmadivand et al. / General and Comparative Endocrinology xxx (2015) xxx–xxx
Fig. 4. Relative expression levels of boule gene in male rainbow trout affected by (A) DEHP (Control = Fish injected with 500 ll olive oil; DEHP = Fish injected with 500 ll olive oil containing 50 mg/kg b.w. DEHP); (B) butachlor exposure (Control = fish without butachlor exposure and butachlor = fish with 0.39 mg/L butachlor exposure) at three different sampling times (days 1, 5 and 10). Data are shown as mean ± SEM (n = 6–8). The asterisk indicates significant differences between the treatment and control groups (P < 0.05).
T-independent pathway in adult mice. In the present study, boule expression was significantly lower in the fish affected by DEHP and butachlor compared to control groups. This finding aligns with a mammalian study where decreased boule expression in testis of mice following exposure to Methoxychlor was reported (Du et al., 2014). In addition, and similar to our results, several works showed that exposure of fish to a variety of EDC’s such as butachlor and DEHP suppresses testosterone, and subsequently, reproductive success (Uren-Webster et al., 2010; Crago and Klaper, 2012; Chang et al., 2013). Therefore, effect of DEHP and butachlor on boule gene expression in testis of rainbow trout can be mediated by testosterone via AR present in Leydig or Sertoli cells. Furthermore, IGF1 expression can be affected by DEHP exposure (Boas et al., 2010). Therefore, this second pathway might be another way of suppressing boule expression by DEHP. To our knowledge, the effect of butachlor or other herbicides on IGF1 has not been previously reported, and therefore the mechanism of action of DEHP and butachlor on boule may be slightly different from each other. In conclusion, the present study demonstrated that DEHP and butachlor inhibits the progression of spermatogenesis in male trout, potentially by arresting meiosis, which may be due to down-regulation of boule gene expression through T and/or IGF1 via ERK1/2 signaling in T-independent pathways. Furthermore, these results confirmed that boule can be considered as a predictive marker to assess the meiotic efficiency, and subsequently to predict successful complete spermatogenesis. However, a further experiment needs to find out the regulating mechanisms and pathway of the boule gene expression. Acknowledgments The authors would like to thank Dr. Mohamad Ali Nematolahi for his kind help in supplying living fishes. We also appreciate Mrs. Aghdas Movassagh and Mr. Reza Ashori for the technical assistance. References Baker, J., Hardy, M.P., Zhou, J., Bondy, C., Lupu, F., Bellve, A.R., Efstratiadis, A., 1996. Effects of an Igf1 gene null mutation on mouse reproduction. Mol. Endocrinol. 10, 903–918. Boas, M., Frederiksen, H., Feldt-Rasmussen, U., Skakkebaek, N.E., Hegedus, L., Hilsted, L., Juul, A., Main, K.M., 2010. Childhood exposure to phthalates: associations with thyroid function, insulin-like growth factor I, and growth. Environ. Health Perspect. 118, 1458–1464.
Chang, C., Chen, Y.T., Yeh, S.D., Xu, Q., Wang, R.S., Guillou, F., Lardy, H., Yeh, S., 2004. Infertility with defective spermatogenesis and hypotestosteronemia in male mice lacking the androgen receptor in Sertoli cells. Proc. Natl. Acad. Sci. U.S.A. 101, 6876–6881. Chang, J., Gui, W., Wang, M., Zhu, G., 2013. Effects of butachlor on reproduction and hormone levels in adult zebrafish (Danio rerio). Exp. Toxicol. Pathol. 65, 205– 209. Cheng, Y.S., Kuo, P.L., Teng, Y.N., Kuo, T.Y., Chung, C.L., Lin, Y.H., Liao, R.W., Lin, J.S., Lin, Y.M., 2006. Association of spermatogenic failure with decreased Cdc25a expression in infertile men. Hum. Reprod. 21, 2346–2352. Crago, J., Klaper, R., 2012. A mixture of an environmentally realistic concentration of a phthalate and herbicide reduces testosterone in male fathead minnow (Pimephales promelas) through a novel mechanism of action. Aquat. Toxicol. 110–111, 74–83. Cravedi, J.P., Perdu-Durand, E., 2002. The phthalate diesters DEHP and DBP do not induce lauric acid hydroxylase activity in rainbow trout. Mar. Environ. Res. 54, 787–791. De Bethizy, J.D., Hayes, J.R., 1994. Metabolism: a determinant of toxicity. In: Hayes, A.W. (Ed.), Principles and Methods of Toxicology. Raven Press, New York, pp. 59–100. De Gendt, K., Swinnen, J.V., Saunders, P.T., Schoonjans, L., Dewerchin, M., Devos, A., Tan, K., Atanassova, N., Claessens, F., Lécureuil, C., Heyns, W., Carmeliet, P., Guillou, F., Sharpe, R.M., Verhoeven, G., 2004. A Sertoli cell-selective knockout of the androgen receptor causes spermatogenic arrest in meiosis. Proc. Natl. Acad. Sci. U.S.A. 101, 1327–1332. Del Buano, D., Scarponi, L., Amato, R.D., 2005. An analytical method for the simultaneous determination of butachlor and benoxacor in wheat and soil. J. Agric. Food Chem. 53, 4326–4330. Du, X., Zhang, H., Liu, Y., Yu, W., Huang, C., Li, X., 2014. Perinatal exposure to lowdose methoxychlor impairs testicular development in C57BL/6 mice. PLoS ONE 9, e103016. Eberhart, C.G., Maines, J.Z., Wasserman, S.A., 1996. Meiotic cell cycle requirement for a fly homologue of human Deleted in Azoospermia. Nature 381, 783–785. European Commission, 2003. EU Risk Assessment Report for 1,2Benzenedicarboxylic Acid, Di-C9-11-Branched Alkyl Esters, C10 Rich and Di‘‘Isodecyl’’ Phthalate (DIDP), 36. European Chemicals Bureau. Foresta, C., Ferlin, A., Garolla, A., Rossato, M., Barbaux, S., De Bortoli, A., 1997. Ychromosome deletions in idiopathic severe testiculopathies. J. Clin. Endocrinol. Metab. 82, 1075–1080. Froment, P., Vigier, M., Negre, D., Fontaine, I., Beghelli, J., Cosset, F.L., Holzenberger, M., Durand, P., 2007. Inactivation of the IGF1 receptor gene in primary Sertoli cells highlights the autocrine effects of IGF-1. J. Endocrinol. 194, 557–568. Fromme, H., Küchler, T., Otto, T., Pilz, K., Müller, J., Wenzel, A., 2002. Occurrence of phthalates and bisphenol A and F in the environment. Water Res. 36, 1429– 1438. Gonzalez, C.R., Dorfman, V.B., Vitullo, A.D., 2015. IGF1 regulation of BOULE and CDC25A transcripts via a testosterone-independent pathway in spermatogenesis of adult mice. Reprod. Biol. 15, 48–55. Guillette, L.J., Gunderson, M.P., 2001. Alterations in development of reproductive and endocrine systems of wildlife populations exposed to endocrine-disrupting contaminants. Reproduction 122, 857–864. Guo, H.R., Yin, L.C., Zhang, S.C., Feng, W.R., 2010. The toxic mechanism of high lethality of herbicide butachlor in marine flatfish flounder Paralichthys olivaceus. J. Ocean Univ. China 9, 257–264. Harrad, S., Ibarra, C., Robson, M., Melymuk, L., Zhang, X., Diamond, M., Douwes, J., 2009. Polychlorinated biphenyls in domestic dust from Canada, New Zealand, United Kingdom and United States: implications for human exposure. Chemosphere 76, 232–238.
Please cite this article in press as: Ahmadivand, S., et al. Boule gene expression underpins the meiotic arrest in spermatogenesis in male rainbow trout (Oncorhynchus mykiss) exposed to DEHP and butachlor. Gen. Comp. Endocrinol. (2015), http://dx.doi.org/10.1016/j.ygcen.2015.05.011
S. Ahmadivand et al. / General and Comparative Endocrinology xxx (2015) xxx–xxx Hedges, S.B., 2002. The origin and evolution of model organisms. Nat. Rev. Genet. 3, 838–849. Hernández-Díaz, S., Mitchell, A.A., Kelley, K.E., Calafat, A.M., Hauser, R., 2009. Medications as a potential source of exposure to phthalates in the U.S. population. Environ. Health Perspect. 117, 185–189. Heudorf, J., Mersch-Sundermann, V., Angerer, J., 2007. Phthalates: toxicology and exposure. Int. J. Hyg. Environ. Health 210, 623–634. Hewitson, T.D., Wigg, B., Becker, G.J., 2010. Tissue preparation for histochemistry: fixation, embedding and antigen retrieval for light microscopy. In: Hewitson, T.D., Darby, I.A. (Eds.), Histology Protocols. Humana Press, New York, pp. 3–18. Hoebeeck, J., Speleman, F., Vandesompele, J., 2007. Real-time quantitative PCR as an alternative to southern blot or fluorescence in situ hybridization for detection of gene copy number changes. In: Hilario, E., Mackay, J. (Eds.), Protocols for Nucleic Acid Analysis by Nonradioactive Probes, 353. Humana Press, Totowa, NJ. Hoopfer, E.D., Penton, A., Watts, R.J., Luo, L., 2008. Genomic analysis of Drosophila neuronal remodeling: a role for the RNA-binding protein Boule as a negative regulator of axon pruning. J. Neurosci. 28, 6092–6103. Ikeuchi, T., Todo, T., Kobayashi, T., Nagahama, Y., 2001. Two subtypes of androgen and progestogen receptors in fish testes. Comp. Biochem. Physiol. 129B, 449– 455. Jin, Y., Chen, R., Liu, W., Fu, Z., 2010. Effect of endocrine disrupting chemicals on the transcription of genes related to the innate immune system in the early developmental stage of zebrafish (Danio rerio). Fish Shellfish Immunol. 28, 854– 861. Jinno, S., Suto, K., Nagata, A., Igarashi, M., Kanaoka, Y., Nojima, H., Okayama, H., 1995. Cdc25a is a novel phosphatase functioning early in the cell cycle. EMBO J. 13, 1549–1556. Jobling, S., Reynolds, T., White, R., Parker, M.G., Sumpter, J.P., 1995. A variety of environmentally persistent chemicals including some phthalate plasticizers are weakly estrogenic. Environ. Health Perspect. 103, 582–587. Joiner, M.L., Wu, C.F., 2004. Nervous system function for the testis RNA-binding protein BOULE in Drosophila. J. Neurogenet. 18, 341–363. Junghans, M., Backhaus, T., Faust, M., Scholze, M., Grimme, L.H., 2003. Predictability of combined effects of eight chloroacetanilide herbicides on algal reproduction. Pest Manag. Sci. 59, 1101–1110. Kleiman, S.E., Lehavi, O., Hauser, R., Botchan, A., Paz, G., Yavetz, H., Yogev, L., 2011. CDY1 and BOULE transcripts assessed in the same biopsy as predictive markers for successful testicular sperm retrieval. Fertil. Steril. 95, 2297–2302. Knoll, A.H., Carroll, S.B., 1999. Early animal evolution: emerging views from comparative biology and geology. Science 284, 2129–2137. Kostova, E., Yeung, C.H., Luetjens, C.M., Brune, M., Nieschlag, E., Gromoll, J., 2007. Association of three isoforms of the meiotic BOULE gene with spermatogenic failure in infertile men. Mol. Hum. Reprod. 13, 85–93. Lasheidani, M., Balouchi, S.N., Keyvan, A., Jamili, S., Falakru, K., 2008. Effect of butachlor on density, volume and number of abnormal sperms in Caspian kutum (Rutilus frisii Kutum). Res. J. Environ. Sci. 2, 474–482. Li, M., Shen, Q., Xu, H., Wong, F.M., Cui, J., Li, Z., Hong, N., Wang, L., Zhao, H., Ma, B., Hong, Y., 2011. Differential conservation and divergence of fertility genes boule and dazl in the rainbow trout. PLoS ONE 6, e15910. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2DDCt method. Methods 25, 402–408. Luetjens, C.M., Xu, E.Y., Reijo Pera, R.A., Kamischke, A., Nieschlag, E., Gromoll, J., 2004. Association of meiotic arrest with lack of BOULE protein expression in infertile men. J. Clin. Endocrinol. Metab. 89, 1926–1933. Matta, S.L., Vilela, D.A., Godinho, H.P., França, L.R., 2002. The goitrogen 6-n-propyl2-thiouracil (PTU) given during testis development increases Sertoli and germ cell numbers per cyst in fish: the tilapia (Oreochromis niloticus) model. Endocrinology 143, 970–978. Mills, L.J., Chichester, C., 2005. Review of evidence: are endocrine-disrupting chemicals in the aquatic environment impacting fish populations? Sci. Total Environ. 43, 1–34. Onorato, T.M., Brown, P.W., Morris, P.L., 2008. Mono-(2-ethylhexyl) phthalate increases spermatocyte mitochondrial peroxiredoxin 3 and cyclooxygenase 2. J. Androl. 29, 293–303. Ou, Y.H., Chung, P.C., Chang, Y.C., Ngo, F.Q., Hsu, K.Y., Chen, F.D., 2000. Butachlor, a suspected carcinogen, alters growth and transformation characteristics of mouse liver cells. Chem. Res. Toxicol. 13, 1321–1325.
7
Pereira, J.J., Mercaldoallen, R., Kuropat, C., Luedke, D., Sennefelder, G., 1993. Effect of cadmium accumulation on serum vitellogenin levels and hepatosomatic and gonadosomatic indexes of winter flounder (Pleuronectes americanus). Arch. Environ. Contam. Toxicol. 24, 427–431. Petrovic, M., Eljarrat, E., López de Alda, M.J., Barceló, D., 2001. Analysis and environmental levels of endocrine-disrupting compounds in freshwater sediments. Trac-Trends Anal. Chem. 20, 637–648. Reddy, J.K., Azarnoff, D.L., Hignite, C.E., 1980. Hypolipidaemic hepatic peroxisome proliferators form a novel class of chemical carcinogens. Nature 283, 397–398. Reijo, R.A., Lee, T.Y., Salo, P., Alagappan, R., Brown, L.G., Rosenberg, M., Rozen, S., Jaffe, T., Straus, D., Hovatta, O., de la Chapelle, A., Silber, S., Page, D.C., 1995. Diverse spermatogenic defects in humans caused by Y chromosome deletions encompassing a novel RNA-binding protein gene. Nat. Genet. 10, 383–393. Schulz, R.W., de Franca, L.R., Lareyre, J.J., LeGac, F., Chiarini-Garcia, H., Nobrega, R.H., Miura, T., 2010. Spermatogenesis in fish. Gen. Comp. Endocrinol. 165, 390–411. Sharpe, R.M., Fisher, J.S., Millar, M.M., Jobling, S., Sumpter, J.P., 1995. Gestational and lactational exposure of rats to xenoestrogens results in reduced testicular size and sperm production. Environ. Health Perspect. 103, 1136–1143. Tollefsen, K.E., 2002. Interaction of estrogen mimics, singly and in combination, with plasma sex steroid-binding proteins in rainbow trout (Oncorhynchus mykiss). Aquat. Toxicol. 56, 215–225. Tomlin, C., 1994. The Pesticide Manual, 10th ed. Crop Protection Publications, British Crop Protection Council, Farnham, Surrey, UK. Tsai, M.Y., Yeh, S.D., Wang, R.S., Yeh, S., Zhang, C., Lin, H.Y., Tzeng, C.R., Chang, C., 2006. Differential effects of spermatogenesis and fertility in mice lacking androgen receptor in individual testis cells. Proc. Natl. Acad. Sci. U.S.A. 103, 18975–18980. Tu, W., Niu, L., Liu, L., Xu, C., 2013. Embryonic exposure to butachlor in zebrafish (Danio rerio): endocrine disruption, developmental toxicity and immunotoxicity. Ecotoxicol. Environ. Saf. 89, 189–195. Urano, J., Fox, M.S., Pera Reijo, R.A., 2005. Interaction of the conserved meiotic regulators, BOULE (BOL) and PUMILIO-2 (PUM2). Mol. Reprod. Dev. 71, 290– 298. Uren-Webster, T.M., Lewis, C., Filby, A.L., Paull, G.C., Santos, E.M., 2010. Mechanisms of toxicity of di(2-ethylhexyl) phthalate on the reproductive health of male zebrafish. Aquat. Toxicol. 99, 360–369. VanGompel, J.W., Xu, E.Y., 2010. A novel requirement in mammalian spermatid differentiation for the DAZ-family protein Boule. Hum. Mol. Genet. 19, 2360– 2369. Walker, W.H., 2009. Molecular mechanisms of testosterone action in spermatogenesis. Steroids 74, 602–607. Walker, W.H., 2010. Non-classical actions of testosterone and spermatogenesis. Philos. Trans. R. Soc. Lond. B Biol. Sci. 365, 1557–1569. Wang, R.S., Yeh, S., Tzeng, C.R., Chang, C., 2009. Androgen receptor roles in spermatogenesis and fertility: lessons from testicular cell-specific androgen receptor knockout mice. Endocr. Rev. 30, 119–132. Xu, E.Y., Lee, D.F., Klebes, A., Turek, P.J., Kornberg, T.B., Reijo Pera, R.A., 2003. Human BOULE gene rescues meiotic defects in infertile flies. Hum. Mol. Genet. 12, 169– 175. Xu, E.Y., Moore, F.L., Pera, R.A., 2001. A gene family required for human germ cell development evolved from an ancient meiotic gene conserved in metazoans. Proc. Natl. Acad. Sci. U.S.A. 98, 7414–7419. Xu, H.D., Wang, J.S., Li, M.H., Liu, Y., Chen, T., Jia, A.Q., 2015. (1)H NMR based metabolomics approach to study the toxic effects of herbicide butachlor on goldfish (Carassius auratus). Aquat. Toxicol. 159, 69–80. Yeh, S., Tsai, M.Y., Xu, Q., Mu, X.M., Lardy, H., Huang, K.E., Lin, H., Yeh, S.D., Altuwaijri, S., Zhou, X., Xing, L., Boyce, B.F., Hung, M.C., Zhang, S., Gan, L., Chang, C., 2002. Generation and characterization of androgen receptor knockout (ARKO) mice: an in vivo model forthe study of androgen functions in selective tissues. Proc. Natl. Acad. Sci. U.S.A. 99, 13498–13503. Yu, Y.L., Chen, Y.X., Luo, Y.M., Pan, X.D., He, Y.F., Wong, M.H., 2003. Rapid degradation of butachlor in wheat rhizosphere soil. Chemosphere 50, 771–774. Zhang, Q., Li, J., Li, Q., Li, X., Liu, Z., Song, D., Xie, Z., 2009. Cloning and characterization of the gene encoding the bovine BOULE protein. Mol. Genet. Genomics 281, 67–75. Zhu, L., Wei, L., Jinmiao, Z., Miao, W., Lilai, Y., Zijian, W., 2014. Butachlor causes disruption of HPG and HPT axes in adult female rare minnow (Gobiocypris rarus). Chem. Biol. Interact. 221, 119–126.
Please cite this article in press as: Ahmadivand, S., et al. Boule gene expression underpins the meiotic arrest in spermatogenesis in male rainbow trout (Oncorhynchus mykiss) exposed to DEHP and butachlor. Gen. Comp. Endocrinol. (2015), http://dx.doi.org/10.1016/j.ygcen.2015.05.011
Contents lists available at ScienceDirect
General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen
Boule gene expression underpins the meiotic arrest in spermatogenesis in male rainbow trout (Oncorhynchus mykiss) exposed to DEHP and butachlor Sohrab Ahmadivand a,⇑, Hamid Farahmand b, Ladan Teimoori-Toolabi c, Alireza Mirvaghefi b, Soheil Eagderi b, Tom Geerinckx d, Sara Shokrpoor e, Hooman Rahmati-Holasoo a a
Department of Aquatic Animal Health, Faculty of Veterinary Medicine, University of Tehran, P.O. Box: 14155-6453, Tehran, Iran Department of Fisheries, Faculty of Natural Resources, University of Tehran, P.O. Box 4314, Karaj, Iran c Molecular Medicine Department, Biotechnology Research Center, Pasteur Institute of Iran, P.O. Box: 13169-43551, Tehran, Iran d Department of Biology, Evolutionary Morphology of Vertebrates, Ghent University (UGent), 9000 Ghent, Belgium e Department of Pathology, Faculty of Veterinary Medicine, University of Tehran, P.O. Box: 14155-6453, Tehran, Iran b
a r t i c l e
i n f o
Article history: Received 14 February 2015 Revised 25 April 2015 Accepted 7 May 2015 Available online xxxx Keywords: Boule Azoospermia Testes DEHP Butachlor Trout
a b s t r a c t Boule, the ancestor of the DAZ (Deleted in AZoospermia) gene family, in most organisms is mainly involved in male meiosis. The present study investigates the effects of the plasticizer DEHP (50 mg/kg body weight) and herbicide butachlor (0.39 mg/L) on male rainbow trout (Oncorhynchus mykiss) for a 10-day period in two independent experiments. The results showed that plasma testosterone (T) concentrations were significantly lower in fish exposed to either DEHP or butachlor compared to the control fish (P < 0.05). Fish showed a significantly elevated hepatosomatic index (HSI) in the butachlor treatment (P < 0.05). However, no significant difference was observed in HSI values in the DEHP treatment (P > 0.05). In addition, no significant differences were found in the gonadosomatic index (GSI) in both DEHP and butachlor treatments (P > 0.05). Histologically, testes of male trout in the control groups were well differentiated and filled with large numbers of cystic structures containing spermatozoa. In contrast, the testes of male trout contained mostly spermatocytes with few spermatozoa in both treated group, suggesting that DEHP and butachlor may inhibit the progression of meiosis. Also, boule gene expression was significantly lower in the testes of male trout affected by DEHP and butachlor in comparison with their control groups (P < 0.05), which confirmed the meiotic arrest in affected trout. Based on the results, the present study demonstrated that DEHP and butachlor can inhibit the progression of spermatogenesis in male trout, potentially by causing an arrest of meiosis, maybe due to down-regulation of boule gene expression through T and/or IGF1 via ERK1/2 signaling in T-independent pathways. In addition, these results confirmed that boule can be considered as a predictive marker to assess meiotic efficiency. Ó 2015 Elsevier Inc. All rights reserved.
1. Introduction Spermatogenesis is a complex physiological process in which a series of mitotic and meiotic divisions of diploid spermatogonia results in mature spermatozoa carrying a haploid, recombined genome, with a complex regulation at the levels of transcription and translation of many genes (Urano et al., 2005). The meiosis alone may require expression of more than 900 genes in zebrafish (Schulz et al., 2010). Some of these genes are highly conserved, and, when suffering a mutation, can lead to an arrest of spermatogenesis at a specific stage (Xu et al., 2003). ⇑ Corresponding author. Fax: +982166933222. E-mail address: [email protected] (S. Ahmadivand).
DAZ (Deleted in AZoospermia) gene family members are the most commonly defined cause of spermatogenic failure (Reijo et al., 1995; Foresta et al., 1997). The boule gene, the ancestor of the DAZ gene family, has an origin going back to 600 million years ago (Hedges, 2002; Knoll and Carroll, 1999). It is, besides its additional function in the nervous system (Joiner and Wu, 2004; Hoopfer et al., 2008), mainly involved in male meiosis in most organisms. Its loss or reduced expression is associated with male infertility resulting from the meiotic arrest in spermatogenesis (Eberhart et al., 1996; Xu et al., 2001; Luetjens et al., 2004; Zhang et al., 2009; Kleiman et al., 2011). Testosterone (T), the primary male steroid hormone, is produced almost exclusively by leydig cells in the interstitial space of the testis. Sertoli cell is the major cellular target and translator
http://dx.doi.org/10.1016/j.ygcen.2015.05.011 0016-6480/Ó 2015 Elsevier Inc. All rights reserved.
Please cite this article in press as: Ahmadivand, S., et al. Boule gene expression underpins the meiotic arrest in spermatogenesis in male rainbow trout (Oncorhynchus mykiss) exposed to DEHP and butachlor. Gen. Comp. Endocrinol. (2015), http://dx.doi.org/10.1016/j.ygcen.2015.05.011
2
S. Ahmadivand et al. / General and Comparative Endocrinology xxx (2015) xxx–xxx
of testosterone signals (via classical and non-classical pathways) to develop germ cells (Walker, 2009, 2010), as, in vivo, survive of germ cells depend on close and continuous interaction with this cell (Matta et al., 2002). In the absence of the testosterone or androgen receptor (AR), expressed in the sertoli and leydig cells (Ikeuchi et al., 2001), spermatogenesis does not proceed beyond the meiosis stage (Yeh et al., 2002; De Gendt et al., 2004; Chang et al., 2004). Therefore, it can be suggested that absence or disrupting in both of boule gene and/or testosterone signaling in germ, and somatic cells cause meiotic arrest in spermatogenesis. However, whether testosterone or boule gene acts on the spermatogenesis in parallel? Or is the boule downstream (dependent) on testosterone, also, its pathway needs to be clarified. Recently, health concerns regarding the adverse effects of endocrine disrupting contaminants (EDC’s) on the development and reproduction of humans and wildlife – especially aquatic species – has increased, due to their interference with the endocrine system (Mills and Chichester, 2005; Harrad et al., 2009). Therefore, further research to evaluate their effects and mechanisms of action in aquatic animals has been suggested (Jin et al., 2010). DEHP and butachlor are two anti-androgenic EDC’s (Jobling et al., 1995; Tu et al., 2013) and both potentially reproductive toxicants in fish. Di-(2-ethylhexyl)-phthalate (DEHP) is a phthalate commonly used as a plasticizer to promote plastic productions such as food packaging, infant toys, electrical devices and medical equipments such as tubing, blood bags and dialysis equipment (Heudorf et al., 2007; Hernández-Díaz et al., 2009). This compound is found up to 100 lg/L in surface water and up to 200 mg/kg in sediment (Petrovic et al., 2001; Fromme et al., 2002). DEHP is found in fish tissue ranging from 1 to 2.6 mg/kg (European Commission, 2003). Butachlor [2-chloro-2,6-diethyl-N-(butoxyme thyl)-acetanilide] is a common herbicide to control weeds in rice fields (Yu et al., 2003). LC50 (96 h) of butachlor in fishes has been reported to range from 0.14 to 0.52 mg/L (0.52 mg/L in rainbow trout, Oncorhynchus mykiss (Tomlin, 1994). Many adverse effects of this herbicide on fish species have been reported (Lasheidani et al., 2008; Guo et al., 2010; Tu et al., 2013; Zhu et al., 2014; Xu et al., 2015). Hence, the current study was conducted to investigate the effects of DEHP and butachlor on plasma testosterone, testicular histology, gonadosomatic index (GSI), hepatosomatic index (HSI) and boule expression, as a predictive marker to assess the meiotic efficiency (Kostova et al., 2007; Kleiman et al., 2011), in male rainbow trout. Recently, boule was identified, and its RNA expression at different stages of gametogenesis, was examined in rainbow trout, as, it has been revealed that boule in spermatogonia phase is expressed weakly, whereas, it shows a strong expression in spermatocyte phase, and in spermatid/sperm phase is rapidly disappeared, suggesting that boule has evolved meiosis-preferential expression in male trout (Li et al., 2011).
2. Materials and methods
fishes were randomly introduced into four 1000 L tanks, each containing 20 fishes.
2.2. Chemicals and treatment procedures The effects of butachlor and DEHP were investigated in two independent experiments. The applied dosages of chemical compounds were determined based on previous studies on male fish (Cravedi and Perdu-Durand, 2002; Lasheidani et al., 2008; Uren-Webster et al., 2010). The duration of both experiments was 10 days. The fishes were not fed during the experiment. Two tanks were used for the DEHP experiment, including group A as control and group B as treatment. After anesthetizing fish with MS-222 (100 mg/L), 500 ll of a carrier, i.e. olive oil, was administered to fishes of group A intraperitoneally. The fishes of the group B were injected with the same volume of carrier containing 50 mg/kg (body weight) DEHP (Merck, Germany) on the first and fifth days of the experiment. The other experiment was carried out with butachlor in two tanks, including group C and D as control and treatment groups, respectively. Based on Tomlin (1994), LC50 96 h of the butachlor acute toxicity for rainbow trout is 0.52 mg/L. Hence, this study was performed using 75% of the above-mentioned concentration, i.e. 0.39 mg/L (Purity 60%, H.P.C, Iran). To ensure consistency of prepared concentration of butachlor in the exposure water, we validated it using a HPLC system (Junghans et al., 2003; Del Buano et al., 2005). During the experiment, the dead fish were counted and removed. Water containing the experimental concentration of butachlor in group D, was renewed daily. Water physiochemical characteristics were monitored twice daily (before and after water exchange). During the experiment, the water parameters, including water temperature (°C), pH, oxygen (mg/L), ammonia (ng/L) and nitrite (lg/L) were 16.3 ± 0.9, 7.9 ± 0.1, 7.5–9.0, 23 ± 2.3 and 33.4 ± 0.6, respectively. Also, the photoperiod was held at 12:12 (L:D).
2.3. Sampling On days 1, 5 and 10 of the experiment fish were sampled from each group (n = 6–8) and anesthetized immediately by MS-222 (100 mg/L). Wet weight was measured. Then, the blood samples were taken from the caudal vasculature using a heparinized syringe and quickly centrifuged (5000 rpm, 10 min at 4 °C), and the obtained plasma samples were stored at 20 °C until subsequent analysis. Also, the liver and testes were dissected and weighed for determination of the hepatosomatic index; HSI = (liver weight (mg)/total weight (mg)) 100)) and gonadosomatic index; GSI = (testes weight (mg)/total weight (mg)) 100)), respectively. Finally, the gonad tissue samples were removed for histopathological studies, and the remaining samples, immediately snap-frozen in liquid nitrogen and stored at 80 °C until analysis of transcript profiles.
2.1. Study specimens In total, 90 male specimens of rainbow trout (with mean body weight and length of 410 ± 10.5 g and 30 ± 3.5 cm, respectively) were obtained from a local farm (Mazandaran Province, North Iran). Fishes were kept in two well-aerated 1000 L tanks for acclimatization to laboratory condition (pH = 7.9 ± 0.1, hardness 180 mg/L (as CaCO3) and total alkalinity 150 mg/L) for 10 days. The water was supplied from dechlorinated tap water filtered by cationic resin. After checking the health status, ten fish without any exposure were sampled as an initial control. The 80 remaining
2.4. Histology The testes samples were fixed into Bouin’s solution and then transferred into 70% alcohol after 48 h. The histological sections were prepared based on Hewitson et al. (2010). They were sectioned into 6 lm semi-thin sections and stained with hematoxylin-eosin staining according to Hewitson et al. (2010). The mounted slides were observed and photographed using a Leica microscope equipped with a digital Dino camera.
Please cite this article in press as: Ahmadivand, S., et al. Boule gene expression underpins the meiotic arrest in spermatogenesis in male rainbow trout (Oncorhynchus mykiss) exposed to DEHP and butachlor. Gen. Comp. Endocrinol. (2015), http://dx.doi.org/10.1016/j.ygcen.2015.05.011
3
S. Ahmadivand et al. / General and Comparative Endocrinology xxx (2015) xxx–xxx
2.5. Plasma testosterone (T) Plasma testosterone (T) concentrations were measured using a gamma counter and Immunotech radioimmunoassay (RIA) kit (Beckman Coulter, France).
butachlor was significantly higher than that of the control (P < 0.05), despite the short-term duration of this study (Fig. 1B). Regarding the gonadosomatic index (GSI), no significant difference was found between DEHP (Fig. 1C) or butachlor (Fig. 1D) treatments and control groups (P > 0.05). 3.2. Histological analysis of testes of trout affected by DEHP and butachlor
2.6. Quantitative real-time PCR (qPCR) RNA was extracted from gonad samples using RNX-Plus Solution (SinaClon, Iran), following the instruction of the manufacturer. RNA was then dissolved in 50 lL of water, and stored at 80 °C. RNA concentrations (ng/lL) were measured using a Nanodrop spectrophotometer (Implen NanoPhotometer™, Germany). To eliminate genomic DNA contamination, RNA samples were treated with RNase-free DNase (Promega) prior to cDNA creation. For each tissue sample, cDNA was synthesized according to manufacturer’s instructions from 200 ng/lL of testes RNA using M-MLV RT (Invitrogen). The qPCR primers for boule were designed using Primer Express 3.0 software (ABI), and then ordered from their site. b actin gene was used as reference gene for standardization of expression levels. Primer efficiencies were confirmed on serial dilutions of testis cDNA (results not shown), (Hoebeeck et al., 2007). Primers are listed in Table 1. Relative expression of boule was quantified in triplicate for each cDNA sample on the Real-Time PCR detection system (Applied Biosystems) using SYBR Green qPCR Master Mix (2x) (Fermentas). Each qPCR reaction comprised 12.5 ll 2xSYBR Green PCR Master Mix, 200 nM of each primer 100 ng cDNA template and nuclease-free water up to final volume of 25 ll. The procedure of the Real-time PCR was performed following the methods described: one cycle at 95 °C for 15 min and 40 cycles at 95 °C for 15 s, 59 °C for 1 min. The fold change in boule relative mRNA expression was calculated by the 2DDCt method (Livak and Schmittgen, 2001).
Histopathologically, testes of male trout in the control group were well-differentiated and filled with large numbers of cystic structures containing spermatozoa (Fig. 2A and C). In contrast, in the testis of male injected by olive oil containing 50 mg DEHP/kg body weight (b.w.), mostly spermatocytes with few spermatids and spermatozoa were observed (Fig 2B). Also, there was a significant increase in spermatocytes and decrease in spermatozoa in the testes of fish exposed to 0.39 mg/L butachlor (Fig. 2D) compared to those of the control group. 3.3. Effects of butachlor and DEHP on Plasma testosterone (T) levels of trout The results of effects of butachlor and DEHP on plasma testosterone (T) levels of rainbow trout are shown in Fig. 3. The testosterone concentration in the initial control was 1.18 ± 0.6 ng/ml. The T levels reached 4.33 ± 0.61 and 3.76 ± 0.94 ng/ml in the control group of DEHP and butachlor experiments, respectively, on day 10. These increase in testosterone that occurred in the control fish were not shown in either DEHP or butachlor treatments. At the end of the experiment, plasma testosterone in injected fish with DEHP and exposed to butachlor was as low as 1.90 ± 0.1 and 1.14 ± 0.78 ng/ml, respectively. These levels were significantly lower than those of control groups (P < 0.05). 3.4. Effects of butachlor and DEHP on boule expression in the testes of trout
2.7. Statistical analysis Data were statistically analyzed using the SPSS package (SPSS 1998). A t-test was used to compare the means. P < 0.05 was set as the criterion for statistical significance. Prior to statistical analysis, normality and homogeneity of variance were checked and percentage data were subjected to arcsine transformation. All data are expressed as mean ± SE. 3. Results 3.1. Effects of butachlor and DEHP on gonadosomatic index (GSI) and hepatosomatic index (HSI) of rainbow trout The water quality of each treatment did not change during the experiment due to controlled, daily renewing of the water. Also, during the experiment, 1 and 2 mortalities were recorded in group A and D, respectively. In group A, a fish died during injection. The concentrations of butachlor in the water in Group D ranged from 0.37 to 0.39 mg/L. DEHP did not affect the hepatosomatic index (HSI) of male rainbow trout (Fig. 1A). In contrast, HSI of the fish exposed to 0.39 mg/L
To confirm how meiosis is affected by DEHP and butachlor treatment in male rainbow trout, the expression of boule was evaluated in all groups using Quantitative real-time PCR. The results revealed that injection of 50 mg DEHP kg1 (day 10) results in a significant decrease in the expression of boule compared with the group injected with olive oil alone, at the end of experiment (P < 0.05). However, no significant (P > 0.05) differences were observed in other times of sampling, i.e., days 1 and 5 (Fig. 4A). Also, treatment with 0.39 mg/l butachlor resulted in a significant decrease of boule expression compared with that of the control group on days 5 and 10 of the experiment (P < 0.05) (Fig. 4B), while not affected on day 1. 4. Discussion In the present study, there was a significant increase in HSI in fish exposed to butachlor, compared to the control group, despite the short-term duration of this study. This effect has been attributed to the function of butachlor as a peroxisome proliferator (PP) compound associated with an increased cell proliferation via the PPAR signaling pathway (Reddy et al., 1980; Ou et al., 2000; Xu
Table 1 The primer information for the real-time quantitative RT-PCR. Gene
Accession number
Forward primer (50 -30 )
Reverse primer (50 -30 )
Product length (bp)
Boule b actin
HQ696915.1 NM_001124235.1
CTGTTAAGCACGGTGTCCAC ACACCCGACTACCACTTCAG
CCACAAAGATGCGGTTAGGG GCTGTTTCACCGTTCCAGTT
175 192
Please cite this article in press as: Ahmadivand, S., et al. Boule gene expression underpins the meiotic arrest in spermatogenesis in male rainbow trout (Oncorhynchus mykiss) exposed to DEHP and butachlor. Gen. Comp. Endocrinol. (2015), http://dx.doi.org/10.1016/j.ygcen.2015.05.011
4
S. Ahmadivand et al. / General and Comparative Endocrinology xxx (2015) xxx–xxx
Fig. 1. Biometric parameters of male rainbow trout affected by DEHP (Control = Fish injected with 500 ll olive oil; DEHP = Fish injected with 500 ll olive oil containing 50 mg/kg b.w. DEHP) and butachlor exposure (Control = fish without butachlor exposure; butachlor = fish with 0.39 mg/L butachlor exposure). (A and B) Hepatosomatic index (HSI) and (C and D) gonadosomatic index (GSI) at three different sampling times (On days 1, 5 and 10). Data are shown as means ± SEM (n = 6–8). The asterisk indicates significant differences between the treatment and control groups (P < 0.05).
et al., 2015). Moreover, enhanced HSI can be normally due to increases in detoxification activities in response to the presence of toxic substance (Pereira et al., 1993). The plasma testosterone (T) level in fish treated with butachlor or DEHP was lower than that of controls. It has been shown that testosterone concentrations can be influenced by hepatic biotransformation through several mechanisms such as direct conjugation and oxidoreduction pathways (de Bethizy and Hayes, 1994; Guillette and Gunderson, 2001). Therefore, lower plasma testosterone in male trout exposed to butachlor or DEHP might be associated with these pathways. Furthermore, EDC’s can competitively bind to steroid-binding proteins (Tollefsen, 2002). Chang et al. (2013) suggested that butachlor inhibits the gonadal steroidogenesis. Thus, inhibition of the gonadal steroidogenesis and binding to steroid-binding proteins might be another reason for lower plasma testosterone in male rainbow trout exposed to butachlor. Furthermore, Crago and Klaper (2012) suggested that lower plasma testosterone of the male fathead minnow exposed to a mixture of
DEHP and linuron may be linked to increasing steroid catabolism. Hence, similarly, increasing testosterone catabolism may result in lower plasma testosterone in male rainbow trout affected by DEHP. The results showed that treatment of male trout with 0.39 mg/L butachlor or 50 mg/kg b.w. DEHP results in the production of fewer spermatozoa and more spermatocytes in the testes compared to controls. These results are in agreement with other studies on mammalian and non-mammalian vertebrates showing that exposure to DEHP results in meiotic arrest in spermatogenesis and production of fewer spermatozoa (Sharpe et al., 1995; Uren-Webster et al., 2010). However, many works have shown that the adverse effects due to exposure to DEHP and butachlor likely occur preferentially via PPAR signalling pathways by oxidative stress in the testis and oestrogen signalling pathways in the liver (Onorato et al., 2008; Uren-Webster et al., 2010; Zhu et al., 2014). We measured the transcript profiles of the boule gene in the testes of rainbow trout, to investigate the molecular mechanisms underpinning the meiotic arrest in spermatogenesis. The boule
Please cite this article in press as: Ahmadivand, S., et al. Boule gene expression underpins the meiotic arrest in spermatogenesis in male rainbow trout (Oncorhynchus mykiss) exposed to DEHP and butachlor. Gen. Comp. Endocrinol. (2015), http://dx.doi.org/10.1016/j.ygcen.2015.05.011
S. Ahmadivand et al. / General and Comparative Endocrinology xxx (2015) xxx–xxx
5
Fig. 2. Histological section of testes of male rainbow trout affected by butachlor exposure and DEHP (A = Fish injected with 500 ll olive oil; B = Fish injected with 500 ll olive oil containing 50 mg/kg b.w. DEHP; C = fish without butachlor exposure (Control); D = fish with 0.39 mg/L butachlor exposure) at the end of the experiment (day 10), (n = 6– 8). The testes contained mostly spermatocytes with few spermatozoa in figures B and especially D are seen. (Sg) spermatogonia, (Sc) spermatocytes, (Sz) spermatozoa. H&E.
Fig. 3. Plasma testosterone (T) levels of male rainbow trout affected by (A) DEHP (Control = Fish injected with 500 ll olive oil; DEHP = Fish injected with 500 ll olive oil containing 50 mg/kg b.w. DEHP) and (B) butachlor exposure (Control = fish without butachlor exposure; butachlor = fish with 0.39 mg/L butachlor exposure) at three different sampling times (On days 1, 5 and 10). Data are shown as means ± SEM (n = 6–8). The asterisk indicates significant differences between the treatment and control groups at (P < 0.05).
ancestor of the DAZ family is mainly involved in male meiosis in most studied organisms and a mutation or lack of boule protein is associated with meiotic arrest (Eberhart et al., 1996; Xu et al., 2001; Luetjens et al., 2004; Zhang et al., 2009). It has also been shown that boule functions in spermatogenesis by controlling the translation of the meiotic CDC25 cell cycle regulators, especially CDC25A (Xu et al., 2001; VanGompel and Xu, 2010), which is expressed in the testes and might play a role in the mitotic or meiotic regulation via G1/S transition and M-phase exit (Jinno et al., 1995; Luetjens et al., 2004; Cheng et al., 2006). In addition, the insulin-like growth factor 1 (IGF1) regulates germ cell proliferation and testosterone (T) production by the Leydig cells, and induces
the activity of the Sertoli cells (Baker et al., 1996; Froment et al., 2007). Furthermore, androgen signaling via androgen receptors (ARs) localized in the Leydig, Sertoli and peritubular cells regulates proliferation and differentiation of the male germs. However, its mechanism is still not fully understood and only a few direct androgen-target genes have been identified (Tsai et al., 2006; Wang et al., 2009). Therefore, a coordinated interaction between T, IGF1, CDC25A and the boule gene may lead to success of the spermatogenesis. This notion was confirmed by Gonzalez et al. (2015) showing that testosterone increased boule expression and IGF1 increased boule and CDC25A genes expression via ERK1/2 signaling in a
Please cite this article in press as: Ahmadivand, S., et al. Boule gene expression underpins the meiotic arrest in spermatogenesis in male rainbow trout (Oncorhynchus mykiss) exposed to DEHP and butachlor. Gen. Comp. Endocrinol. (2015), http://dx.doi.org/10.1016/j.ygcen.2015.05.011
6
S. Ahmadivand et al. / General and Comparative Endocrinology xxx (2015) xxx–xxx
Fig. 4. Relative expression levels of boule gene in male rainbow trout affected by (A) DEHP (Control = Fish injected with 500 ll olive oil; DEHP = Fish injected with 500 ll olive oil containing 50 mg/kg b.w. DEHP); (B) butachlor exposure (Control = fish without butachlor exposure and butachlor = fish with 0.39 mg/L butachlor exposure) at three different sampling times (days 1, 5 and 10). Data are shown as mean ± SEM (n = 6–8). The asterisk indicates significant differences between the treatment and control groups (P < 0.05).
T-independent pathway in adult mice. In the present study, boule expression was significantly lower in the fish affected by DEHP and butachlor compared to control groups. This finding aligns with a mammalian study where decreased boule expression in testis of mice following exposure to Methoxychlor was reported (Du et al., 2014). In addition, and similar to our results, several works showed that exposure of fish to a variety of EDC’s such as butachlor and DEHP suppresses testosterone, and subsequently, reproductive success (Uren-Webster et al., 2010; Crago and Klaper, 2012; Chang et al., 2013). Therefore, effect of DEHP and butachlor on boule gene expression in testis of rainbow trout can be mediated by testosterone via AR present in Leydig or Sertoli cells. Furthermore, IGF1 expression can be affected by DEHP exposure (Boas et al., 2010). Therefore, this second pathway might be another way of suppressing boule expression by DEHP. To our knowledge, the effect of butachlor or other herbicides on IGF1 has not been previously reported, and therefore the mechanism of action of DEHP and butachlor on boule may be slightly different from each other. In conclusion, the present study demonstrated that DEHP and butachlor inhibits the progression of spermatogenesis in male trout, potentially by arresting meiosis, which may be due to down-regulation of boule gene expression through T and/or IGF1 via ERK1/2 signaling in T-independent pathways. Furthermore, these results confirmed that boule can be considered as a predictive marker to assess the meiotic efficiency, and subsequently to predict successful complete spermatogenesis. However, a further experiment needs to find out the regulating mechanisms and pathway of the boule gene expression. Acknowledgments The authors would like to thank Dr. Mohamad Ali Nematolahi for his kind help in supplying living fishes. We also appreciate Mrs. Aghdas Movassagh and Mr. Reza Ashori for the technical assistance. References Baker, J., Hardy, M.P., Zhou, J., Bondy, C., Lupu, F., Bellve, A.R., Efstratiadis, A., 1996. Effects of an Igf1 gene null mutation on mouse reproduction. Mol. Endocrinol. 10, 903–918. Boas, M., Frederiksen, H., Feldt-Rasmussen, U., Skakkebaek, N.E., Hegedus, L., Hilsted, L., Juul, A., Main, K.M., 2010. Childhood exposure to phthalates: associations with thyroid function, insulin-like growth factor I, and growth. Environ. Health Perspect. 118, 1458–1464.
Chang, C., Chen, Y.T., Yeh, S.D., Xu, Q., Wang, R.S., Guillou, F., Lardy, H., Yeh, S., 2004. Infertility with defective spermatogenesis and hypotestosteronemia in male mice lacking the androgen receptor in Sertoli cells. Proc. Natl. Acad. Sci. U.S.A. 101, 6876–6881. Chang, J., Gui, W., Wang, M., Zhu, G., 2013. Effects of butachlor on reproduction and hormone levels in adult zebrafish (Danio rerio). Exp. Toxicol. Pathol. 65, 205– 209. Cheng, Y.S., Kuo, P.L., Teng, Y.N., Kuo, T.Y., Chung, C.L., Lin, Y.H., Liao, R.W., Lin, J.S., Lin, Y.M., 2006. Association of spermatogenic failure with decreased Cdc25a expression in infertile men. Hum. Reprod. 21, 2346–2352. Crago, J., Klaper, R., 2012. A mixture of an environmentally realistic concentration of a phthalate and herbicide reduces testosterone in male fathead minnow (Pimephales promelas) through a novel mechanism of action. Aquat. Toxicol. 110–111, 74–83. Cravedi, J.P., Perdu-Durand, E., 2002. The phthalate diesters DEHP and DBP do not induce lauric acid hydroxylase activity in rainbow trout. Mar. Environ. Res. 54, 787–791. De Bethizy, J.D., Hayes, J.R., 1994. Metabolism: a determinant of toxicity. In: Hayes, A.W. (Ed.), Principles and Methods of Toxicology. Raven Press, New York, pp. 59–100. De Gendt, K., Swinnen, J.V., Saunders, P.T., Schoonjans, L., Dewerchin, M., Devos, A., Tan, K., Atanassova, N., Claessens, F., Lécureuil, C., Heyns, W., Carmeliet, P., Guillou, F., Sharpe, R.M., Verhoeven, G., 2004. A Sertoli cell-selective knockout of the androgen receptor causes spermatogenic arrest in meiosis. Proc. Natl. Acad. Sci. U.S.A. 101, 1327–1332. Del Buano, D., Scarponi, L., Amato, R.D., 2005. An analytical method for the simultaneous determination of butachlor and benoxacor in wheat and soil. J. Agric. Food Chem. 53, 4326–4330. Du, X., Zhang, H., Liu, Y., Yu, W., Huang, C., Li, X., 2014. Perinatal exposure to lowdose methoxychlor impairs testicular development in C57BL/6 mice. PLoS ONE 9, e103016. Eberhart, C.G., Maines, J.Z., Wasserman, S.A., 1996. Meiotic cell cycle requirement for a fly homologue of human Deleted in Azoospermia. Nature 381, 783–785. European Commission, 2003. EU Risk Assessment Report for 1,2Benzenedicarboxylic Acid, Di-C9-11-Branched Alkyl Esters, C10 Rich and Di‘‘Isodecyl’’ Phthalate (DIDP), 36. European Chemicals Bureau. Foresta, C., Ferlin, A., Garolla, A., Rossato, M., Barbaux, S., De Bortoli, A., 1997. Ychromosome deletions in idiopathic severe testiculopathies. J. Clin. Endocrinol. Metab. 82, 1075–1080. Froment, P., Vigier, M., Negre, D., Fontaine, I., Beghelli, J., Cosset, F.L., Holzenberger, M., Durand, P., 2007. Inactivation of the IGF1 receptor gene in primary Sertoli cells highlights the autocrine effects of IGF-1. J. Endocrinol. 194, 557–568. Fromme, H., Küchler, T., Otto, T., Pilz, K., Müller, J., Wenzel, A., 2002. Occurrence of phthalates and bisphenol A and F in the environment. Water Res. 36, 1429– 1438. Gonzalez, C.R., Dorfman, V.B., Vitullo, A.D., 2015. IGF1 regulation of BOULE and CDC25A transcripts via a testosterone-independent pathway in spermatogenesis of adult mice. Reprod. Biol. 15, 48–55. Guillette, L.J., Gunderson, M.P., 2001. Alterations in development of reproductive and endocrine systems of wildlife populations exposed to endocrine-disrupting contaminants. Reproduction 122, 857–864. Guo, H.R., Yin, L.C., Zhang, S.C., Feng, W.R., 2010. The toxic mechanism of high lethality of herbicide butachlor in marine flatfish flounder Paralichthys olivaceus. J. Ocean Univ. China 9, 257–264. Harrad, S., Ibarra, C., Robson, M., Melymuk, L., Zhang, X., Diamond, M., Douwes, J., 2009. Polychlorinated biphenyls in domestic dust from Canada, New Zealand, United Kingdom and United States: implications for human exposure. Chemosphere 76, 232–238.
Please cite this article in press as: Ahmadivand, S., et al. Boule gene expression underpins the meiotic arrest in spermatogenesis in male rainbow trout (Oncorhynchus mykiss) exposed to DEHP and butachlor. Gen. Comp. Endocrinol. (2015), http://dx.doi.org/10.1016/j.ygcen.2015.05.011
S. Ahmadivand et al. / General and Comparative Endocrinology xxx (2015) xxx–xxx Hedges, S.B., 2002. The origin and evolution of model organisms. Nat. Rev. Genet. 3, 838–849. Hernández-Díaz, S., Mitchell, A.A., Kelley, K.E., Calafat, A.M., Hauser, R., 2009. Medications as a potential source of exposure to phthalates in the U.S. population. Environ. Health Perspect. 117, 185–189. Heudorf, J., Mersch-Sundermann, V., Angerer, J., 2007. Phthalates: toxicology and exposure. Int. J. Hyg. Environ. Health 210, 623–634. Hewitson, T.D., Wigg, B., Becker, G.J., 2010. Tissue preparation for histochemistry: fixation, embedding and antigen retrieval for light microscopy. In: Hewitson, T.D., Darby, I.A. (Eds.), Histology Protocols. Humana Press, New York, pp. 3–18. Hoebeeck, J., Speleman, F., Vandesompele, J., 2007. Real-time quantitative PCR as an alternative to southern blot or fluorescence in situ hybridization for detection of gene copy number changes. In: Hilario, E., Mackay, J. (Eds.), Protocols for Nucleic Acid Analysis by Nonradioactive Probes, 353. Humana Press, Totowa, NJ. Hoopfer, E.D., Penton, A., Watts, R.J., Luo, L., 2008. Genomic analysis of Drosophila neuronal remodeling: a role for the RNA-binding protein Boule as a negative regulator of axon pruning. J. Neurosci. 28, 6092–6103. Ikeuchi, T., Todo, T., Kobayashi, T., Nagahama, Y., 2001. Two subtypes of androgen and progestogen receptors in fish testes. Comp. Biochem. Physiol. 129B, 449– 455. Jin, Y., Chen, R., Liu, W., Fu, Z., 2010. Effect of endocrine disrupting chemicals on the transcription of genes related to the innate immune system in the early developmental stage of zebrafish (Danio rerio). Fish Shellfish Immunol. 28, 854– 861. Jinno, S., Suto, K., Nagata, A., Igarashi, M., Kanaoka, Y., Nojima, H., Okayama, H., 1995. Cdc25a is a novel phosphatase functioning early in the cell cycle. EMBO J. 13, 1549–1556. Jobling, S., Reynolds, T., White, R., Parker, M.G., Sumpter, J.P., 1995. A variety of environmentally persistent chemicals including some phthalate plasticizers are weakly estrogenic. Environ. Health Perspect. 103, 582–587. Joiner, M.L., Wu, C.F., 2004. Nervous system function for the testis RNA-binding protein BOULE in Drosophila. J. Neurogenet. 18, 341–363. Junghans, M., Backhaus, T., Faust, M., Scholze, M., Grimme, L.H., 2003. Predictability of combined effects of eight chloroacetanilide herbicides on algal reproduction. Pest Manag. Sci. 59, 1101–1110. Kleiman, S.E., Lehavi, O., Hauser, R., Botchan, A., Paz, G., Yavetz, H., Yogev, L., 2011. CDY1 and BOULE transcripts assessed in the same biopsy as predictive markers for successful testicular sperm retrieval. Fertil. Steril. 95, 2297–2302. Knoll, A.H., Carroll, S.B., 1999. Early animal evolution: emerging views from comparative biology and geology. Science 284, 2129–2137. Kostova, E., Yeung, C.H., Luetjens, C.M., Brune, M., Nieschlag, E., Gromoll, J., 2007. Association of three isoforms of the meiotic BOULE gene with spermatogenic failure in infertile men. Mol. Hum. Reprod. 13, 85–93. Lasheidani, M., Balouchi, S.N., Keyvan, A., Jamili, S., Falakru, K., 2008. Effect of butachlor on density, volume and number of abnormal sperms in Caspian kutum (Rutilus frisii Kutum). Res. J. Environ. Sci. 2, 474–482. Li, M., Shen, Q., Xu, H., Wong, F.M., Cui, J., Li, Z., Hong, N., Wang, L., Zhao, H., Ma, B., Hong, Y., 2011. Differential conservation and divergence of fertility genes boule and dazl in the rainbow trout. PLoS ONE 6, e15910. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2DDCt method. Methods 25, 402–408. Luetjens, C.M., Xu, E.Y., Reijo Pera, R.A., Kamischke, A., Nieschlag, E., Gromoll, J., 2004. Association of meiotic arrest with lack of BOULE protein expression in infertile men. J. Clin. Endocrinol. Metab. 89, 1926–1933. Matta, S.L., Vilela, D.A., Godinho, H.P., França, L.R., 2002. The goitrogen 6-n-propyl2-thiouracil (PTU) given during testis development increases Sertoli and germ cell numbers per cyst in fish: the tilapia (Oreochromis niloticus) model. Endocrinology 143, 970–978. Mills, L.J., Chichester, C., 2005. Review of evidence: are endocrine-disrupting chemicals in the aquatic environment impacting fish populations? Sci. Total Environ. 43, 1–34. Onorato, T.M., Brown, P.W., Morris, P.L., 2008. Mono-(2-ethylhexyl) phthalate increases spermatocyte mitochondrial peroxiredoxin 3 and cyclooxygenase 2. J. Androl. 29, 293–303. Ou, Y.H., Chung, P.C., Chang, Y.C., Ngo, F.Q., Hsu, K.Y., Chen, F.D., 2000. Butachlor, a suspected carcinogen, alters growth and transformation characteristics of mouse liver cells. Chem. Res. Toxicol. 13, 1321–1325.
7
Pereira, J.J., Mercaldoallen, R., Kuropat, C., Luedke, D., Sennefelder, G., 1993. Effect of cadmium accumulation on serum vitellogenin levels and hepatosomatic and gonadosomatic indexes of winter flounder (Pleuronectes americanus). Arch. Environ. Contam. Toxicol. 24, 427–431. Petrovic, M., Eljarrat, E., López de Alda, M.J., Barceló, D., 2001. Analysis and environmental levels of endocrine-disrupting compounds in freshwater sediments. Trac-Trends Anal. Chem. 20, 637–648. Reddy, J.K., Azarnoff, D.L., Hignite, C.E., 1980. Hypolipidaemic hepatic peroxisome proliferators form a novel class of chemical carcinogens. Nature 283, 397–398. Reijo, R.A., Lee, T.Y., Salo, P., Alagappan, R., Brown, L.G., Rosenberg, M., Rozen, S., Jaffe, T., Straus, D., Hovatta, O., de la Chapelle, A., Silber, S., Page, D.C., 1995. Diverse spermatogenic defects in humans caused by Y chromosome deletions encompassing a novel RNA-binding protein gene. Nat. Genet. 10, 383–393. Schulz, R.W., de Franca, L.R., Lareyre, J.J., LeGac, F., Chiarini-Garcia, H., Nobrega, R.H., Miura, T., 2010. Spermatogenesis in fish. Gen. Comp. Endocrinol. 165, 390–411. Sharpe, R.M., Fisher, J.S., Millar, M.M., Jobling, S., Sumpter, J.P., 1995. Gestational and lactational exposure of rats to xenoestrogens results in reduced testicular size and sperm production. Environ. Health Perspect. 103, 1136–1143. Tollefsen, K.E., 2002. Interaction of estrogen mimics, singly and in combination, with plasma sex steroid-binding proteins in rainbow trout (Oncorhynchus mykiss). Aquat. Toxicol. 56, 215–225. Tomlin, C., 1994. The Pesticide Manual, 10th ed. Crop Protection Publications, British Crop Protection Council, Farnham, Surrey, UK. Tsai, M.Y., Yeh, S.D., Wang, R.S., Yeh, S., Zhang, C., Lin, H.Y., Tzeng, C.R., Chang, C., 2006. Differential effects of spermatogenesis and fertility in mice lacking androgen receptor in individual testis cells. Proc. Natl. Acad. Sci. U.S.A. 103, 18975–18980. Tu, W., Niu, L., Liu, L., Xu, C., 2013. Embryonic exposure to butachlor in zebrafish (Danio rerio): endocrine disruption, developmental toxicity and immunotoxicity. Ecotoxicol. Environ. Saf. 89, 189–195. Urano, J., Fox, M.S., Pera Reijo, R.A., 2005. Interaction of the conserved meiotic regulators, BOULE (BOL) and PUMILIO-2 (PUM2). Mol. Reprod. Dev. 71, 290– 298. Uren-Webster, T.M., Lewis, C., Filby, A.L., Paull, G.C., Santos, E.M., 2010. Mechanisms of toxicity of di(2-ethylhexyl) phthalate on the reproductive health of male zebrafish. Aquat. Toxicol. 99, 360–369. VanGompel, J.W., Xu, E.Y., 2010. A novel requirement in mammalian spermatid differentiation for the DAZ-family protein Boule. Hum. Mol. Genet. 19, 2360– 2369. Walker, W.H., 2009. Molecular mechanisms of testosterone action in spermatogenesis. Steroids 74, 602–607. Walker, W.H., 2010. Non-classical actions of testosterone and spermatogenesis. Philos. Trans. R. Soc. Lond. B Biol. Sci. 365, 1557–1569. Wang, R.S., Yeh, S., Tzeng, C.R., Chang, C., 2009. Androgen receptor roles in spermatogenesis and fertility: lessons from testicular cell-specific androgen receptor knockout mice. Endocr. Rev. 30, 119–132. Xu, E.Y., Lee, D.F., Klebes, A., Turek, P.J., Kornberg, T.B., Reijo Pera, R.A., 2003. Human BOULE gene rescues meiotic defects in infertile flies. Hum. Mol. Genet. 12, 169– 175. Xu, E.Y., Moore, F.L., Pera, R.A., 2001. A gene family required for human germ cell development evolved from an ancient meiotic gene conserved in metazoans. Proc. Natl. Acad. Sci. U.S.A. 98, 7414–7419. Xu, H.D., Wang, J.S., Li, M.H., Liu, Y., Chen, T., Jia, A.Q., 2015. (1)H NMR based metabolomics approach to study the toxic effects of herbicide butachlor on goldfish (Carassius auratus). Aquat. Toxicol. 159, 69–80. Yeh, S., Tsai, M.Y., Xu, Q., Mu, X.M., Lardy, H., Huang, K.E., Lin, H., Yeh, S.D., Altuwaijri, S., Zhou, X., Xing, L., Boyce, B.F., Hung, M.C., Zhang, S., Gan, L., Chang, C., 2002. Generation and characterization of androgen receptor knockout (ARKO) mice: an in vivo model forthe study of androgen functions in selective tissues. Proc. Natl. Acad. Sci. U.S.A. 99, 13498–13503. Yu, Y.L., Chen, Y.X., Luo, Y.M., Pan, X.D., He, Y.F., Wong, M.H., 2003. Rapid degradation of butachlor in wheat rhizosphere soil. Chemosphere 50, 771–774. Zhang, Q., Li, J., Li, Q., Li, X., Liu, Z., Song, D., Xie, Z., 2009. Cloning and characterization of the gene encoding the bovine BOULE protein. Mol. Genet. Genomics 281, 67–75. Zhu, L., Wei, L., Jinmiao, Z., Miao, W., Lilai, Y., Zijian, W., 2014. Butachlor causes disruption of HPG and HPT axes in adult female rare minnow (Gobiocypris rarus). Chem. Biol. Interact. 221, 119–126.
Please cite this article in press as: Ahmadivand, S., et al. Boule gene expression underpins the meiotic arrest in spermatogenesis in male rainbow trout (Oncorhynchus mykiss) exposed to DEHP and butachlor. Gen. Comp. Endocrinol. (2015), http://dx.doi.org/10.1016/j.ygcen.2015.05.011